CN108893417A - It is a kind of for the high flux screening system of high-nucleic acid yeast breeding and application - Google Patents
It is a kind of for the high flux screening system of high-nucleic acid yeast breeding and application Download PDFInfo
- Publication number
- CN108893417A CN108893417A CN201810815659.0A CN201810815659A CN108893417A CN 108893417 A CN108893417 A CN 108893417A CN 201810815659 A CN201810815659 A CN 201810815659A CN 108893417 A CN108893417 A CN 108893417A
- Authority
- CN
- China
- Prior art keywords
- yegfp
- nucleic acid
- hyg
- yeast
- yep
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of high flux screening system for high nucleic acid saccharomyces cerevisiae breeding is that the host cell by reporter plasmid YEp-Hyg B-yeGFP and containing YEp-Hyg B-yeGFP is constituted；Reporter plasmid YEp-Hyg B-yeGFP is ring-type, and from 5 ' to 3 ' are successively made of YEplac195 plasmid backbone, yeast enhanced green fluorescent protein gene yeGFP expression cassette, hygromycin B resistant gene expression cassette；The starting strain of host cell is the Saccharomyces cerevisiae for being higher than normal value through screening confirmation nucleic acid content.The invention also discloses screen bodies to tie up to the application in high-nucleic acid yeast engineering bacteria breeding.The screening system, which can make up traditional high-nucleic acid yeast breeding, can not directly reflect the defect of rna content, and can be eliminated easily by its unstability in yeast by continuous passage, be of great significance to the application of high-nucleic acid yeast in the food industry.
Description
Technical field
The present invention relates to microorganisms technical field more particularly to a kind of high throughput sieves for high nucleic acid saccharomyces cerevisiae breeding
Select system and application.
Background technique
Ribonucleic acid (Ribonucleic acid, RNA) not only executes biological function in the cell, but also is also important
New raw-food material, food additives and medicine intermediate etc..RNA and its degradation product or corresponding derivative are a variety of drugs
Effective component [Wang Nan, Cai Xiaxia, Li Yong extraneous nucleotide and studies on immune function are in progress Food Science, 2016,37 (5):
278-282.], improving etc. to the health-care efficacy of people and animal, immunity has positive effect.In recent years, RNA is through multienzyme
Promote the 5'-inosinic acid (5 '-IMP) and 5'-GMP (5 '-GMP) of orientation conversion preparation, referred to as the sapidity nucleotide disodium, tool
There are unique " delicate flavour " mouthfeel and the characteristic rich in nutrition, has become the enriched nutritive health ucleotides food of a new generation
Flavoring agent has very high economic value.
Ribonucleic acid is material base existing for life, and almost all of organism all contains ribonucleic acid, but is not
All living resources may serve to extract ribonucleic acid on a large scale, and that there are rna contents is low, resource is limited or industrial
On the problems such as can not preparing.Although producing RNA using the microorganisms direct fermentation such as such as bacillus subtilis has industrial value,
Since RNA is macromolecular substances, fermentation broth viscosity is high, and RNA is extracted from fermentation liquid at present technically still great difficulty, limits
Made its industrialized production [Qiao Binfu microorganism generates nucleosides and nucleic acid [J] industrial microorganism, 1998, (28):22-27.].
And as aliment security level (Generally Regarded As Safe, GRAS) microorganism, saccharomyces cerevisiae
(Saccharomyces cerevisiae) is to generally acknowledge the optimal source RNA, and not only its rna content is relatively high, but also is extracted
Bacterium protein afterwards still has very high application value, convenient for comprehensive utilization.It is concentrated currently, external yeast nucleic acid production is main
In Brazil, although domestic some Beer Brewage producers, which extract RNA using the waste yeast generated in beer production, can become useless
For treasured, the cycling and reutilization of resource is realized, but because material quality is poor, rna content is lower, and product quality is very unstable, relatively
Conversion ratio is low, influences greatly on subsequent production processing, therefore domestic medical producer can only be at high price from external as Brazil's import is a large amount of
High-content yeast rna product, market is in the situation that supply falls short of demand.Therefore, breeding high-nucleic acid yeast is imperative, and
Solve the problems, such as the basic of this.
Currently, being current one of research hotspot, Chinese patent application for the research of high nucleic acid saccharomyces cerevisiae
CN101760437A is disclosed a kind of " bread yeast with high nucleic acid content and preparation method thereof ", and this method expands the training of culture by control
The conditions such as time are supported, the nucleic acid containing the 20 weight % or more for being equivalent to bread microzyme body weight have been prepared, wherein RNA
Reach 9.5% or more.Chinese patent application CN102559522B discloses a kind of " bread yeast with high nucleic acid content and its preparation side
Method ", this method expands in Saccharomyces cerevisiae adds glutamine and aspartic acid in incubation, is prepared for relative to Saccharomyces cerevisiae
100 weight % of thallus, the nucleic acid containing 20 weight % or more, wherein RNA is greater than 12.0 weight %；Chinese patent application
CN106635851A is disclosed a kind of " selection of high nucleic acid S. cervisiae ", after this method is by primary dcreening operation and secondary screening, warp
Medium optimization carries out extension culture using lab scale and pilot scale fermentation process optimization, and acquisition rna content is 14.6%-
15.2% high nucleic acid S. cervisiae.Although this traditional breeding method avoids transgenosis problem, but rna content detects
Cumbersome, error is larger, is difficult to realize scale selection.
Breeding method improvement has also been made in other research institutions in the world, and Japanese Harashima seminar reports based on life
Long breeding measures construct the serious variation bacterial strain of growth, so by knocking out the RRN10 gene in upstream stimulating factor (UAF)
Ethyl methane sulfonate (EMS) mutagenesis is utilized afterwards, is screened 7 and is grown the repressor to improve, specific growth rate and rna content have
Different degrees of raising [Chuwattanakul V, Kim YH, Sugiyama M, Nishiuchi H, Miwa H, Kaneko Y,
Harashima S.Construction of a Saccharomyces cerevisiae strain with a high
level of RNA.J Biosci Bioeng.2011,112(1):1–7.].This Breeding Strategies based on growth realize height
Flux screening, however transgenosis problem involved in breeding process, need fairly simple using genetic background and have selection markers
Laboratory strains (monoploid) are used as breeding starting strain, and can not reflect that rna content changes.Therefore, presently, there are can not
The problems such as reflecting the high flux screening system and transgenosis of rna content variation, becomes and restrict the restricted of high-nucleic acid yeast breeding
Factor.
Saccharomyces cerevisiae at least generates three kinds of main RNA as other eucaryotes, there is rRNA (rRNA), letter
Make RNA (mRNA) and transfer RNA (tRNA), wherein rRNA content is most.Therefore, improving intracellular rRNA level is that building is high
The key of nucleic acid yeast bacterial strain.The rDNA of coding rRNA is generally randomly located at chromosome with about 150~200 duplicate units
On XII, rna plymerase i forms transcription initiation complex in rDNA promoter region and other subunits, instructs rDNA genetic transcription.
Rna plymerase i is most active eukaryon RNA polymerase, and the transcription initiation and extension efficiency to rDNA gene compare polymerase
II or III is obviously fast.But retrieval discovery：Played the role of in terms of rDNA genetic transcription using rna plymerase i efficiently this
Feature instructs reporter gene yeGFP to express by rDNA gene promoter, and building can cause rRNA synthesis variation by induction
Regulation disturbance, indirectly reflect rRNA changes of contents high-throughput scale selection system, and be applied to high-nucleic acid yeast sieve
The related article or patent of choosing have not been reported.
