CN104630257B - One plant can utilize the expression system of the yeast Spathaspora passalidarum of xylose - Google Patents

Abstract

The present invention relates to one plant can utilize the expression system of the yeast Spathaspora passalidarum of xylose, including a kind of new expression vector, it is ring-type, is successively operably connected with following elements from 5 ' -3 ': pMD19-Tsimple plasmid backbone, rDNA homologous recombination sequence, exogenous gene expression box and riddled basins expression cassette；The exogenous gene expression box from upstream to downstream successively include promoter, foreign gene insertion restriction enzyme site and transcription terminator；The riddled basins expression cassette includes promoter, antibiotics resistance gene, transcription terminator.Described can be Spathaspora passalidarum using the yeast of xylose.Expression vector of the invention may be implemented in the integrated stable expression in Spathaspora passalidarum, have great importance to the fundamental research and product development of xylose utilization yeast Spathaspora passalidarum.

Description

One plant can utilize the expression of the yeast Spathaspora passalidarum of xylose System

Technical field

The present invention relates to gene engineering technology fields, more particularly, to a kind of yeast that can utilize xylose The expression system and its construction method of Spathaspora passalidarum and application.

Background technique

Yeast is a kind of low unicellular eukaryote, and both there are prokaryotes to be easy to cultivate for it, breeding is fast, convenient for base The features such as because of Engineering operation, while having the function of eukaryotic protein processing, folding, posttranslational modification again etc..Especially most The methanol yeast gene expression system developed rapidly in recent years has inheritance stability, high density fermentation, expression quantity high, easy In purifying the advantages that.Therefore, yeast has become the most important tool of modern molecular biology research and model, is particularly suitable for table Up to eukaryotic gene and prepare functional protein.

Lignocellulosic is one of the most abundant renewable resource on the earth, can be converted into clean fuel ethyl alcohol, butanol, big A variety of biobased products such as ancestor's chemicals lactic acid, high value added product xylitol, organic acid and microbial bacteria body protein, very To can be used for producing a variety of industrial enzymes such as cellulase.Its effective use is able to solve money encountered in social development process Source lacks problem, thus gets more and more people's extensive concerning.Xylose is that content is only second to glucose in ligno-cellulose hydrolysate A kind of monosaccharide, high efficiency bioconversion and using be influence lignocellulosic industry development one of key factor.

Currently, the yeast of energy xylose-fermenting is divided into two classes, one kind is the genetic engineering bacteriums such as saccharomyces cerevisiae；Another kind of is natural Xylose utilization yeast and its engineering bacteria, study it is more have Pichia stipitis, Candida shehatae, Pachysolen tannophilus and its engineering bacteria.Saccharomyces cerevisiae gene engineering bacteria shows xylitol product during the fermentation It is tired, the problems such as metabolic fluxes are obstructed；And the metabolite type of natural xylose utilization yeast is limited, and most yeast xylose utilizations Efficiency and product output rate are low.Therefore, breeding high-efficiency xylose-fermenting strains and the efficient wood-sugar fermentation genetic engineering bacterium of building It is of great significance to exploitation cellulose family renewable resource.

Spathaspora passalidarum be newly separate can utilize xylose yeast (NGUYEN N H, SUH S O,MARSHALL C J,et al.Morphological and ecological similarities:wood-boring beetles associated with novel xylose-fermenting yeasts,Spathaspora passalidarum gen.sp.nov.and Candida jeffriesii sp.nov.Mycol Res,2006,110(Pt 10):1232-1241).The yeast can efficiently use xylose under anaerobic, while can be realized xylose under aerobic conditions With common fermentation (the HOU X.Anaerobic xylose fermentation by Spathaspora of glucose passalidarum.Appl Microbiol Biotechnol,2012,94(1):205-214.).Long etc. (LONG T M, SU Y K,HEADMAN J,et al.Cofermentation of glucose,xylose,and cellobiose by the beetle-associated yeast Spathaspora passalidarum.Appl Environ Microbiol,2012, 78(16):5492-5500.).It, being capable of xylose-fermenting and fiber simultaneously the study found that the yeast is in the presence of 30g/L glucose Disaccharides shows preferable xylose transport ability, and alcohol yied reaches 0.42g/g total reducing sugar, is expected to become novel xylose fermentation pattern Bacterial strain (Cofermentation of glucose, xylose, and cellobiose by the beetle-associated yeast Spathaspora passalidarum.Applied and environmental microbiology,2012,78 (16):5492-5500.)。

Nevertheless, wild type Spathaspora passalidarum to the transformation efficiency and products collection efficiency of xylose also not Reach the requirement of industrial strain, therefore is managed by carrying out genetic engineering transformation to Spathaspora passalidarum Think that bacterial strain is very necessary.Currently, the research on Spathaspora passalidarum gene level is still in its infancy, Though gene sequencing is tentatively completed, but still lacks a gene expression system applicatory.Although there are many be applied on the market The expression vector of the expression systems such as saccharomyces cerevisiae, Pichia pastoris, but the yeast uses special gene coded system, codon CUG encoding serine rather than leucine (Wohlbach DJ, Kuo A, Sato TK, Potts KM, Salamov AA, Labutti KM,Sun H,Clum A,Pangilinan JL,Lindquist EA,Lucas S,Lapidus A,Jin M,Gunawan C, Balan V,Dale BE,Jeffries TW,Zinkel R,Barry KW,Grigoriev IV,Gasch AP.Comparative genomics of xylose-fermenting fungi for enhanced biofuel production.Proceedings of the National Academy of Sciences of the United States of America, 2011,108 (32): 13212-13217.), therefore above-mentioned conventional expression vector is difficult to pass through modification Come suitable for the yeast expression system.

Therefore, it is necessary to construct the gene expression system suitable for Spathaspora passalidarum itself, herein On the basis of, the gene expression system can be used, genetic engineering transformation is carried out to Spathaspora passalidarum, for building Saccharomyces neoformans genetic engineering bacterium lays the foundation, while utilizes Spathaspora passalidarum by metabolic engineering means Xylose produces mankind's useful products, establishes the biological processing technique that renewable resource recycles and is possibly realized.

Summary of the invention

In view of the above-mentioned problems existing in the prior art, the applicant provides one plant of yeast that can utilize xylose The expression system of Spathaspora passalidarum.Expression vector of the invention may be implemented in Spathaspora Integrated stable expression in passalidarum, manages the basis of xylose utilization yeast Spathaspora passalidarum Have great importance by research and product development.

Technical scheme is as follows:

One aspect of the present invention is related to one plant can be using the expression of the yeast Spathaspora passalidarum of xylose System, including a kind of new expression vector are successively operably connected with following elements from 5 ' -3 ' for ring-type:

PMD19-Tsimple plasmid backbone, rDNA homologous recombination sequence, exogenous gene expression box and riddled basins table Up to box；

The exogenous gene expression box from upstream to downstream successively include promoter, foreign gene insertion restriction enzyme site and Transcription terminator；

The riddled basins expression cassette includes promoter, antibiotics resistance gene, transcription terminator.

Described can be Spathaspora passalidarum using the yeast of xylose.

The DNA sequence dna of exogenous gene expression box promoter and transcription terminator in the expression vector comes from host strain Spathaspora passalidarum, the whole genome sequence NCBI (http: // Www.ncbi.nlm.nih.gov/ the number in) is NZ_AEIK00000000, wherein the yeast can be for from american agriculture Study the cell strain NRRL Y-27907 of Culture Collection Center.