Summary of the invention
For deficiency existing for current high-nucleic acid yeast breeding, the present invention is based on rna plymerase is in the genetic transcription side rDNA
Efficiently this feature is played the role of in face, provides a kind of use that can reflect rna content variation and be avoided that transgenosis problem
High flux screening system in high-nucleic acid yeast breeding and its application in high-nucleic acid yeast engineering bacteria breeding, this is to high nucleic acid
The application of yeast in the food industry is of great significance.
High flux screening system of the present invention for high nucleic acid saccharomyces cerevisiae breeding, it is characterized in that：The screen body
Host cell of the system by reporter plasmid YEp-Hyg B-yeGFP and containing YEp-Hyg B-yeGFP is constituted；Wherein, the report
Plasmid YEp-Hyg B-yeGFP is the shuttle plasmid being implemented between saccharomyces cerevisiae and Escherichia coli, which is ring-type, from 5 ' to
3 ' successively by YEplac195 plasmid backbone, yeast enhanced green fluorescent protein gene yeGFP expression cassette, Hygromycin B resistant base
Because expression cassette forms；The starting strain of the host cell is the saccharomyces cerevisiae work for being higher than normal value through screening confirmation nucleic acid content
Industry bacterial strain.
In the above-mentioned high flux screening system for high nucleic acid saccharomyces cerevisiae breeding：The reporter plasmid YEp-Hyg B-
YEplac195 plasmid in yeGFP is yeast episomal plasmid, the ori containing 2 μ plasmid of yeast.
In the above-mentioned high flux screening system for high nucleic acid saccharomyces cerevisiae breeding：The reporter plasmid YEp-HygB-
Green fluorescence protein gene yeGFP expression cassette in yeGFP from upstream to downstream successively by rDNA promoter, internal ribosome into
Angle of striking IRES (Internal ribosome entry site) sequence, yeGFP gene expression frame, poly (T) sequence, rDNA
Terminator composition；Wherein, rDNA promoter sequence such as SEQ ID No:Shown in 1, IRES sequence such as SEQ ID No:Shown in 2,
YeGFP gene expression frame sequence such as SEQ ID No:Shown in 3, poly (T) sequence such as SEQ IDNo:Shown in 4, rDNA terminator sequence
Column such as SEQ ID No:Shown in 5.
In the above-mentioned high flux screening system for high nucleic acid saccharomyces cerevisiae breeding：The reporter plasmid YEp-HygB-
Hygromycin B resistant gene expression cassette in yeGFP is made of TEF1 promoter, hygromycin B (Hyg B) gene, TEF1 terminator；
Wherein, TEF1 promoter sequence such as SEQ ID NO:Shown in 6, hygromycin B (Hyg B) gene order such as SEQ ID NO:Shown in 7,
TEF1 terminator sequence such as SEQ ID NO:Shown in 8.
In the above-mentioned high flux screening system for high nucleic acid saccharomyces cerevisiae breeding：The starting strain of the host cell is excellent
Choosing is the relatively high yeast strain CGMCC No.9084 of nucleic acid content.
Reporter plasmid YEp-HygB- in high flux screening system of the present invention for high nucleic acid saccharomyces cerevisiae breeding
The construction method of yeGFP, step are：
(1) hygromycin B resistant gene expression cassette is expanded using the method for PCR, then utilizes digestion with restriction enzyme tide
Mycin B tolerant gene expression frame and YEplac195, connection liquid are converted bacillus coli DH 5 alpha, select transformant, verified using PCR,
Obtain recombinant plasmid YEp-Hyg B；
(2) it is terminated using method amplification rDNA promoter, IRES sequence, yeGFP gene, poly (T) and the rDNA of PCR
Son obtains fusion DNA vaccine product rDNAp-IRES-yeGFP-poly (T)-rDNAt, then utilizes digestion with restriction enzyme
RDNAp-IRES-yeGFP-poly (T)-rDNAt and YEp-Hyg B, connection liquid convert bacillus coli DH 5 alpha, select transformant,
It is verified using PCR method, obtains recombinant plasmid YEp-Hyg B-yeGFP.
Contain reporter plasmid YEp- in high flux screening system of the present invention for high nucleic acid saccharomyces cerevisiae breeding
The construction method of the host cell of HygB-yeGFP, step are：
(1) the reporter plasmid YEp-Hyg B-yeGFP is utilized into PEG-LiAc conversion method, electrotransformation or protoplast
Conversion method conversion is higher than the Saccharomyces cerevisiae of normal value through screening confirmation nucleic acid content；
(2) it sets and screens positive transformant containing the screening and culturing medium using hygromycin B, and extract counter from recombination yeast mention
Yeast plasmid does PCR verifying, obtains the host cell containing YEp-Hyg B-yeGFP；
(3) using sepectrophotofluorometer detection method, multiple labeling analyzer detection method or fluorescence microscope detection method to place
Chief cell carries out fluorescence intensity detection, and the high flux screening for being used for high-nucleic acid yeast breeding is determined according to GFP protein expression situation
The host cell of system.
Wherein, preferred embodiment is：Reporter plasmid YEp-Hyg B-yeGFP described in step (1) utilizes PEG-
The relatively high yeast strain CGMCC No.9084 of LiAc conversion method transformed nucleic acid content；Fluorescence intensity detects in step (3)
Method selects multiple labeling analyzer detection method, and concrete operation step is：Take 1mL bacteria suspension to be measured in 1.5mL EP pipe,
12000rpm is centrifuged 2min and abandons supernatant, thallus ddH2Residual media, then plus 1mL ddH are washed off in O cleaning twice2O, which is vortexed, to be shaken
It mixes, draws 200 μ L and be transferred in 96 hole enzyme mark pipe of black, be placed in multiple labeling analyzer, setting absorbs light 485nm, swashs
Luminous 535nm is detected, single-cell fluorescence level fluorescent value/OD600To indicate.
High flux screening system of the present invention for high nucleic acid saccharomyces cerevisiae breeding is selected in high-nucleic acid yeast engineering bacteria
Application in educating, which is characterized in that the application method is：
(1) ultraviolet mutagenesis, ethylmethane sulfonate (EMS) mutagenesis or atmospheric pressure at room plasma are used
(Atmosphericand Room Temperature Plasma, ARTP) method of mutagenesis mutagenesis contains YEp-Hyg B-yeGFP
Host cell；
(2) yeast cells of fluorescence intensity raising is sub-elected using the scale of flow cytometer high throughput；
(3) the strain cell nucleic acid of fluorescence intensity raising is measured using perchloric acid method's extraction or Trizol method extracting mode
Content；
(4) make breeding by the way of continuously cultivating, transferring 10 times or more in the YPD fluid nutrient medium in no screening pressure
The reporter plasmid YEp-Hyg B-yeGFP high flux screening system contained in high-nucleic acid yeast engineering bacteria out is eliminated, and is obtained not
The high-nucleic acid yeast engineering bacteria of the system containing high flux screening.
In above-mentioned application, preferred embodiment is：
Step (1) contains the place of YEp-Hyg B-yeGFP using atmospheric pressure at room plasma (ARTP) method of mutagenesis mutagenesis
Chief cell, method and condition are：1mL bacterium solution is taken, suspension is in 1.5mL EP pipe, 8000r/min, is centrifuged 2min, discards supernatant
Liquid；After brine 2 times, cell concentration is made 10 using the normal saline dilution containing 5% glycerol6~107Between
Bacteria suspension, take 10 μ L bacteria suspensions to be spread evenly across sterile slide surface；Then slide glass is placed in ARTP mutation breeding system
Microscope carrier on, be placed in ARTP mutation breeding instrument and carry out mutagenic treatment, mutagenesis instrument working gas be 99.99% high-purity helium, penetrate
Frequency power is 100W, helium gas flow 10SLM, processing time setting 120s, between sample and plasma emission source away from
From for 3mm；Sample treatment finishes, and slide glass is put into the EP pipe equipped with 1mL physiological saline with tweezers, continues sufficiently to vibrate
1min sufficiently elutes the thallus being attached on slide glass and forms bacteria suspension；Control group directly adds 10 μ L bacterium solutions to 1mL physiological saline
In；
Step (2) implements the side that high-throughput scale sub-elects the yeast cells of fluorescence intensity raising using flow cytometer
Method is：By host cell suspension, that is, control cell suspension containing YEp-Hyg B-yeGFP and step (1) process without mutagenesis
The cell suspension of ARTP mutagenesis, 8000r/min, is centrifuged 2min, liquid is discarded supernatant, then with 500 μ L1 × PBS solution weight respectively
It is outstanding, it is separately added into corresponding fluorescein-labeled antibody and is washed 3 times with 1 × PBS solution in 25 DEG C of incubation 1h, be resuspended in 500 μ
L 1×PBS；Then after crossing 40 μm of strainers, upper hypervelocity fluidic cell separation system (MoFlo XDP) is sorted, and control is thin
Born of the same parents' suspension fluorescent value is set as threshold value, can sub-elect the cell that fluorescent value is greater than threshold value, and the yeast of as fluorescence intensity raising is thin
Born of the same parents；
The content for the strain cell nucleic acid that step (3) is improved using Trizol method extracting mode measurement fluorescence intensity, specifically
Method is：Host cell containing reporter plasmid and step (2) fluorescent value are greater than the cell of threshold value mould containing 200mg/L tide
It is cultivated 12~24 hours in the YPD fluid nutrient medium of plain B, switching bacterium solution to the fresh YPD liquid containing 200mg/L hygromycin B
In body culture medium, and controlling cell concentration is OD600≈ 0.1, in 30 DEG C of shake cultures to final concentration of cells OD600≈ 1.0, centrifugation
Collect cell；By every 5 × 1070.5ml Trizol is added in bacterial cell, utilizes liquid nitrogen grinding；Using the raw work UNIQ-10 in Shanghai
Pillar Trizol total serum IgE extraction agent box and its operating procedure carry out RNA extracting, and the RNA of extraction measures extinction at 260nm
Value.
High flux screening system established by the present invention for high-nucleic acid yeast breeding can make up traditional high nucleic acid ferment
Female breeding can not directly reflect the defect of rna content, will necessarily become the main method of high-nucleic acid yeast breeding.In addition, this hair
The bright high flux screening system unique advantage for high nucleic acid saccharomyces cerevisiae breeding also resides in, which is building
On the high copy plasmid episomal for being suitable for Saccharomyces cerevisiae, after obtaining high-nucleic acid yeast bacterial strain, can by its
Unstability in yeast can be eliminated easily by continuous passage, easy to operate, avoid transgenosis problem, this is to high core
The application of acid leaven in the food industry is of great significance, and economic value great market has a extensive future.
Detailed description of the invention
Fig. 1 is that hygromycin B gene expression cassette is building up to the PCR proof diagram on YEplac195 in embodiment 1
Wherein M：1kb DNA marker；1：Bacterium colony PCR expansion is carried out using primer Hyg B-F and pJ-TEF1-Nco I-R
The Hyg B-TEF1 increased terminates mrna exon fragment.
Fig. 2 is that each element of yeGFP gene expression frame is building up to the PCR proof diagram on YEp-Hyg B in embodiment 1
Wherein M：1kb DNA marker；1：It is arrived using primer Asc I-yeGFP-F and rDNAt-Hind III-R amplification
YeGFP-poly (T)-rDNA terminate mrna exon fragment.
Fig. 3 is the fluorescence intensity detection figure for the Saccharomyces cerevisiae that expression has high flux screening system in embodiment 2.
Fig. 4 is to be surveyed in embodiment 3 using the bacterial strain nucleic acid content that the fluorescence intensity that high flux screening System For Screening arrives improves
Determine result.
Specific embodiment
Technical solution of the present invention is described in detail below in conjunction with embodiment.These embodiments are merely to illustrate this
Invention, and be not construed as limiting the scope of the invention.Without departing from the spirit and substance of the case in the present invention, to present invention side
Modifications or substitutions made by method, step or condition are accordingly to be regarded as falling into the scope of the present invention.
Unless otherwise specified, embodiment is according to conventional laboratory conditions, such as reference Sam brook Molecular Cloning: A Laboratory hand
Volume (Sam brook J&Russell DW, Molecular cloning:A laboratory manual, 2001), or according to
The condition of product description suggestion.
Starting strain used in the present embodiment --- yeast strain CGMCC No.9084 is protected purchased from Chinese microorganism strain
It hides administration committee's common micro-organisms center (CGMCC).The plasmid YEplac195 being related to is purchased from BioVector NTCC preservation
The heart, construction method is referring to document [Gietz RD, Sugino A.New yeast-Escherichia coli shuttle
vectors constructed with in vitro mutagenized yeast genes lacking six-base
pair restriction sites.Gene.1988,74(2):527-534.]。
Embodiment 1：The building of reporter plasmid YEp-Hyg B-yeGFP
1, the plasmid YEp-Hyg B building containing hygromycin B resistant gene
(1) building of hygromycin B resistant gene expression cassette
Using plasmid YEp-CH as template, primer Sal I-pJ-TEF1-F is utilized
(5 '-CATTTCCCCGAAAAGTGCCACCTGACGTCGACATGGAGGCCCAGAATACC-3 ') and pJ-TEF1-
Nco I-R (5 '-CCTCCATGGCAGTATAGCGACCAGCATTC-3 ') amplification 1500bp's or so has Sal I and Nco I
The hygromycin B gene expression cassette Sal I-TEF1p-Hyg B-TEF1t-NcoI of restriction enzyme site, PCR amplification condition are 95 DEG C of pre- changes
Property 3min, 95 DEG C of denaturation 45s, 52 DEG C of annealing 15s, 72 DEG C of extension 1.5min, 30 circulation, 72 DEG C eventually extend 5min.
(2) the plasmid YEp-Hyg B building containing hygromycin B resistant gene
Utilize Sal I and Nco I digested plasmid YEplac195 and hygromycin B gene expression cassette Sal I-TEF1p-HygB-
TEF1t-Nco I, then connects, and converts bacillus coli DH 5 alpha, selects transformant and extracts plasmid, utilizes primer
Hyg B-F (5 '-ATGCCTGAACTCACCGCG-3 ') and
PJ-TEF1-Nco I-R (5 '-CCTCCATGGCAGTATAGCGACCAGCATTC-3 ') carries out bacterium colony PCR verifying,
PCR amplification condition is 95 DEG C of initial denaturation 3min, and 95 DEG C of denaturation 45s, 56 DEG C of annealing 15s, 72 DEG C of extension 2min, 30 recycle, 72
DEG C eventually extend 5min.The band (as shown in Figure 1) to 1300bp or so is expanded, illustrates that hygromycin B expression cassette is successfully connected to
On YEplac195, the recombinant plasmid YEp-HygB containing hygromycin B gene expression cassette is obtained.