Preferably, the rDNA homologous recombination sequence is 18s rDNA, and sequence is as shown in SEQ ID NO:1.Another Selection is that the similitude of the rDNA sequence and SEQ ID NO:1 are not less than 90%, preferably 95%, and more excellent is 98%.

The rDNA homologous recombination sequence is 18s rDNA sequence.

Promoter in the exogenous gene expression box includes SpADH_P、SpXYL_P；Transcription terminator includes SpCYC1_T、 SpXYL_T。

Promoter in the riddled basins expression cassette includes SpTEF1_P；Antibiotics resistance gene can be expression It is common in carrier, including hygromycin gene, blasticidin resistance gene, G418；Transcription terminator includes SpCYC1_T、 ScCYC1_T。

The 18s rDNA sequence is as shown in SEQ ID NO:1；

The SpADH_PPromoter is the alcohol dehydrogenase gene ADH1 in the source Spathaspora passalidarum Promoter, the DNA sequence dna of the promoter is as shown in SEQ ID NO:2；

The SpXYL_PPromoter is that the Xylose reductase gene XYL in the source Spathaspora passalidarum is opened Mover, the DNA sequence dna of the promoter is as shown in SEQ ID NO:3；

The SpTEF1_PPromoter is the transcription initiation factor gene in the source Spathaspora passalidarum TEF1 promoter, the DNA sequence dna of the promoter is as shown in SEQ ID NO:4；

The SpCYC1_TTerminator is the cytochrome C gene CYC1 in the source Spathaspora passalidarum Terminator, the DNA sequence dna of the terminator is as shown in SEQ ID NO:5；

The DNA fragmentation of the foreign gene may include the foreign gene and riddled basins, and the foreign gene is inserted Enter in the exogenous gene expression box between promoter and transcription terminator.In one embodiment of the invention, the external source Gene is gfp gene, and the DNA sequence dna of the gene is as shown in SEQ ID NO:11.

It may include more than one marker gene in the riddled basins expression cassette, the marker gene can be tide Mycin B resistant gene, blasticidin resistance gene and/or G418；In one embodiment of the invention, the marker gene It is hygromycin B resistant gene.

The SpXYL_TTerminator is that the Xylose reductase gene XYL in the source Spathaspora passalidarum is whole Only sub, the DNA sequence dna of the terminator is as shown in SEQ ID NO:6.

The ScCYC1_TTerminator is the cytochrome C gene CYC1 in the source Saccharomyces cerevisiae Terminator, the DNA sequence dna of the terminator is as shown in SEQ ID NO:7.

The DNA sequence dna of the hygromycin B resistant gene is as shown in SEQ ID NO:8.

The DNA sequence dna of the blasticidin resistance gene is as shown in SEQ ID NO:9.

The DNA sequence dna of the G418 is as shown in SEQ ID NO:10.

Host yeast used in the present invention is one plant of yeast Spathaspora that can utilize xylose passalidarum.Specifically, the yeast studies Culture Collection Center purchased from american agriculture, deposit number is NRRL Y- 27907。

Specifically, new expression vector has been prepared according to following technical proposals in inventor:

Using Spathaspora passalidarum Host genomic DNA as template, PCR expansion is carried out with primer P1 and P2 Increase and obtains 18s rDNA homologous recombination sequence；PCR amplification, which is carried out, with primer P23 and P24 obtains SpTEF1_PPromoter；With primer P25 and P26 carries out PCR amplification and obtains SpADH1_PPromoter；PCR amplification, which is carried out, with primer P27 and P28 obtains SpXYL_PStarting Son；PCR amplification, which is carried out, with primer P29 and P30 obtains SpCYC1_TTerminator；PCR amplification acquisition is carried out with primer P31 and P32 SpXYL_TTerminator.With PMD-hph_mPlasmid DNA is template, carries out PCR amplification with primer P21 and P22 and obtains segment hph_m- ScCYC1_T.The nucleotide sequence of the primer P1-P2 is as shown in SEQ ID NO.13-14, the nucleotides sequence of the P21-P32 Column are as shown in SEQ ID NO.33-44.

Using pMD19-Tsimple as skeleton, above-mentioned each segment is connected, the connection is in restriction enzyme digestion appropriate position Point on carry out.Specific connection type are as follows: after the EcoR V restriction enzyme site of pMD19-Tsimple connects 18s rDNA, along The direction of 18s rDNA is sequentially connected exogenous gene expression box promoter, exogenous gene expression box transcription terminator, SpTEF1_PIt opens Mover, hph_m-ScCYC1_T。

Yeast gene expression regulation is an extremely complex process, selects suitable promoter and transcription terminator external The expression of source protein is most important.The present invention provides the promoter and tanscription termination sub-portfolio for exogenous protein expression, packets Include SpADH_P-SpCYC1_T、SpXYL_P-SpCYC1_T、SpADH_P-SpXYL_T、SpXYL_P-SpXYL_T、SpTEF1_P-SpCYC1_T、、 SpXYL_P-SpXYL_T。

The promoter is predicted to obtain according to following methods:

(1) it according to Spathaspora passalidarum genome sequence, selects commonly to open in yeast expression system All nucleotide fragments between the affiliated gene of mover and the open reading frame of a upper gene；

(2) the online test and evaluation software of promoter is used, on-line prediction is carried out to possible promoter sequence；

(3) according to the potential promoter sequence of high score value, design primer amplification obtains promoter sequence to be measured.

The terminator is obtained according to following methods:

(1) it according to Spathaspora passalidarum genome sequence, selects common whole in yeast expression system Only son belonging to gene open reading frame after about 300bp as terminator sequence to be measured.

(2) design primer amplification obtains the terminator to be measured.

The promoter and tanscription termination sub-portfolio of the exogenous protein expression are used for the functional expression of foreign gene.Implementing In example, gfp gene is inserted between the promoter and transcription terminator of the exogenous protein expression.

The expression vector is integrated in the genome of the Spathaspora passalidarum host strain.

The Spathaspora passalidarum host strain is that (but being not limited to) protects from american agriculture research strain The cell strain NRRL Y-27907 at hiding center.

In one embodiment of the invention, the Spathaspora passalidarum host strain is from U.S.'s agriculture The Spathaspora passalidarum NRRL Y-27907 of industry research Culture Collection Center.

Another aspect of the present invention provides a kind of structure of Spathaspora passalidarum gene expression system Construction method, comprising the following steps:

The expression vector establishment of the Spathaspora passalidarum gene expression system:

According to Spathaspora passalidarum whole genome sequence, Spathaspora passalidarum is transferred 18s rDNA partial sequence is as homologous recombination site.It is with Spathaspora passalidarum Host genomic DNA Template carries out PCR amplification with primer P1 and P2 and obtains 18s rDNA homologous recombination sequence, while introducing digestion position in segment upstream Point EcoR I, downstream introduce restriction enzyme site Bgl II, BamH I and Kpn I.PCR product is cloned into plasmid pMD19- after purification Tsimple obtains recombinant plasmid pMD-18s rDNA.