2, the building of reporter plasmid YEp-Hyg B-yeGFP
(1) amplification of each element of reporter gene yeGFP expression cassette
1. the amplification of rDNA promoter：Using the genomic DNA of saccharomyces cerevisiae Y08 as template, primer SacI-rDNAp- is utilized
F
(5 '-CATTTCCCCGAAAAGTGCCACCTGACGTCGACATGGAGGCCCAGAATACC-3 ') and rDNAp-
IRES-R
(5 '-CTTTAGCGGCTTAACTGTGCCCTCCATGGCAGTATAGCGACCAGCATTCAC-3 ') carry out PCR expansion
Increase the rDNA promoter fragment with IRES element homology arm for obtaining 600bp or so, PCR amplification condition is 95 DEG C of initial denaturations
3min, 95 DEG C of denaturation 45s, 52 DEG C of annealing 15s, 72 DEG C of extension 40s, 30 circulations, 72 DEG C extend 5min eventually.
2. the amplification of IRES segment：Pass through NCBI (National Center for Biotechnology
Information the sequence of CrPV intergenic region (IGR) IRES) is consulted in Genome, IRES sequence is synthesized by full genome
Mode obtain, then using the plasmid pUC57-IRES containing IRES sequence as template, utilize primer rDNAp-IRES-F (5 '-
GAAAGCAGTTGAAGACAAGTTCGAAAAGAGAAAGCAAAAATGTGATCTTGC-3 ') and Asc I-IRES-R (5 '-
TTGGCGCGCCTTGAAATGTAGCAGGTAAATTTC-3 ') carry out PCR amplification obtain 250bp or so with rDNA promoter
The IRES element segment of element homology arm, PCR amplification condition be 95 DEG C of initial denaturations 3min, 95 DEG C of denaturation 45s, 52 DEG C of annealing 15s,
72 DEG C of extension 20s, 30 circulations, 72 DEG C extend 5min eventually.
3. the amplification of rDNA promoter fragment and IRES segment composition：It is opened respectively with the rDNA with IRES element homology arm
Promoter fragment and IRES element segment with rDNA promoter element homology arm are template, utilize primer Sac I-rDNAp-F
With Asc I-IRES-R, the Sac I-rDNAp-IRES- with Sac I and Asc I restriction enzyme site of fusion amplification 850bp or so
Asc I segment, PCR amplification condition are 95 DEG C of initial denaturation 3min, 95 DEG C of denaturation 45s, 52 DEG C of annealing 15s, 72 DEG C of extension 50s, 30
A circulation, 72 DEG C extend 5min eventually.
4. the amplification of yeGFP gene open reading expression cassette：Using laboratory preservation plasmid pJFE3-yeGFP plasmid as mould
Plate utilizes primer Asc I-yeGFP-F (5 '-TTGGCGCGCCATGTCTAAAGGTGAAGAATTA-3 ') and yeGFP-Xho I-
R (5 '-CCGCTCGAGTTATTTGTACAATTCATCCATACC-3 ') carries out PCR amplification, obtains the yeast enhancing of 714bp or so
Type green fluorescent protein yeGFP gene open reading frame, amplification condition are 95 DEG C of initial denaturation 3min, and 95 DEG C of denaturation 45s, 52 DEG C are moved back
Fiery 15s, 72 DEG C of extension 50s, 30 circulations, 72 DEG C extend 5min eventually.
The acquisition of poly 5. (T) sequence：Due to being difficult to obtain poly (T) sequence by way of PCR, the present invention utilizes people
The mode of work synthesis constructs on plasmid pUC57-poly (T), then utilizes Xho I and Xba I double digestion, and acquisition contains digestion
Site poly (T).
6. the amplification of rDNA termination sub-piece：Using the genomic DNA of saccharomyces cerevisiae Y08 as template, primer rDNAt- is utilized
Xba I-F (5 '-CTAGTCTAGATTTTTATTTCTTTCTAAGTGGGTAC-3 ') and rDNAt-Hind III-R (5 '-
GATGCTAGCTTGTGAAAGCCCTTCTCTTTC-3 ') PCR amplification is carried out, obtain 300bp or so contains Xba I and Hind
The segment of the rDNA terminator in III digestion site, amplification condition are 95 DEG C of initial denaturation 3min, and 95 DEG C of denaturation 45s, 50 DEG C are annealed
15s, 72 DEG C of extension 25s, 30 circulations, 72 DEG C extend 5min eventually.
Wherein：
Above-mentioned rDNA promoter sequence such as SEQ ID No:Shown in 1；
Above-mentioned IRES sequence such as SEQ ID No:Shown in 2；
Above-mentioned yeGFP gene expression frame sequence such as SEQ ID No:Shown in 3；
Above-mentioned poly (T) sequence such as SEQ ID No:Shown in 4.
Above-mentioned rDNA terminator sequence such as SEQ ID No:Shown in 5.
(2) building of reporter plasmid YEp-Hyg B-yeGFP
Each element in recombinant plasmid YEp-Hyg B and reporter gene expression frame is used into corresponding restriction enzyme enzyme respectively
It cuts, is then attached, convert Escherichia coli, then verified accordingly, connected by 4 times, convert bacillus coli DH 5 alpha,
It selects transformant and extracts plasmid, carry out PCR with primer Asc I-yeGFP-F and rDNAt-HindIII-R using last transformant
It verifies (as shown in Figure 2), PCR amplification condition is 94 DEG C of initial denaturation 10min, and 94 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C extend
5min, 30 circulations, 72 DEG C extend 10min eventually.
PCR amplification goes out the band of 1530bp or so, illustrates yeGFP gene open reading frame, poly (T) and rDNA terminator
It is successfully connected on YEp-Hyg B, the final recombinant plasmid YEp-Hyg B-yeGFP for obtaining new expression vector, the expression carries
Body contains the expression cassette of hygromycin B resistant gene and the expression cassette of reporter gene yeGFP, and wherein yeGFP gene starts in rDNA
Under the control of son and terminator, its transcription and translation are realized by addition IRES sequence and poly (T) sequence.
Embodiment 2：S. cerevisiae host cell building containing reporter plasmid
1, reporter plasmid transformed saccharomyces cerevisiae host cell
By control plasmid YEp-Hyg B and reporter plasmid YEp-Hyg B-yeGFP conversion early period by primary dcreening operation confirmation nucleic acid
The relatively high yeast strain CGMCC No.9084 (present invention is named as Y08) of content, used method for transformation are PEG-
The Saccharomyces cerevisiae transformant method that LiAc is mediated selects conversion using the YPD plate screening transformant containing 200mg/L hygromycin B
Then son, the anti-upgrading grain from yeast carry out PCR amplification using primer Sac I-rDNAp-F and URA3-Xho I-R, PCR expands
Increasing condition is 95 DEG C of initial denaturation 3min, and 95 DEG C of denaturation 45s, 52 DEG C of annealing 15s, 72 DEG C of extension 1.5min, 30 recycle, 72 DEG C of ends
Extend 5min.PCR amplification goes out the band of about 1400bp or so, illustrates expression vector successful conversion into saccharomyces cerevisiae.
2, fluorescence intensity detects
The control group bacterial strain of picking plate streaking separation is named as Y081 and (does not contain the empty matter of yeGFP gene expression frame
Grain YEp-Hyg B) and experimental group bacterial strain, being named as Y082, (i.e. expression has yeGFP gene, contains reporter plasmid YEp-Hyg B-
YeGFP saccharomyces cerevisiae single colonie) is inoculated into the YPD containing 200mg/L hygromycin B, vibrates activation culture twice in 30 DEG C,
It is incubated overnight 10 hours or so, takes 1mL bacteria suspension to be measured in 1.5mL EP pipe, 12000rpm is centrifuged 2min and abandons supernatant, thallus
Use ddH2Residual media is washed off in O cleaning twice, adds 1mL ddH2O is vortexed to shake and mix, and draws 200 μ L and is transferred to 96 hole of black
In enzyme mark pipe, green fluorescent protein (GFP) intensity is detected with multiple labeling analyzer (PekinElmer), and setting absorbs light 485nm,
Exciting light 535nm is detected, single-cell fluorescence level fluorescent value/OD600To indicate.It is detected (as shown in Figure 3), is compareed
Group bacterial strain fluorescence intensity is lower, and expression has the experimental group bacterial strain fluorescence intensity of yeGFP gene higher.Illustrate that yeGFP gene exists
Transcription is realized under the action of rDNA promoter and terminator and poly (T), is realized under the translation Initiation Function effect of IRES
Translation, has been successfully established the high flux screening system for high-nucleic acid yeast breeding in Saccharomyces cerevisiae.
Embodiment 3：System For Screening high-nucleic acid yeast engineering bacteria is screened using novel high flux
1, contain the host cell of reporter plasmid using ARTP mutagenesis
(1) bacterial strain activates：Will expression have high flux screening system Saccharomyces cerevisiae Y082 be seeded to containing
The YPD plate of 200mg/L hygromycin B, 30 DEG C of inversions are cultivated 2~3 days, and the YPD containing 200mg/L hygromycin B is then seeded to
In liquid, shaken cultivation 12~24 hours, it is dense that switching bacterium solution controls thallus into the fresh YPD containing 200mg/L hygromycin B
Spend OD6000.1,30 DEG C of culture shake culture a few hours of ≈ control thallus final concentration OD600Within ≈ 1.0, go out as ARTP mutagenesis
Bacterium germination strain.
(2) ARTP mutagenesis：1mL bacterium solution is taken, suspension is in 1.5mL EP pipe, 8000r/min, is centrifuged 2min, discards supernatant
Liquid.After brine 2 times, cell concentration is made 10 using the normal saline dilution containing 5% glycerol6~107Between
Bacteria suspension, take 10 μ L bacteria suspensions to be spread evenly across sterile slide surface.Then slide glass is placed in ARTP mutation breeding system
Microscope carrier on, be placed in ARTP mutation breeding instrument (Wuxi Siqingyuan Biotechnology Co., Ltd.) and carry out mutagenic treatment, mutagenesis instrument
Working gas be 99.99% high-purity helium, radio-frequency power 100W, helium gas flow 10SLM, processing time setting 120s,
The distance between sample and plasma emission source are 3mm.Sample treatment finishes, and slide glass is put into equipped with 1mL physiology with tweezers
In the EP pipe of salt water, continues sufficiently to vibrate 1min, the thallus being attached on slide glass is sufficiently eluted and forms bacteria suspension, in control group
Directly plus 10 μ L bacterium solutions are into 1mL physiological saline.
2, the yeast cells that bacterium high throughput scale sorting fluorescence intensity improves after mutagenesis
By the host cell suspension, that is, control cell suspension and step (1) containing YEp-Hyg B-yeGFP without mutagenesis
By the cell suspension of ARTP mutagenesis, 8000r/min is centrifuged 2min, liquid is discarded supernatant, then with 500 μ L 1 × PBS solution weights
It is outstanding, it is separately added into corresponding fluorescein-labeled antibody and is washed 3 times, be resuspended in using 1 × PBS solution in 25 DEG C of incubation 1h
500μL 1×PBS.Then after crossing 40 μm of strainers, upper hypervelocity fluidic cell separation system (MoFloXDP) is sorted, and will be compareed
Cell suspension fluorescent value is set as threshold value, and the cell that the fluorescent value being sorted into is greater than threshold value is cultivated in YPD.Finally it is sorted into one
The Wine brewing yeast strain that strain fluorescence intensity improves, is named as Wine brewing yeast strain Y083.
3, the bacterial strain nucleic acid content measurement that fluorescence intensity improves
Starting strain Y082 and fluorescence intensity the bacterial strain Y083 improved are connected to the YPD liquid containing 200mg/L hygromycin B
In culture medium, shaken cultivation 12~24 hours, switching bacterium solution controlled cell into the fresh YPD containing 200mg/L hygromycin B
Concentration is OD600≈ 0.1 or so, 30 DEG C of culture shake culture a few hours, as final concentration of cells OD600≈ 1.0 or so collects 1mL
Bacterium solution extracts RNA, concrete operations ginseng using UNIQ-10 pillar Trizol total serum IgE extraction agent box (Shanghai Sheng Gong Co., Ltd)
It is carried out according to product description, the RNA of extraction measures light absorption value at 260nm, and after measured, the nucleic acid content of Y083 is higher than bacterium germination
Strain Y082 (as shown in Figure 4), illustrating that the fluorescence intensity arrived by the high flux screening System For Screening improves bacterial strain Y083 is nucleic acid
Content improves bacterial strain.
Embodiment 4：The elimination of high flux screening system
The Wine brewing yeast strain Y083 that fluorescence intensity is improved and verified nucleic acid content is improved is connected to no hygromycin B
YPD fluid nutrient medium in, continuous culture, switching 10 times or more make the report contained in the high-nucleic acid yeast engineering bacteria selected
Plasmid YEp-Hyg B-yeGFP high flux screening system is accused to eliminate, it is final to obtain the high nucleic acid ferment for being free of high flux screening system
Mother strains.