With PMD-hph_mPlasmid DNA is template, carries out PCR amplification with primer P21 and P22 and obtains segment hph_m-ScCYC1_T, BamH I, Pst I are introduced in segment upstream simultaneously, downstream introduces Kpn I.By the PCR product of purifying and recombinant plasmid pMD-18s RDNA uses BamH I and Kpn I double digestion respectively, and digestion products connection obtains recombinant plasmid PR-hph_m。

Using Spathaspora passalidarum Host genomic DNA as template, PCR is carried out with primer P23 and P24 Amplification obtains SpTEF1_PPromoter, while restriction enzyme site BamH I and Pst I is introduced at segment both ends.By the PCR product of purifying With recombinant plasmid PR-hph_mBamH I and Pst I double digestion are used respectively, and digestion products connection obtains recombinant plasmid PRTH.

Using Spathaspora passalidarum Host genomic DNA as template, PCR is carried out with primer P25 and P26 Amplification obtains SpADH_PPromoter；PCR amplification, which is carried out, with primer P27 and P28 obtains SpXYL_PPromoter；Simultaneously in the upper of segment Trip introduces restriction enzyme site Bgl II, and downstream introduces restriction enzyme site Sal I and BamH I.By the PCR product and recombinant plasmid of purifying PRTH uses Bgl II and Sal I double digestion respectively, and the recombinant plasmid of digestion is connected with PCR product and obtains recombinant plasmid PRATH And PRXTH.

Using Spathaspora passalidarum Host genomic DNA as template, PCR is carried out with primer P29 and P30 Amplification obtains SpCYC1_TTerminator；PCR amplification, which is carried out, with primer P31 and P32 obtains SpXYL_TTerminator.It is introduced in segment upstream Restriction enzyme site Sal I and Not I introduces restriction enzyme site BamH I in segment downstream.By the PCR product and recombinant plasmid of purifying PRATH and PRXTH use Sal I and BamH I double digestion respectively, digestion products connection obtain PR series recombinant plasmid PRACTH, PRAXTH, PRXCTH and PRXXTH.

The nucleotide sequence of the primer P1-P2 is as shown in SEQ ID NO.13-14.

The nucleotide sequence of the primer P21-P32 is as shown in SEQ ID NO.33-44.

The activation and culture of host strain Spathaspora passalidarum.

Genetic transformation of the PR series recombinant plasmid in host strain Spathaspora passalidarum.

The screening of host strain Spathaspora passalidarum positive transformant.

The construction method of the Spathaspora passalidarum gene expression system, wherein the expression vector It is recombinant plasmid PRACTH, wherein the promoter of exogenous gene expression box and terminator are respectively SpADH_PAnd SpCYC1_T。

The construction method of the Spathaspora passalidarum gene expression system, wherein the expression vector It is recombinant plasmid PRAXTH, wherein the promoter of exogenous gene expression box and terminator are respectively SpADH_PAnd SpXYL_T。

The construction method of the Spathaspora passalidarum gene expression system, wherein the expression vector It is recombinant plasmid PRXCTH, wherein the promoter of exogenous gene expression box and terminator are respectively SpXYL_PAnd SpCYC1_T。

The construction method of the Spathaspora passalidarum gene expression system, wherein the expression vector It is recombinant plasmid PRXXTH, wherein the promoter of exogenous gene expression box and terminator are respectively SpXYL_PAnd SpXYL_T。

The construction method of the Spathaspora passalidarum gene expression system, wherein the genetic transformation Method includes PEG-LiAC conversion method, electrotransformation and protoplast transformation, and preferred method for transformation is PEG-LiAC conversion Method.

The construction method of the Spathaspora passalidarum gene expression system, wherein the host strain Spathaspora passalidarum transformant screening method be resistant panel screening, to the transformant Jing Guo preliminary screening into Row bacterium colony PCR or Genomic PCR detection, and conversion is determined eventually by the method for detection foreign protein activity or metabolite Son.

The present invention provides a kind of methods of expression alien gene, include the following steps:

(1) the integrated Spathaspora passalidarum gene expression system is provided；

(2) foreign gene that foreign gene is inserted into the expression vector is inserted into restriction enzyme site, obtains recombinant expression carrier；

(3) recombinant expression carrier is converted into host strain Spathaspora passalidarum and the table in host strain Up to the foreign gene.

The present invention also provides the method for metabolic engineering host strain Spathaspora passalidarum a kind of, packets Include following steps:

(1) integrated Spathaspora passalidarum expression system described in claim 1 is provided；

(2) foreign gene that target gene is inserted into the expression vector is inserted into restriction enzyme site, obtains recombinant expression carrier；

(3) recombinant expression carrier is converted into host strain Spathaspora passalidarum and the table in host strain Up to the target gene；

(4) recombinant bacterium is cultivated, the recombinant bacterium metabolite is detected.

Other aspects of invention are obvious to those skilled in the art due to this disclosure.

The present invention is beneficial to be had the technical effect that

1, yeast used in the present invention is one plant of novel yeast using xylose, have efficient xylose utilization ability and Higher alcohol yied, and hot fermentation ability is had more, it is one plant of good industrial production candidate strain.However the yeast makes With special gene coded system, codon CUG encoding serine rather than leucine, therefore be applied on the market saccharomyces cerevisiae, The expression vector of the expression systems such as Pichia pastoris can not be suitable for the xylose utilization yeast.In consideration of it, the present inventor construct it is suitable For a series of new expression vector of the yeast itself, using the series expression vector, it is convenient to be carried out to the yeast outer The expression of source protein and metabolic engineering.

2, described the present invention provides the method with other DNA moleculars conversion Spathaspora passalidarum DNA molecular may be from connecting Spathaspora passalidarum gene pack between above-mentioned Vector promoter and terminator In the library that is constituted of section or the DNA molecular of synthesis.The present invention can be used in expressing gene diverse libraries to can provide, Generate the technology that can therefrom screen the product of new bioactive substance.

3, it in integrated expression vector of the present invention, attempts using multiple Spathaspora passalidarum's RDNA sequence is as integration site, but only one sequence shows to integrate effect, which is the part of 18s rDNA Sequence, and the site shows copy number height, the good feature of stability, so that the integrated expression vector of the series, which becomes, to fit The integrated expression of yeast multi-copy of foreign protein and metabolic engineering is expressed for Spathaspora passalidarum Carrier.

4. in new expression vector constructed by the present invention, to used hygromycin B resistant gene, blasticidin resistance Multiple CUG codons carry out rite-directed mutagenesis in the riddled basins open reading frame such as gene, UUG are sported, to reporter gene CUG codon in gfp open reading frame has carried out rite-directed mutagenesis, sports UUG, carries to realize Novel series expression Effective conversion and functional expression of the body in yeast Spathaspora passalidarum.

Detailed description of the invention

Fig. 1 be embodiment 1 rite-directed mutagenesis after hph gene C DS sequence (Indicate rite-directed mutagenesis site)；

Fig. 2 be embodiment 4 rite-directed mutagenesis after gfp gene C DS sequence (Indicate rite-directed mutagenesis site)；

Fig. 3 is the green fluorescent protein recombinant plasmid PRACTH-gfp of embodiment 4_mPlasmid map；

Fig. 4 is that embodiment 4 is bacterium green fluorescent protein recombinant plasmid transformed daughter colony PCR proof diagram (M Maker, swimming Road 1 is negative control, and swimming lane 2 is wild mushroom amplification, and swimming lane 3-14 is positive transformant amplification)；

Fig. 5 is the green fluorescent protein recombinant plasmid PRACTH-gfp of embodiment 4_mConvert Spathaspora Passalidarum and GFP fluorescence microscope detects (left figure is dark field, and right figure is light field)；

Fig. 6 is the lactobacillus plantarum l-lactate dehydrogenase gene order of embodiment 5；

Fig. 7 is the plasmid map of the lactic dehydrogenase recombinant plasmid PRACTH-ldh of embodiment 5；

Fig. 8 is the growth of Spathaspora passalidarum genetic engineering bacterium and glucose metabolism situation of embodiment 5.