Sequence table
<110>Qilu University of Technology, Shandong sage's fine jade biology Co., Ltd
<120>It is a kind of for the high flux screening system of high-nucleic acid yeast breeding and application
<141> 2018-7-10
<160>8
<210> 1
<211> 600
<212> DNA
<213>Artificial sequence
<221>RDNA promoter sequence
<222>（1）…（600）
<400> 1
agaaaacata gaatagttac cgttattggt aggagtgtgg tggggtggta tagtccgcat 60
tgggatgtta ctttcctgtt atggcatgga tttcccttta gggtctctga agcgtatttc 120
cgtcaccgaa aaaggcagaa aaagggaaac tgaagggagg atagtagtaa agtttgaatg 180
gtggtagtgt aatgtatgat atccgttggt tttggtttcg gttgtgaaaa gttttttggt 240
atgatatttt gcaagtagca tatatttctt gtgtgagaaa ggtatatttt gtatgttttg 300
tatgttcccg cgcgtttccg tattttccgc ttccgcttcc gcagtaaaaa atagtgagga 360
actgggttac ccggggcacc tgtcactttg gaaaaaaaat atacgctaag atttttggag 420
aatagcttaa attgaagttt ttctcggcga gaaatacgta gttaaggcag agcgacagag 480
agggcaaaag aaaataaaag taagatttta gtttgtaatg ggaggggggg tttagtcatg 540
gagtacaagt gtgaggaaaa gtagttggga ggtacttcat gcgaaagcag ttgaagacaa 600
<210> 2
<211> 180
<212> DNA
<213>Artificial sequence
<221>IRES sequence
<222>（1）…（180）
<400> 2
aaagcaaaaa tgtgatcttg cttgtaaata caattttgag aggttaataa attacaagta 60
gtgctatttt tgtatttagg ttagctattt agctttacgt tccaggatgc ctagtggcag 120
ccccacaata tccaggaagc cctctctgcg gtttttcaga ttaggtagtc gaaaaaccta 180
<210> 3
<211> 717
<212> DNA
<213>Artificial sequence
<221>YeGFP gene expression frame sequence
<222>（1）…（717）
<400> 3
atgtctaaag gtgaagaatt attcactggt gttgtcccaa ttttggttga attagatggt 60
gatgttaatg gtcacaaatt ttctgtctcc ggtgaaggtg aaggtgatgc tacttacggt 120
aaattgacct taaaatttat ttgtactact ggtaaattgc cagttccatg gccaacctta 180
gtcactactt tcggttatgg tgttcaatgt tttgctagat acccagatca tatgaaacaa 240
catgactttt tcaagtctgc catgccagaa ggttatgttc aagaaagaac tatttttttc 300
aaagatgacg gtaactacaa gaccagagct gaagtcaagt ttgaaggtga taccttagtt 360
aatagaatcg aattaaaagg tattgatttt aaagaagatg gtaacatttt aggtcacaaa 420
ttggaataca actataactc tcacaatgtt tacatcatgg ctgacaaaca aaagaatggt 480
atcaaagtta acttcaaaat tagacacaac attgaagatg gttctgttca attagctgac 540
cattatcaac aaaatactcc aattggtgat ggtccagtct tgttaccaga caaccattac 600
ttatccactc aatctgcctt atccaaagat ccaaacgaaa agagagacca catggtcttg 660
ttagaatttg ttactgctgc tggtattacc catggtatgg atgaattgta caaataa 717
<210> 4
<211> 50
<212> DNA
<213>Artificial sequence
<221>Poly (T) sequence
<222>（1）…（50）
<400> 4
tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt 50
<210> 5
<211> 284
<212> DNA
<213>Artificial sequence
<221>RDNA terminator sequence
<222>（1）…（284）
<400> 5
tttttatttc tttctaagtg ggtactggca ggagccgggg cctagtttag agagaagtag 60
actgaacaag tctctataaa ttttatttgt cttaagaatt ctatgatccg ggtaaaaaca 120
tgtattgtat atatctatta taatatacga tgaggatgat agtgtgtaag agtgtaccat 180
ttactaatgt atgtaagtta ctatttacta tttggtcttt ttatttttta tttttttttt 240
ttttttcgtt gcaaagatgg gttgaaagag aagggctttc acaa 284
<210> 6
<211> 344
<212> DNA
<213>Artificial sequence
<221>TEF1 promoter sequence
<222>（1）…（344）
<400> 6
gacatggagg cccagaatac cctccttgac agtcttgacg tgcgcagctc aggggcatga 60
tgtgactgtc gcccgtacat ttagcccata catccccatg tataatcatt tgcatccata 120
cattttgatg gccgcacggc gcgaagcaaa aattacggct cctcgctgca gacctgcgag 180
cagggaaacg ctcccctcac agacgcgttg aattgtcccc acgccgcgcc cctgtagaga 240
aatataaaag gttaggattt gccactgagg ttcttctttc atatacttcc ttttaaaatc 300
ttgctaggat acagttctca catcacatcc gaacataaac aacc 344
<210> 7
<211> 804
<212> DNA
<213>Artificial sequence
<221>Hygromycin B（Hyg B）Gene order
<222>（1）…（804）
<400> 7
atgtcgaaag ctacatataa ggaacgtgct gctactcatc ctagtcctgt tgctgccaag 60
ctatttaata tcatgcacga aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc 120
accaaggaat tactggagtt agttgaagca ttaggtccca aaatttgttt actaaaaaca 180
catgtggata tcttgactga tttttccatg gagggcacag ttaagccgct aaaggcatta 240
tccgccaagt acaatttttt actcttcgaa gacagaaaat ttgctgacat tggtaataca 300
gtcaaattgc agtactctgc gggtgtatac agaatagcag aatgggcaga cattacgaat 360
gcacacggtg tggtgggccc aggtattgtt agcggtttga agcaggcggc agaagaagta 420
acaaaggaac ctagaggcct tttgatgtta gcagaattgt catgcaaggg ctccctatct 480
actggagaat atactaaggg tactgttgac attgcgaaga gcgacaaaga ttttgttatc 540
ggctttattg ctcaaagaga catgggtgga agagatgaag gttacgattg gttgattatg 600
acacccggtg tgggtttaga tgacaaggga gacgcattgg gtcaacagta tagaaccgtg 660
gatgatgtgg tctctacagg atctgacatt attattgttg gaagaggact atttgcaaag 720
ggaagggatg ctaaggtaga gggtgaacgt tacagaaaag caggctggga agcatatttg 780
agaagatgcg gccagcaaaa ctaa 804
<210> 8
<211> 198
<212> DNA
<213>Artificial sequence
<221>TEF1 terminator sequence
<222>（1）…（198）
<400> 8
actgacaata aaaagattct tgttttcaag aacttgtcat ttgtatagtt tttttatatt 60
gtagttgttc tattttaatc aaatgttagc gtgatttata ttttttttcg cctcgacatc 120
atctgcccag atgcgaagtt aagtgcgcag aaagtaatat catgcgtcaa tcgtatgtga 180
atgctggtcg ctatactg 198
Claims (10)
1. a kind of high flux screening system for high nucleic acid saccharomyces cerevisiae breeding, it is characterized in that：The screening system is by reporting
Plasmid YEp-Hyg B-yeGFP and host cell containing YEp-Hyg B-yeGFP are constituted；Wherein, the reporter plasmid YEp-
Hyg B-yeGFP is the shuttle plasmid being implemented between saccharomyces cerevisiae and Escherichia coli, which is ring-type, from 5 ' to 3 ' successively by
YEplac195 plasmid backbone, yeast enhanced green fluorescent protein gene yeGFP expression cassette, hygromycin B resistant gene expression cassette
Composition；The starting strain of the host cell is the Saccharomyces cerevisiae for being higher than normal value through screening confirmation nucleic acid content.
2. it is used for the high flux screening system of high nucleic acid saccharomyces cerevisiae breeding according to claim 1, it is characterized in that：The report
The YEplac195 plasmid accused in plasmid YEp-Hyg B-yeGFP is yeast episomal plasmid, the ori containing 2 μ plasmid of yeast.
3. it is used for the high flux screening system of high nucleic acid saccharomyces cerevisiae breeding according to claim 1, it is characterized in that：The report
The green fluorescence protein gene yeGFP expression cassette accused in plasmid YEp-Hyg B-yeGFP is successively opened by rDNA from upstream to downstream
Mover, internal ribosome entry site IRES (Internal ribosome entry site) sequence, yeGFP gene expression
Frame, poly (T) sequence, rDNA terminator composition；Wherein, rDNA promoter sequence such as SEQ ID No:Shown in 1, IRES sequence is such as
SEQ ID No:Shown in 2, yeGFP gene expression frame sequence such as SEQ ID No:Shown in 3, poly (T) sequence such as SEQ ID No:4
It is shown, rDNA terminator sequence such as SEQ ID No:Shown in 5.