Specific embodiment

Technical solution of the present invention is described in detail below in conjunction with embodiment.It should be understood that these embodiments are only used In illustrating the present invention, and it is not construed as limiting the scope of the invention.Without departing from the spirit and substance of the case in the present invention, to this Modifications or substitutions made by inventive method, step or condition are accordingly to be regarded as falling into the scope of the present invention.

In the following examples, the experimental methods for specific conditions are not specified, substantially all in accordance with common clone's handbook or institute, manufacturer It is recommended that condition carry out experimental implementation；Manufacturer person is not specified in agents useful for same or instrument, and being can be by the normal of commercially available acquisition Advise product.

Unless separately limiting herein, whole term used herein is logical with ordinary person of the art The identical meanings often understood.

In the present invention, term " being operably connected " refers to functional space row of two or more nucleic acid sequences Column.Such as: promoter sequence is placed in the specific position relative to target gene nucleic acid sequence, so that the transcription of the target gene By the guidance of the promoter, expression is made to become feasible, thus, promoter sequence is " operably connected " the nucleic acid sequence On.In general, term " being operably connected " refer to connected DNA sequence dna be it is adjacent, the connection of the sequence be by It is attached to implement on restriction site appropriate.If the site is not present, can be used according to conventional methods The oligonucleotide adaptor or connector of synthesis.

The building of the integrated expression vector of embodiment 1:PR series

One, the building of recombinant plasmid pMD-18s rDNA

(1) according to Spathaspora passalidarum whole genome sequence (GenBank accession NZ_ AEIK00000000), two primer interception Spathaspora passalidarum 18s rDNA partial sequences are designed as same Source recombination site.Primer sequence is as follows: primer P1 underscore part be EcoR I recognition site, primer P2 underscore part by 5 ' to 3 ' ends are respectively the recognition site of Bgl II, BamH I and Kpn I.

P1:5 ' GCCGGAATTCTGCCAGTAGTCATATGCTTGTCTC3’

P2:5 ' ATATTAGGGGTACCCGGGATCCGAAGATCTGTTGAAGAGCAATAAT3’

(2) it is incubated overnight Spathaspora passalidarum, collects cell, genomic DNA is extracted in separation.

(3) using Spathaspora passalidarum Host genomic DNA as template, with primer P1 and P2 progress PCR amplification.Amplification condition is 95 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 62 DEG C of annealing 30s, 72 DEG C of extension 1.5min, 30 Circulation, 72 DEG C of extension 5min.Purification and recovery pcr amplification product rear clone to pMD19-Tsimple carrier (is purchased from Dalian TaKaRa Company), obtain recombinant plasmid pMD-18s rDNA.

Two, recombinant plasmid PMD-hph_mBuilding

(1) according to plasmid pRS303H (Taxis C, Knop M.System of centromeric, episomal, and integrative vectors based on drug resistance markers for Saccharomyces Cerevisiae.BioTechniques, 2006,40 (1): 73-78.) in hygromycin gene expression cassette primers P3 and P4.

P3:5 ' ACATTTTGATGGCCGCACGG3 '

P4:5 ' AACTCCTTCCTTTTCGGTTAGAGCG 3 '

(2) using pRS303H Plasmid DNA as template, hph expression cassette segment, amplification condition 95 are expanded with primer P3 and P4 DEG C initial denaturation 5min, 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1.5min, 30 circulations, 72 DEG C of extension 5min.It is pure Change after recycling above-mentioned segment, be cloned into pMD19-Tsimple carrier, obtains recombinant plasmid PMD-hph.

(3) mutant primer is designed according to CUG password subcase in hygromycin gene CDS, wherein the primer sequence Middle underscore part is mutational site.

P5:5 ' GAGAAGTTTTTGATCGAAAAGTTCGACAGC 3’

P6:5 ' GCTGTCGAACTTTTCGATCAAAAACTTCTC 3’

P7:5 ' GACAGCGTCTCCGACTTGATGCAGCTCTCG 3’

P8:5 ' CGAGAGCTGCATCAAGTCGGAGACGCTGTC 3’

P9:5 ' GGGCGTGGATATGTCTTGCGGGTAAATAG 3’

P10:5 ' CTATTTACCCGCAAGACATATCCACGCCC 3’

P11:5 ' AATTCAGCGAGAGCTTGACCTATTGCATCT 3’

P12:5 ' AGATGCAATAGGTCAAGCTCTCGCTGAATT 3’

P13:5 ' TTGCAAGACTTGCCTGAAACCGAATTGCCCGCTGTT3’

P14:5 ' AACAGCGGGCAATTCGGTTTCAGGCAAGTCTTGCAA3’

P15:5 ' AATTGCCCGCTGTTTTGCAGCCGGT 3’

P16:5 ' ACCGGCTGCAAAACAGCGGGCAATT 3’

P17:5 ' AGGCTCTCGATGAGTTGATGCTTTGGGCCGAG 3’

P18:5 ' CTCGGCCCAAAGCATCAACTCATCGAGAGCCT 3’

P19:5 ' GCTCCAACAATGTCTTGACGGACAATGG 3’

P20:5 ' CCATTGTCCGTCAAGACATTGTTGGAGC 3’

Using plasmid PMD-hph as template, the limited public affairs of Agilent Technologies (are purchased from using Stratagene site-directed mutagenesis kit Department), PCR amplification is carried out with above-mentioned primer, obtains cyclic annular PCR product.Amplification condition are as follows: 95 DEG C of initial denaturation 2min, 95 DEG C of denaturation 30s, 55 DEG C of annealing 2min, 68 DEG C of extension 3.5min, 30 circulations, 68 DEG C sufficiently extend 5min.

(4) use restriction endonuclease Dpn I in 37 DEG C of digestion 30min after purification above-mentioned PCR product, in 65 DEG C of reaction 15min with Inactivate restriction endonuclease Dpn I.After purification by digestion products, Transformed E .coli JM109 competent cell is (public purchased from the full formula gold in Beijing Department), it is coated on LB (100 μ g/ml ampicillin) plate, picking individual colonies, send after extracting plasmid to raw work bioengineering (Shanghai) limited liability company is sequenced, and the correct plasmid in mutational site is selected.After above-mentioned mutation operation, mutant plasmid It is named as PMD-hph_m, wherein the CDS sequence of hph is as shown in Figure 1 after mutation.

Three, recombinant plasmid PR-hph_mBuilding

(1) according to PMD-hph_mHygromycin gene expression cassette sequence in plasmid designs two primers: under primer P21 For dashed part by 5 ' to 3 ' the ends respectively recognition site of BamH I and Pst I, primer P22 underscore part is the knowledge of Kpn I Other site.

P21:5 ' CGGGATCCAAACTGCAGATGGGTAAAAAGCCTGAACTCAC3’

P22:5 ' GGGGTACCAACTCCTTCCTTTTCGGTTAGAGCG3’

(2) with PMD-hph_mPlasmid DNA is template, carries out PCR amplification with primer P21 and P22, obtains PCR product.Amplification Condition is 95 DEG C of initial denaturation 5min, and 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 1.5min, 30 circulations, 72 DEG C extend 5min。

(3) PCR product of purifying and recombinant plasmid pMD-18s rDNA are used into BamHI and Kpn I double digestion respectively, by enzyme It cuts product to connect overnight after purification respectively, Transformed E .coli JM109 competent cell, is coated on LB (100 μ g/ml ammonia benzyl moulds Element) on plate, picking individual colonies, BamH I and Kpn I double digestion is verified after extracting plasmid, obtains recombinant plasmid PR-hph_m。

Four, the building of recombinant plasmid PRTH

(1) according to Spathaspora passalidarum whole genome sequence (GenBank accession NZ_ AEIK00000000) and online database EMBL-EBI (http://www.ebi.ac.uk/) provide sequence information, obtain All dna sequences between Spathaspora passalidarum transcription initiation factor and a upper gene open reading frame. According to promoter software (http://www.softberrv.com and http://www.cbs.dtu.dk/services/) to upper It states sequence and carries out on-line prediction, two primers are designed according to selected sequence restriction enzyme site situation later, transfer Spathaspora Passalidarum transcription initiation factor upstream 700bp or so is used as promoter SpTEF1_P: primer P23 underscore part is The recognition site of BamH I, primer P24 underscore part are the recognition site of Pst I.

P23:5 ' CGGGATCCACCACTTACATAATAGAAAGAC 3’

P24:5 ' ACGAGCCTGCAGTTTTGATTGATTGATTG 3’

(2) using Spathaspora passalidarum Host genomic DNA as template, with primer P23 and P24 progress PCR amplification obtains PCR product.Amplification condition is 95 DEG C of initial denaturation 5min, and 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend 50s, 30 circulations, 72 DEG C of extension 5min.

(3) by the PCR product of purifying and recombinant plasmid PR-hph_mBamH I and Pst I double digestion are used respectively, and digestion is produced Object connects overnight after purification respectively, Transformed E .coli JM109 competent cell, is coated on LB (100 μ g/ml ampicillin) On plate, picking individual colonies, BamH I and Pst I double digestion is verified after extracting plasmid, obtains recombinant plasmid PRTH.

Five, the building of recombinant plasmid PRATH and PRXTH

(1) according to Spathaspora passalidarum whole genome sequence (GenBank accession NZ_ AEIK00000000) and online database EMBL-EBI (http://www.ebi.ac.uk/) provide sequence information, obtain Spathaspora passalidarum alcohol dehydrogenase and Xylose reductase are respectively between a upper gene open reading frame All dna sequences.According to promoter software (http://www.softberrv.com and http://www.cbs.dtu.dk/ Services/) on-line prediction is carried out to above-mentioned sequence to transfer later according to selected sequence restriction enzyme site situation design primer Spathaspora passalidarum alcohol dehydrogenase and Xylose reductase open reading frame upstream 1000bp or so are used as and open Mover, i.e. SpADH_PAnd SpXYL_P: primer P25 and P27 underscore part is the recognition site of Bgl II, under primer P26 and P28 Dashed part is by 5 ' to 3 ' the ends respectively recognition site of BamH I and Sal I.

P25:5 ' GCCGGAAGATCTGTAAATTAATGCTACATCAGTTGAGG 3’

P26:5 ' CGGGATCCACGCGTCGACTATATTTTATTTAGGAATT3’

P27:5 ' GCCGGAAGATCTGTGACATAGTTAACTATGGC 3’

P28:5 ' CGGGATCCACGCGTCGACTTTATTGTATTGTG 3’

(2) using Spathaspora passalidarum Host genomic DNA as template, with primer P25 and P26 progress PCR amplification obtains segment SpADH_P.Amplification condition is 95 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C Extend 1min, 30 circulations, 72 DEG C of extension 5min.

(3) using Spathaspora passalidarum Host genomic DNA as template, with primer P27 and P28 progress PCR amplification obtains segment SpXYL_P.Amplification condition is 95 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 72 DEG C Extend 1min, 30 circulations, 72 DEG C of extension 5min.

(4) by the segment SpADH of purifying_PBgl II and BamH I double digestion is used respectively with recombinant plasmid PRTH, by digestion Product connects overnight after purification respectively, Transformed E .coli JM109 competent cell, is coated on LB (100 μ g/ml ammonia benzyl moulds Element) on plate, picking individual colonies, Bgl II and BamH I double digestion is verified after extracting plasmid, shows 1000bp after gel electrophoresis The i.e. positive connection of left and right band, obtains recombinant plasmid PRATH.

(5) by the segment SpXYL of purifying_PBgl II and BamH I double digestion is used respectively with recombinant plasmid PRTH, by digestion Product connects overnight after purification respectively, Transformed E .coli JM109 competent cell, is coated on LB (100 μ g/ml ammonia benzyl moulds Element) on plate, picking individual colonies, Bgl II and BamH I double digestion is verified after extracting plasmid, shows 1000bp after gel electrophoresis The i.e. positive connection of left and right band, obtains recombinant plasmid PRXTH.

Six, the building of the integrated expression vector of PR series

(1) according to Spathaspora passalidarum whole genome sequence (GenBank accession NZ_ AEIK00000000) and online database EMBL-EBI (http://www.ebi.ac.uk/) provide sequence information, obtain Spathaspora passalidarum cytochrome C1 and Xylose reductase open reading frame downstream sequence.Design primer is transferred Spathaspora passalidarum cytochrome C1 and Xylose reductase open reading frame downstream 300bp or so are as transcription Terminator, i.e. SpCYC1_TAnd SpXYL_T: primer P29 and P31 underscore part is respectively Sal I and Not I's by 5 ' to 3 ' ends Recognition site, primer P30 and P32 underscore part are the recognition site of BamH I.

P29:5 ' ACGCGTCGACATAAGAATGCGGCCGCGCTAACTTCAATTAGAAT3’

P30:5 ' CGGGATCCCATCACTATAAGCGAAATCGGGTTTC 3’

P31:5 ' ACGCGTCGACATAAGAATGCGGCCGCGTTTGATTCTAGTTTATAT3’

P32:5 ' GCGCGGATCCATAGTTAACTATGTCACTTGAACTC 3’

(2) using Spathaspora passalidarum Host genomic DNA as template, with primer P29 and P30 progress PCR amplification obtains segment SpCYC1_T.Amplification condition is 95 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C Extend 30s, 30 circulations, 72 DEG C of extension 5min.

(3) using Spathaspora passalidarum Host genomic DNA as template, with primer P31 and P32 progress PCR amplification obtains segment SpXYL_T.Amplification condition is 95 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 61 DEG C of annealing 30s, 72 DEG C Extend 30s, 30 circulations, 72 DEG C of extension 5min.

(4) by the segment SpCYC1 of purifying_TSal I and BamH I double digestion is used respectively with recombinant plasmid PRATH, by digestion Product connects overnight after purification respectively, Transformed E .coli JM109 competent cell, is coated on LB (100 μ g/ml ammonia benzyl moulds Element) on plate, picking individual colonies, Sal I and BamH I double digestion is verified after extracting plasmid, obtains recombinant plasmid PRACTH.

(5) by the segment SpCYC1 of purifying_TSal I and BamH I double digestion is used respectively with recombinant plasmid PRXTH, by digestion Product connects overnight after purification respectively, Transformed E .coli JM109 competent cell, is coated on LB (100 μ g/ml ammonia benzyl moulds Element) on plate, picking individual colonies, Sal I and BamH I double digestion is verified after extracting plasmid, obtains recombinant plasmid PRXCTH.

(6) by the segment SpXYL of purifying_TSal I and BamH I double digestion is used respectively with recombinant plasmid PRATH, by digestion Product connects overnight after purification respectively, Transformed E .coli JM109 competent cell, is coated on LB (100 μ g/ml ammonia benzyl moulds Element) on plate, picking individual colonies, Sal I and BamH I double digestion is verified after extracting plasmid, obtains recombinant plasmid PRAXTH.

(7) by the segment SpXYL of purifying_TSal I and BamH I double digestion is used respectively with recombinant plasmid PRXTH, by digestion Product connects overnight after purification respectively, Transformed E .coli JM109 competent cell, is coated on LB (100 μ g/ml ammonia benzyl moulds Element) on plate, picking individual colonies, Sal I and BamH I double digestion is verified after extracting plasmid, obtains recombinant plasmid PRXXTH.

The foundation for the Spathaspora passalidarum method for transformation that embodiment 2:PEG/LiAc is mediated.

Using Spathaspora passalidarum NRRL Y-27907 as host strain, is mediated and turned using PEG/LiAc The method implementation for changing yeast is as follows:

One, the preparation of Spathaspora passalidarum NRRL Y-27907 competence

(1) the Spathaspora passalidarum NRRL Y-27907 of cryopreservation tube preservation is inoculated in YPD culture Base, shaking flask activation culture 48h.

(2) by activated bacterium solution in the flat lining out culture of YPD, and 4 DEG C save.

(3) the picking Spathaspora passalidarum NRRL Y-27907 single colonie in YPD plate, is inoculated in In 20ml YPD culture medium, it is incubated overnight for 30 DEG C in 100ml shaking flask.

(4) the fresh bacterium solution being incubated overnight is inoculated in 50ml YPD culture medium, 30 DEG C in 250ml shaking flask, 200rpm culture, until bacterium solution OD600 to 1.2 or so.

(5) 5000rpm room temperature is centrifuged 5min, collects somatic cells.

(6) cell is resuspended in the LiAc of 500 μ l 0.1mol/L, is centrifuged, abandon supernatant, obtain competent cell.

Two, the preparation of recombinant plasmid is linearized

(1) E.coli containing recombinant expression plasmid is inoculated in LB culture medium, be incubated overnight.

(2) E.coli somatic cells are collected, recombinant plasmid are extracted using alkali cracking method, specific method is referring to vast Tyke plasmid Extracts kit.

(3) restriction enzyme Stu I single endonuclease digestion recombinant plasmid, endonuclease reaction system (50 μ L): 40 μ L DNA, 5 μ are used L buffer, 1.5 μ L restriction enzyme Stu I supply 50 μ L with distilled water, and mixing is placed on digestion in 37 DEG C of insulating boxs 2h。

(4) digestion products are purified, linearisation recombinant plasmid is obtained.

Three, PEG/LiAc method converts Spathaspora passalidarum NRRL Y-27907

(1) following conversion mixed liquor: 240 μ L PEG3350,36 μ L 1.0mol/L is sequentially added in competent cell LiAc, 25 μ L salmon sperm dnas, 50 μ L linear DNAs to be transformed, wherein ice bath immediately after salmon sperm dna boiling water bath 10min；

(2) each reaction tube is acutely vibrated until cell mixes completely；

(3) 30 DEG C of incubation 1h are placed in；

(4) 42 DEG C of metal bath thermal shock 22min are placed in；

(5) wait be cooled to room temperature, 5000rpm is centrifuged 5min, abandons supernatant；

(6) 1ml YPD culture medium is added, cultivates 2h after 30 DEG C；

(7) 5000rpm is centrifuged 5min, discards 800 μ l supernatants, mixes thallus and is coated with hygromycin B (250mg/mL) resistance Plate, 30 DEG C of culture 3-4d obtain transformant.

Embodiment 3: the foundation for the yeast Spathaspora passalidarum method for transformation that electroporation mediates

Using Spathaspora passalidarum NRRL Y-27907 as host strain, is mediated and turned using electroporation The implementation for changing yeast is as follows:

One, Spathaspora passalidarum NRRL Y-27907 electricity turns the preparation of competent cell

(1) the Spathaspora passalidarum NRRL Y-27907 of cryopreservation tube preservation is inoculated in YPD culture Base, shaking flask activation culture 48h；

(2) by activated bacterium solution in the flat lining out culture of YPD, and 4 DEG C save；

(3) the picking Spathaspora passalidarum NRRL Y-27907 single colonie in YPD plate, is inoculated in In 20ml YPD culture medium, it is incubated overnight for 30 DEG C in 100ml shaking flask；

(4) the fresh bacterium solution being incubated overnight is inoculated in 50ml YPD culture medium, 30 DEG C in 250ml shaking flask, 200rpm culture, until bacterium solution OD600 to 1.2 or so；

(5) bacterium solution is placed in 30min, 5000rpm, 4 DEG C of centrifugation 5min on ice, collects somatic cells；

(6) 2 times, 5000rpm, 4 DEG C centrifugation 5min of 20ml distilled water washing thalline of pre-cooling are added, collect somatic cells；

(7) 2 times, 5000rpm, 4 DEG C centrifugation 5min of 1.0mol/L sorbitol washes thallus of 20ml pre-cooling are added, collect bacterium Body cell；

(8) the 1.0mol/L sorbierite that 200 μ l pre-cooling is added mixes somatic cells, obtains competent cell.

Two, the preparation of recombinant plasmid is linearized

(1) E.coli containing recombinant expression plasmid is inoculated in LB culture medium, be incubated overnight.

(2) E.coli somatic cells are collected, recombinant plasmid are extracted using alkali cracking method, specific method is referring to vast Tyke plasmid Extracts kit.

(3) restriction enzyme Stu I single endonuclease digestion recombinant plasmid, endonuclease reaction system (50 μ L): 40 μ L DNA, 5 μ are used L buffer, 1.5 μ L restriction enzyme Stu I supply 50 μ L with distilled water, and mixing is placed on digestion in 37 DEG C of insulating boxs 2h。

(4) digestion products are purified, linearisation recombinant plasmid is obtained.

Three, the electrotransformation of Spathaspora passalidarum NRRL Y-27907

(1) it takes 100 μ l Electroporation-competent cells and 10 μ l DNA to mix, is added in 0.2cm electricity revolving cup；

(2) electric revolving cup ice bath 5min, setting condition 1500v, shock by electricity 5s, carries out electrotransformation；

(3) the 1.0mol/L sorbierite of 1ml pre-cooling is added into electric revolving cup immediately, is transferred to 30 DEG C of incubation 1h of incubator；

(4) 5000rpm is centrifuged 5min, abandons supernatant；

(5) 1ml YPD culture medium is added, mixes somatic cells, cultivates 2h after 30 DEG C of incubator；

(6) 5000rpm is centrifuged 5min, discards 800 μ l supernatants, mixes thallus and is coated with hygromycin B (250mg/mL) resistance Plate, 30 DEG C of culture 3-4d obtain transformant.