4. it is used for the high flux screening system of high nucleic acid saccharomyces cerevisiae breeding according to claim 1, it is characterized in that：The report
The hygromycin B resistant gene expression cassette in plasmid YEp-Hyg B-yeGFP is accused by TEF1 promoter, hygromycin B (Hyg B) base
Cause, TEF1 terminator composition；Wherein, TEF1 promoter sequence such as SEQ ID NO:Shown in 6, hygromycin B (Hyg B) gene order
Such as SEQ ID NO:Shown in 7, TEF1 terminator sequence such as SEQ ID NO:Shown in 8.
5. it is used for the high flux screening system of high nucleic acid saccharomyces cerevisiae breeding according to claim 1, it is characterized in that：The place
The starting strain of chief cell is the relatively high yeast strain CGMCC No.9084 of nucleic acid content.
6. for reporter plasmid YEp-HygB- in the high flux screening system of high nucleic acid saccharomyces cerevisiae breeding described in claim 1
The construction method of yeGFP, step are：
(1) hygromycin B resistant gene expression cassette is expanded using the method for PCR, then utilizes digestion with restriction enzyme hygromycin B
Tolerant gene expression frame and YEplac195, connection liquid are converted bacillus coli DH 5 alpha, select transformant, verified using PCR, obtained
Recombinant plasmid YEp-Hyg B；
(2) it using method amplification rDNA promoter, IRES sequence, yeGFP gene, poly (T) and the rDNA terminator of PCR, obtains
Fusion DNA vaccine product rDNAp-IRES-yeGFP-poly (T)-rDNAt is obtained, digestion with restriction enzyme rDNAp- is then utilized
IRES-yeGFP-poly (T)-rDNAt and YEp-Hyg B, connection liquid convert bacillus coli DH 5 alpha, select transformant, utilizes
PCR method verifying, obtains recombinant plasmid YEp-Hyg B-yeGFP.
7. for containing reporter plasmid YEp- in the high flux screening system of high nucleic acid saccharomyces cerevisiae breeding described in claim 1
The construction method of the host cell of Hyg B-yeGFP, step are：
(1) the reporter plasmid YEp-Hyg B-yeGFP is utilized into PEG-LiAc conversion method, electrotransformation or protoplast transformation
Method conversion is higher than the Saccharomyces cerevisiae of normal value through screening confirmation nucleic acid content；
(2) it sets and screens positive transformant containing the screening and culturing medium using hygromycin B, and extract and counter from recombination yeast mention yeast
Plasmid does PCR verifying, obtains the host cell containing YEp-Hyg B-yeGFP；
(3) thin to host using sepectrophotofluorometer detection method, multiple labeling analyzer detection method or fluorescence microscope detection method
Born of the same parents carry out fluorescence intensity detection, and the high flux screening system for being used for high-nucleic acid yeast breeding is determined according to GFP protein expression situation
Host cell.
8. construction method according to claim 7, it is characterized in that：Reporter plasmid YEp-Hyg B- described in step (1)
Bacterial strain CGMCC No.9084 yeGFP relatively high using PEG-LiAc conversion method transformed nucleic acid content；Fluorescence in step (3)
The method of intensity detection selects multiple labeling analyzer detection method, and concrete operation step is：1mL bacteria suspension to be measured is taken to manage in 1.5mL EP
In, 12000rpm is centrifuged 2min and abandons supernatant, thallus ddH2Residual media, then plus 1mL ddH are washed off in O cleaning twice2O is vortexed
Concussion mixes, and draws 200 μ L and is transferred in 96 hole enzyme mark pipe of black, be placed in multiple labeling analyzer, setting absorbs light
485nm, exciting light 535nm are detected, single-cell fluorescence level fluorescent value/OD600To indicate.
9. being selected for the high flux screening system of high nucleic acid saccharomyces cerevisiae breeding in high-nucleic acid yeast engineering bacteria described in claim 1
Application in educating, which is characterized in that the application method is：
(1) ultraviolet mutagenesis, ethylmethane sulfonate (EMS) mutagenesis or atmospheric pressure at room plasma (Atmospheric and are used
Room Temperature Plasma, ARTP) method of mutagenesis mutagenesis contains the host cell of YEp-Hyg B-yeGFP；
(2) yeast cells of fluorescence intensity raising is sub-elected using the scale of flow cytometer high throughput；
(3) containing for the strain cell nucleic acid of fluorescence intensity raising is measured using perchloric acid method's extraction or Trizol method extracting mode
Amount；
(4) make to select by the way of continuously cultivating, transferring 10 times or more in the YPD fluid nutrient medium in no screening pressure
The reporter plasmid YEp-Hyg B-yeGFP high flux screening system contained in high-nucleic acid yeast engineering bacteria is eliminated, and is obtained without height
The high-nucleic acid yeast engineering bacteria of flux screening system.
10. application according to claim 9, it is characterised in that：
Step (1) is thin using the host that atmospheric pressure at room plasma (ARTP) method of mutagenesis mutagenesis contains YEp-Hyg B-yeGFP
Born of the same parents, method and condition are：1mL bacterium solution is taken, suspension is in 1.5mL EP pipe, 8000r/min, is centrifuged 2min, discards supernatant liquid；With
After brine 2 times, cell concentration is made 10 using the normal saline dilution containing 5% glycerol6~107Between bacterium
Suspension takes 10 μ L bacteria suspensions to be spread evenly across sterile slide surface；Then slide glass is placed in the load of ARTP mutation breeding system
It on platform, is placed in ARTP mutation breeding instrument and carries out mutagenic treatment, mutagenesis instrument working gas is 99.99% high-purity helium, radio frequency function
Rate is 100W, helium gas flow 10SLM, processing time setting 120s, and the distance between sample and plasma emission source are
3mm；Sample treatment finishes, and slide glass is put into the EP pipe equipped with 1mL physiological saline with tweezers, continues sufficiently to vibrate 1min,
The thallus being attached on slide glass sufficiently elutes and forms bacteria suspension；Control group directly adds 10 μ L bacterium solutions into 1mL physiological saline；
Step (2) implements the method that high-throughput scale sub-elects the yeast cells of fluorescence intensity raising using flow cytometer
It is：By host cell suspension, that is, control cell suspension containing YEp-Hyg B-yeGFP and step (1) process without mutagenesis
The cell suspension of ARTP mutagenesis, 8000r/min, is centrifuged 2min, liquid is discarded supernatant, then with 500 μ L 1 × PBS solution weights respectively
It is outstanding, it is separately added into corresponding fluorescein-labeled antibody and is washed 3 times with 1 × PBS solution in 25 DEG C of incubation 1h, be resuspended in 500 μ
L 1×PBS；Then after crossing 40 μm of strainers, upper hypervelocity fluidic cell separation system (MoFlo XDP) is sorted, and control is thin
Born of the same parents' suspension fluorescent value is set as threshold value, can sub-elect the cell that fluorescent value is greater than threshold value, and the yeast of as fluorescence intensity raising is thin
Born of the same parents；
The content for the strain cell nucleic acid that step (3) is improved using Trizol method extracting mode measurement fluorescence intensity, specific method