Application of the integrated expression vector of embodiment 4:PR series in terms of expression alien gene.

One, green fluorescent protein recombinant expression carrier is constructed

(1) according to the gene order of green fluorescent protein, design primer: primer P33 underscore part is the identification of Sal I Site, primer P34 underscore part are the recognition site of Not I.

P33:5 ' ACGCGTCGACATGGGTAAGGGAGAAGAACTTTTCAC3’

P34:5 ' ATAAGAATGCGGCCGCTTATTTGTATAGTTCATCCATGCCATG 3’

(2) using the DNA of green fluorescence protein gene as template, PCR amplification is carried out with primer P33 and P34, obtains gene gfp.Amplification condition is 95 DEG C of initial denaturation 5min, and 94 DEG C of denaturation 30s, 62 DEG C of annealing 30s, 72 DEG C of extension 45s, 30 recycle, 72 DEG C extend 5min.

(3) purifying is cloned into pMD19-Tsimple carrier to gfp segment, Transformed E .coli JM109 competent cell, It is coated on LB (100 μ g/ml ampicillin) plate, picking individual colonies, Sal I and Not I double digestion is tested after extracting plasmid Card obtains recombinant plasmid pMD-gfp.

(4) due in gfp gene sequence open reading frame there are codon CUG, and yeast Spathaspora Passalidarum uses special coded system, i.e. codon CUG encoding serine rather than leucine.It is therefore desirable to right Gfp gene carries out rite-directed mutagenesis, and codon CUG is sported codon UUG.

(5) using 601 in gfp gene order CDS base C as mutational site, simple point mutation primer: primer is designed P35 and P36 underscore part is mutational site.

P35:5 ' TACCAGACAACCATTACTTGTCCACACAATCTGCC3’

P36:5 ' GGCAGATTGTGTGGACAAGTAATGGTTGTCTGGTA3’

(6) using recombinant plasmid pMD-gfp as template, using Stratagene site-directed mutagenesis kit, with primer P35 and P36 carries out PCR amplification, obtains cyclic annular PCR product.Amplification condition are as follows: 95 DEG C of initial denaturation 2min, 95 DEG C of denaturation 30s, 55 DEG C are annealed 2min, 68 DEG C of extension 3.5min, 30 circulations, 68 DEG C sufficiently extend 5min；

(7) use restriction endonuclease Dpn I in 37 DEG C of digestion 30min after purification above-mentioned PCR product, in 65 DEG C of reaction 15min with Inactivate restriction endonuclease Dpn I.After purification by digestion products, Transformed E .coli JM109 competent cell is coated on LB (100 μ g/ml Ampicillin) on plate, picking individual colonies are extracted to send to Sangon Biotech (Shanghai) Co., Ltd. after plasmid and are carried out Sequencing, selects the correct plasmid in mutational site, is named as pMD-gfp_m.DNA sequence dna is SEQ ID after gfp site-directed point mutation NO:11, as shown in Figure 2.

(8) by recombinant plasmid pMD-gfp_mUse Sal I and Not I double digestion respectively with PRACTH.Gfp segment digestion purifying It is connect overnight with the digestion products of plasmid PRACTH afterwards, Transformed E .coli JM109 bacterial strain, being coated on LB, (100 μ g/ml ammonia benzyls are green Mycin) on plate, picking individual colonies, Sal I and Not I double digestion is verified after extracting plasmid, obtains green fluorescent protein recombination Expression vector PRACTH-gfp_m, plasmid map is as shown in Figure 3.

Two, Spathaspora passalidarum recombinant bacterium is constructed

The plasmid PRACTH-gfp that will be linearized through Stu I_mBy method described in embodiment 2 or embodiment 3, it is transformed into In Spathaspora passalidarum NRRL Y-27907, transformant is obtained.

Three, transformant screening and verifying

(1) pass through high concentration Hygromycin B resistant plate screening transformant.Green fluorescent protein recombinant expression carrier is converted The transformant obtained after Spathaspora passalidarum NRRL Y-27907 is transferred in higher concentration hygromycin B (350 μ G/mL) in resistant panel, 30 DEG C of culture 2-3d are continuously transferred 3 times using identical method, obtain pure culture transformant bacterial strain.

(2) the bacterium colony PCR verifying of positive transformant.PCR amplification system is prepared with primer P21 and P22, and is added in system Enter the transformant thallus of micro microwave treatment.PCR amplification condition is 95 DEG C of initial denaturation 5min, and 94 DEG C of denaturation 30s, 63 DEG C are annealed 30s, 72 DEG C of extension 1.5min, 30 circulations, 72 DEG C of extension 5min.PCR product shows that 1100bp is left through agarose gel electrophoresis Right band, as shown in figure 4, with DNA fragmentation hph_m-ScCYC1_TStripe size is consistent.

(3) fluorescence detection of positive transformant.The pure culture transformant strain inoculated obtained in step (1) is trained in YPD It supports in base, after 30 DEG C of culture 18h of shaking flask, collection thallus, distilled water washing thalline cell 2 times is simultaneously resuspended in distilled water.It draws A small amount of suspension is placed on glass slide, and covered is observed and taken pictures with oil mirror under fluorescence microscope.As shown in figure 5, can be with Observe that cell issues green fluorescence.

The integrated expression vector of embodiment 5:PR series is in the metabolic engineering side Spathaspora passalidarum The application in face.

One, l-lactate dehydrogenase recombinant expression carrier is constructed

(1) according to the l-lactate dehydrogenase gene order of lactobacillus plantarum, design primer: primer P37 underscore part is The recognition site of Sal I and Xba I, primer P38 underscore part are the recognition site of Not I.

P37:5 ' ACGCGTCGACTGCTCTAGAATGCCAAATCATCAAAAAGTT 3’

P38:5 ' GGCGATAAGAATGCGGCCGCTTATTTATTTTCTAATTCAGC 3’

(2) with lactobacillus plantarum (be purchased from Southern Yangtze University's Chinese Universities ' industrial microorganism resource and information centre, http: // Cicim-cu.jiangnan.edu.cn/) somatic cells are template, using hi-fi polymerase Primerstar, with primer P37 and P38 carries out colony PCR amplification, obtains l-lactate dehydrogenase gene L-ldh.Amplification condition is 98 DEG C of initial denaturation 2min, 98 DEG C denaturation 10s, 62 DEG C of annealing 20s, 72 DEG C of extension 30s, 30 recycle, 72 DEG C of extension 5min.

(3) the L-ldh segment of purifying is cloned into pMD19-Tsimple carrier, Transformed E .coli JM109 competence is thin Born of the same parents are coated on LB (100 μ g/ml ampicillin) plate, picking individual colonies, extract Sal I and Not I double digestion after plasmid Verifying, will verify correct plasmid and send to Sangon Biotech (Shanghai) Co., Ltd. and be sequenced, and select L-ldh's The correct plasmid of DNA sequence dna, is named as pMD-ldh.The DNA sequence dna of L-ldh is SEQ ID NO:12, as shown in Figure 6.

(4) recombinant plasmid pMD-ldh and PRACTH are used into Sal I and Not I double digestion respectively.By the L-ldh through digestion It is connect overnight after fragment purification with the digestion products of plasmid PRACTH, Transformed E .coli JM109 bacterial strain is coated on LB (100 μ g/ Ml ampicillin) on plate, picking individual colonies, Sal I and Not I double digestion is verified after extracting plasmid, and it is de- to obtain Pfansteihl Hydrogen enzyme recombinant expression carrier PRACTH-ldh, plasmid map are as shown in Figure 7.

Two, Spathaspora passalidarum genetic engineering bacterium is constructed

The plasmid PRACTH-gfp that will be linearized through Stu I_mBy method described in embodiment 2 or embodiment 3, it is transformed into In Spathaspora passalidarum NRRL Y-27907, transformant is obtained.

Three, transformant screening and verifying

(1) pass through high concentration Hygromycin B resistant plate screening transformant.L-lactate dehydrogenase recombinant expression carrier is converted The transformant obtained after Spathaspora passalidarum NRRL Y-27907 is transferred in higher concentration hygromycin B (350 μ G/mL) in resistant panel, 30 DEG C of culture 2-3d are continuously transferred 3 times using identical method, obtain pure culture transformant bacterial strain.

(2) the bacterium colony PCR verifying of positive transformant.PCR amplification system is prepared with primer P21 and P22, and is added in system Enter the transformant thallus of micro microwave treatment.PCR amplification condition is 95 DEG C of initial denaturation 5min, and 94 DEG C of denaturation 30s, 63 DEG C are annealed 30s, 72 DEG C of extension 1.5min, 30 circulations, 72 DEG C of extension 5min.PCR product shows that 1100bp is left through agarose gel electrophoresis Right band, with DNA fragmentation hph_m- ScCYC1T stripe size is consistent.

Four, positive transformant shake flask fermentation and Methanogenesis.

(1) the pure culture transformant strain inoculated obtained in above-mentioned steps is shaken in 20ml YPD culture medium in 100ml In bottle, 30 DEG C, after cultivating 18h under the conditions of 200rpm, thallus is collected, distilled water washing thalline cell 2 times is simultaneously resuspended in distilled water In, obtain seed cell.

(2) seed cell is inoculated in 50ml YPD culture medium, makes initial OD₆₀₀0.5 or so.In 250ml shaking flask, 30 DEG C, fermented and cultured is carried out under the conditions of 150rpm.Timing sampling measures bacterium solution OD₆₀₀And related substances content, wherein OD₆₀₀Using Visible spectrophotometer is measured at 600nm.Glucose, Pfansteihl and ethyl alcohol are measured with high performance liquid chromatography (HPLC), color Spectrometer is DIONEX P680；Pump is Agilent 1100；Detector is differential refraction detector (RID)；Chromatographic column is SUGAR SH1011, condition: 0.01mol/L H₂SO₄, flow velocity 0.8ml/min, sample volume 20ul, 50 DEG C of column temperature.Fermented supernatant fluid is taken to be added Isometric 10% trichloroacetic acid, protein precipitation 3 hours or more, 12000r/min was centrifuged 20min, at 0.45 μm of water film filtering After reason, 20 μ l sample introductions are taken, related substances are detected using Composition distribution.Spathaspora passalidarum growth and grape Glycometabolism situation is as shown in Figure 8.

Claims (5)

1. one plant can utilize the expression system of the yeast Spathaspora passalidarum of xylose, it is characterised in that including The yeast Spathaspora passalidarum and a kind of expression vector of xylose can be utilized, the expression vector is from 5 '- 3 ' successively include following operability element:

PMD19-Tsimple plasmid backbone, rDNA homologous recombination sequence, exogenous gene expression box and riddled basins expression Box；

The exogenous gene expression box from upstream to downstream successively include promoter, foreign gene insertion restriction enzyme site and transcription Terminator；

The riddled basins expression cassette includes promoter, antibiotics resistance gene, transcription terminator；

The rDNA homologous recombination sequence is 18s rDNA sequence；Design two primer interception Spathaspora Passalidarum 18s rDNA partial sequence is as homologous recombination site；Primer sequence is as follows:

P1:5 ' GCCGGAATTCTGCCAGTAGTCATATGCTTGTCTC3 '

P2:5 ' ATATTAGGGGTACCCGGGATCCGAAGATCTGTTGAAGAGCAATAAT3 '；

Promoter in the exogenous gene expression box is SpADH_POr SpXYL_P；Transcription terminator is SpCYC1_TOr SpXYL_T；

Promoter in the riddled basins expression cassette is SpTEF1_P；Antibiotics resistance gene be hygromycin gene, Blasticidin resistance gene or G418；Transcription terminator is SpCYC1_TOr ScCYC1_T；

The 18s rDNA sequence is as shown in SEQ ID NO:1；

The SpADH_PPromoter is that the alcohol dehydrogenase gene ADH1 in the source Spathaspora passalidarum starts Son, the DNA sequence dna of the promoter is as shown in SEQ ID NO:2；

The SpXYL_PPromoter is the Xylose reductase gene XYL promoter in the source Spathaspora passalidarum, The DNA sequence dna of the promoter is as shown in SEQ ID NO:3；

The SpTEF1_PPromoter is that the transcription initiation factor gene TEF1 in the source Spathaspora passalidarum is opened Mover, the DNA sequence dna of the promoter is as shown in SEQ ID NO:4；

The SpCYC1_TTerminator is that the cytochrome C gene CYC1 in the source Spathaspora passalidarum is terminated Son, the DNA sequence dna of the terminator is as shown in SEQ ID NO:5；

The SpXYL_TTerminator is the Xylose reductase gene XYL terminator in the source Spathaspora passalidarum, The DNA sequence dna of the terminator is as shown in SEQ ID NO:6；

The ScCYC1_TTerminator is that the cytochrome C gene CYC1 in the source Saccharomyces cerevisiae is terminated Son, the DNA sequence dna of the terminator is as shown in SEQ ID NO:7；

The DNA sequence dna of the hygromycin gene is as shown in SEQ ID NO:8；The hygromycin gene with PRS303H Plasmid DNA is template；

The DNA sequence dna of the blasticidin resistance gene is as shown in SEQ ID NO:9；

The DNA sequence dna of the G418 is as shown in SEQ ID NO:10；

The yeast Spathaspora passalidarum is preserved in american agriculture research Culture Collection Center, deposit number For NRRL Y-27907.

2. the answering in host strain Spathaspora passalidarum genetic transformation of expression vector described in claim 1 With；The host strain Spathaspora passalidarum is preserved in american agriculture research Culture Collection Center, and preservation is compiled Number be NRRL Y-27907.

3. one plant described in claim 1 can utilize the expression system of the yeast Spathaspora passalidarum of xylose Purposes, it is characterised in that it is engineered for expressing foreign protein and host strain own metabolism.

4. a kind of method of expression alien gene, it is characterised in that include the following steps:

(1) expression system described in claim 1 is prepared；

(2) foreign gene that foreign gene is inserted into the expression vector is inserted into restriction enzyme site, obtains recombinant expression carrier；

(3) recombinant expression carrier is converted into host strain Spathaspora passalidarum and expresses institute in host strain State foreign gene.

5. a kind of method of metabolic engineering host strain Spathaspora passalidarum, it is characterised in that including as follows Step:

(1) expression system described in claim 1 is prepared；

(2) foreign gene that target gene is inserted into the expression vector is inserted into restriction enzyme site, obtains recombinant expression carrier；

(3) recombinant expression carrier is converted into host strain Spathaspora passalidarum and expresses institute in host strain State target gene；

(4) recombinant bacterium is cultivated, the recombinant bacterium metabolite is detected.