It is：The cell that host cell containing reporter plasmid and step (2) fluorescent value are greater than threshold value is being contained into 200mg/L hygromycin B
YPD fluid nutrient medium in cultivate 12~24 hours, switching bacterium solution is trained to fresh YPD liquid containing 200mg/L hygromycin B
It supports in base, and controlling cell concentration is OD600≈ 0.1, in 30 DEG C of shake cultures to final concentration of cells OD600≈ 1.0, is collected by centrifugation
Cell；By every 5 × 1070.5ml Trizol is added in bacterial cell, utilizes liquid nitrogen grinding；Using the raw work UNIQ-10 pillar in Shanghai
Trizol total serum IgE extraction agent box and its operating procedure carry out RNA extracting, and the RNA of extraction measures light absorption value at 260nm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810815659.0A CN108893417B (en) | 2018-07-16 | 2018-07-16 | High-throughput screening system for high-nucleic-acid yeast breeding and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810815659.0A CN108893417B (en) | 2018-07-16 | 2018-07-16 | High-throughput screening system for high-nucleic-acid yeast breeding and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108893417A true CN108893417A (en) | 2018-11-27 |
| CN108893417B CN108893417B (en) | 2021-05-14 |
Family
ID=64351745
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810815659.0A Active CN108893417B (en) | 2018-07-16 | 2018-07-16 | High-throughput screening system for high-nucleic-acid yeast breeding and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108893417B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112834411A (en) * | 2021-01-07 | 2021-05-25 | 上海交通大学 | Metal nanoprobe applied to mass flow technology, preparation method and application |
| CN114134130A (en) * | 2021-10-11 | 2022-03-04 | 南京大学 | Method for high-throughput screening of nuclease |
| CN115478024A (en) * | 2022-10-31 | 2022-12-16 | 齐鲁工业大学 | Non-transgenic high-nucleic-acid saccharomyces cerevisiae strain and application thereof |
| CN115753714A (en) * | 2022-11-21 | 2023-03-07 | 清华大学 | Biosensor, nucleic acid molecule, expression vector and application |
| CN116286939A (en) * | 2023-02-03 | 2023-06-23 | 齐鲁工业大学(山东省科学院) | Method for improving nucleic acid yield of saccharomyces cerevisiae and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6368862B1 (en) * | 1991-08-12 | 2002-04-09 | Fred Hutchinson Cancer Research Center | Polymerase I promoter plasmid and vector constructs |
| CN108410902A (en) * | 2018-01-24 | 2018-08-17 | 齐鲁工业大学 | A kind of novel saccharomyces cerevisiae expression system and its construction method |
-
2018
- 2018-07-16 CN CN201810815659.0A patent/CN108893417B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6368862B1 (en) * | 1991-08-12 | 2002-04-09 | Fred Hutchinson Cancer Research Center | Polymerase I promoter plasmid and vector constructs |
| CN108410902A (en) * | 2018-01-24 | 2018-08-17 | 齐鲁工业大学 | A kind of novel saccharomyces cerevisiae expression system and its construction method |
Non-Patent Citations (1)
| Title |
|---|
| R D GIETZ ET AL: "New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites", 《GENE》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112834411A (en) * | 2021-01-07 | 2021-05-25 | 上海交通大学 | Metal nanoprobe applied to mass flow technology, preparation method and application |
| CN112834411B (en) * | 2021-01-07 | 2022-05-27 | 上海交通大学 | Metal nanoprobe applied to mass flow technology, preparation method and application |
| CN114134130A (en) * | 2021-10-11 | 2022-03-04 | 南京大学 | Method for high-throughput screening of nuclease |
| CN114134130B (en) * | 2021-10-11 | 2023-06-27 | 南京大学 | Method for high-throughput screening of nuclease |
| CN115478024A (en) * | 2022-10-31 | 2022-12-16 | 齐鲁工业大学 | Non-transgenic high-nucleic-acid saccharomyces cerevisiae strain and application thereof |
| CN115478024B (en) * | 2022-10-31 | 2023-03-17 | 齐鲁工业大学 | Non-transgenic high-nucleic-acid saccharomyces cerevisiae strain and application thereof |
| CN115753714A (en) * | 2022-11-21 | 2023-03-07 | 清华大学 | Biosensor, nucleic acid molecule, expression vector and application |
| CN116286939A (en) * | 2023-02-03 | 2023-06-23 | 齐鲁工业大学(山东省科学院) | Method for improving nucleic acid yield of saccharomyces cerevisiae and application |
| CN116286939B (en) * | 2023-02-03 | 2023-09-01 | 齐鲁工业大学(山东省科学院) | Method for improving nucleic acid yield of saccharomyces cerevisiae and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108893417B (en) | 2021-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108893417A (en) | It is a kind of for the high flux screening system of high-nucleic acid yeast breeding and application | |
| CN106085937B (en) | A kind of bacillus subtilis recombinant bacterial strain and the preparation method and application thereof | |
| CN108795789A (en) | A kind of high-yield itaconic acid Yarrowia lipolytica engineered strain and its construction method, zymotechnique and application | |
| CN104630258B (en) | A kind of genes of brewing yeast expression system and its structure and application | |
| CN109988722A (en) | A kind of method of recombinant Saccharomyces cerevisiae bacterial strain and its application and production tyrosol and/or rhodioside | |
| CN104593407B (en) | Pichia stipitis gene expression system and its structure and application | |
| CN104480130A (en) | PTerm-SC plasmid as well as construction method and application thereof | |
| CN105695383A (en) | Recombinant strain and application thereof | |
| CN104630255B (en) | A kind of carrier and its construction method for Chlamydomonas reinhardtii polygenes coexpression | |
| CN110079465A (en) | It gives a report the aspergillus oryzae transformation system construction method of gene using phleomycin as selection markers/GFP | |
| CN104725517A (en) | Method for enhancing target protein display quantity on yeast cell surface | |
| CN106554926A (en) | Prepare restructuring Pidolidone produces method, the bacterial strain prepared by the method and its using method of bacterial strain | |
| CN108410902A (en) | A kind of novel saccharomyces cerevisiae expression system and its construction method | |
| CN104789586B (en) | Genome of E.coli integration vector, genetic engineering bacterium and the application in xylitol is produced | |
| CN109536463A (en) | The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method | |
| CN104561082B (en) | One plant of yeast Candida jeffriesii that can utilize xylose expression system | |
| CN105349441B (en) | High sporogenic Trichoderma T23-Ovel1 bacterial strain and its construction method | |
| CN114703185B (en) | Application of acetobacter xylinum-derived promoter in promotion of bacterial cellulose synthesis | |
| CN109652388A (en) | One section of gene that can be used for coding for tomato phytoene dehydrogenase enzyme | |
| CN108901844A (en) | A method of building Lycoris genetic conversion system | |
| CN104561081B (en) | One plant can utilize the expression system of the yeast Candida amazonensis of xylose | |
| CN107217066A (en) | The method and its application of DNA fragmentation and the recombinant vector containing the fragment, structure recombinant vector | |
| CN104630257B (en) | One plant can utilize the expression system of the yeast Spathaspora passalidarum of xylose | |
| CN109402096A (en) | A kind of AID enzyme mutant and its application | |
| CN112481290B (en) | Method for improving citric acid fermentation production level based on morphological gene co-interference |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |