CN108866237A - A kind of application of shore wheat genome specific molecular marker - Google Patents

A kind of application of shore wheat genome specific molecular marker Download PDF

Info

Publication number
CN108866237A
CN108866237A CN201811035249.0A CN201811035249A CN108866237A CN 108866237 A CN108866237 A CN 108866237A CN 201811035249 A CN201811035249 A CN 201811035249A CN 108866237 A CN108866237 A CN 108866237A
Authority
CN
China
Prior art keywords
wheat
shore
added
sequence
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811035249.0A
Other languages
Chinese (zh)
Inventor
吉万全
杜欣
王艳珍
师晓曦
王长有
陈春环
田增荣
张宏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northwest A&F University
Original Assignee
Northwest A&F University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest A&F University filed Critical Northwest A&F University
Priority to CN201811035249.0A priority Critical patent/CN108866237A/en
Publication of CN108866237A publication Critical patent/CN108866237A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of applications of shore wheat genome specific molecular marker, and shore wheat EST-STS primer mark is carried out PCR amplification and obtains the special sequence of shore wheat by database than China spring, common wheat and psathyrostachys huashanica.To the present invention, our distinguished sequences that shore wheat has been obtained have 1.By the distinguished sequence of shore wheat, to new molecular labeling is developed, effectively distinguishes common wheat and the derivative offspring of common wheat and nearly edge species shore wheat lays a good foundation.

Description

A kind of application of shore wheat genome specific molecular marker
Technical field
The invention belongs to technical field of biological genetic engineering, are related to a kind of application of shore wheat genome specific molecular marker.
Background technique
Shore wheat (Leymusmollis (Trin) Hara.NsNsXmXm 2n=28) belongs to grass family (Poaceae), Tribe Triticeae (Triticeae), barley subtribe (Hordinae), leymus (LeymusHochst) the nearly edge of a perennial wheat of tetraploid Kind of wild plant, is mainly grown in seashore and inland arid area, is distributed in northern China coastal area, Russia (Far East Area), Korea, Japan and North America.It is spent more etc. with stripe rust resisting, powdery mildew, head blight, aphid, drought resisting, saline-alkali tolerant, big fringe excellent Good characteristic.Last century the fifties, Soviet scientists start to carry out wheat and leymus includes the hybridization of shore wheat, save skill through embryo Art obtains the hybrid of tetraploid, hexaploid wheat and shore wheat, and the sixties obtain the amphidiploid of hybrid, and the seventies obtain Obtained the incomplete amphidiploid of durum wheat Yu shore wheat.Fu Jie etc. creates a series of wheats-with excellent economical character The heterologous germplasm line of shore wheat, these germplasm lines still have the characteristic of part shore wheat, especially to the resistance of stripe rust.It is miscellaneous using remote edge Multiple types excellent genes in the wheat of shore are imported into common wheat by the multiple means such as friendship, chromosome engineering, and initiative carries shore The new wheat germplasm of the excellent character of wheat enriches the hereditary basis of wheat breeding, excavates Resistant germplasm, formulates abundant kind of material Material is the effective way and important directions for carrying out genetic improvement of wheat.The process that wheat inhereditary material is shifted to common wheat in shore In, the precise Identification of shore wheat inhereditary material and tracking are important and urgent work.These SSR markers and EST-STS label are equal Can the derivative homologous group of offspring first part of common wheat-shore wheat amplified into the homologous group's addition line of Part VII shore McGee because The specific fragment of group, the transfer importeding into common wheat genetic background for shore wheat favorable genes provide technical support.
Using shore wheat special primer, the special sequence of shore wheat is amplified, is established for the work of subsequent molecular markers development Basis.Therefore, the major technique for establishing shore wheat distinguished sequence is：Using SSR and EST-STS labeled primer in common wheat 7182, corresponding band is amplified in shore wheat and psathyrostachys huashanica, by comparing with reference gene order-checking, it is special obtains shore wheat Sequence.
Abbreviation and Key Term definition
SSR：Simple sequence repeat marker, SSR are that have using 1~6 base as the tandem repetitive sequence of basic unit Relatively rich state property and it is randomly distributed in whole gene group, according to the difference of recurring unit's size, sequence and copy number Length polymorphism is presented.SSR technology is amplified according to the both ends sequence design specific primer of repetitive sequence by PCR reaction The PCR product of different length.
EST-STS：EST, EST refer to from the cDNA library of different tissue sources random selected clone into The expressed sequence segment for being about 300~400bp that the end of row 5 ' or 3 ' end sequencings obtain, number then correspond to its representative The copy number of gene expression, gene expression number is more, and corresponding cDNA clone is more, therefore can be with to the sequencing analysis of clone Understand the gene expression abundance of gene.The technology path being consequently formed in recent years is widely used in gene identification, draws gene expression Map finds the research fields such as new gene, and achieves remarkable effect.
Summary of the invention
The purpose of the present invention is to provide a kind of shore wheat genome specific molecular marker primers in shore wheat variety qualification process In application.SSR and EST-STS labeled primer is expanded, convenient for distinguishing shore wheat and the new wheat of common wheat 7182 and the Huashan The different bands of grass.
Its specific technical solution is：
A kind of application of shore wheat genome specific molecular marker primer in the wheat variety qualification process of shore.
It is chosen in shore wheat (Leymusmollis (Trin) Hara.NsNsXmXm 2n=28) existing specific molecular marker The preferable EST label of 17 specificity has been selected to carry out PCR amplification, agarose gel electrophoresis, glue recycling, connection conversion, sequencing Etc. related experiments further verify whether the shore specific molecular marker filtered out can distinguish shore wheat and other species, especially Differentiation between shore wheat and psathyrostachys huashanica, so shore wheat and psathyrostachys huashanica can also be identified, in relation to report and studies have shown that The affiliation of shore wheat and psathyrostachys huashanica is closer, and the Ns genome of shore wheat contains the dyeing of shore wheat external source from psathyrostachys huashanica The shore wheat of body and the derivative offspring of common wheat.The specific marker selected is as shown in table 1：
Table 1
Detailed description of the invention
Fig. 1 agarose gel electrophoresis results, wherein M：D2000；1：Common wheat 7182；2：Shore wheat；3：The new wheat in the Huashan Grass；
Fig. 2 falls PCR electrophoresis result；
The sequence that Fig. 3 primer BE518255 is expanded in the wheat of shore position corresponding with wheat 4DL sequence；
Extension increasing sequence of Fig. 4 primer BE518255 in shore wheat and psathyrostachys huashanica and common wheat 4AL, 4BL, 4DL alkali Otherness comparing result on basic sequence 503-551bp, wherein 1：One section of sequence of common wheat 4AL；2：Common wheat 4BL One section of sequence；3：One section of sequence of common wheat 4DL；4：One section amplification of the EST primer BE518255 in psathyrostachys huashanica Sequence；5：One section extension increasing sequence of the EST primer BE518255 in Leymus mollis；
Extension increasing sequence of Fig. 5 EST primer BE518255 in shore wheat and psathyrostachys huashanica is in common wheat AL, 4BL, 4DL Otherness comparing result on base sequence 650-690bp, wherein 1：One section of sequence of common wheat 4BL；2：Common wheat One section of sequence of 4DL；3：One section extension increasing sequence of the EST primer BE518255 in psathyrostachys huashanica；4：EST primer BE518255 One section of extension increasing sequence in Leymus mollis.
Specific embodiment
Technical solution of the present invention is described in more detail with specific embodiment with reference to the accompanying drawing.
1. common wheat 7182, shore wheat, psathyrostachys huashanica are marked with the above EST-STS specific primer and carry out PCR expansion Increase, the specific method is as follows：
(1) amplification reaction system (10 μ L of bulking property) includes following component：
(2) amplification program：
94 DEG C of initial denaturation 4min；
94 DEG C of denaturation 45sec,
60 DEG C of annealing 45sec,
72 DEG C of extension 1min30sec,
Circulation 35 times；
72 DEG C of extension 10min；
12 DEG C of preservations.
(3) whole process carries out on S1000 type thermal cycler (Bio-Rad, California, USA).
2. agarose gel electrophoresis
It takes 10 μ L pcr amplification products that 2 μ L 6 × Loading dye are added, mixes, detected with 1.5% Ago-Gel, By ultraviolet gel imager (Champ Gel 5000) scanography, band is counted, analyzes polymorphism, and choose common wheat 7182, it between shore wheat and psathyrostachys huashanica there are notable difference and brighter band carries out cutting glue, is put into after blob of viscose is cut pair The 1.5ml centrifuge tube for finishing number answered, deposit in 4 DEG C it is spare.
3.PCR product gel extraction
The gel extraction of PCR product uses the Universal DNA Purification Kit of Tiangeng company, specific to grasp Make to carry out by kit specification：
(1) 500ulBL is added in (adsorption column is put into collecting pipe) in adsorption column CB2,4 DEG C, 12000rpm, is centrifuged 1min, The waste liquid in collecting pipe is outwelled, adsorption column is placed back in into collecting pipe；
(2) single target DNA band is cut from Ago-Gel (excision redundance as far as possible) be put into it is clean In centrifuge tube, weight is weighed；
(3) isometric PC is added into blob of viscose, and (if blob of viscose weight is 0.1g, volume can be considered 100ul, then be added 100ulPC), 10min or so is placed in 50 DEG C of water-baths, and during which constantly mild spins upside down centrifuge tube, to ensure that blob of viscose is sufficiently molten Solution；
(4) previous step acquired solution is added in an adsorption column CB2,4 DEG C, 12000rpm, is centrifuged 1min, outwells collection Adsorption column is placed back in collecting pipe by the waste liquid in pipe；
(5) 600ul rinsing liquid PW (first adding ethyl alcohol using preceding) is added into CB2,4 DEG C, 12000rpm, is centrifuged 1min, Fall the waste liquid in collecting pipe, adsorption column is placed back in into collecting pipe；
(6) (5) are repeated；
(7) CB2 is put into collecting pipe, 4 DEG C, 12000rpm, is centrifuged 2min, as far as possible removing rinsing liquid, adsorption column is set It places several minutes in greenhouse, thoroughly dries；
(8) CB2 is put into a clean centrifuge tube, suitable 68 DEG C of preheatings is vacantly added dropwise to adsorption column middle position Elution buffer (EB:DdH2O=2:1) it, is placed at room temperature for 5min, 4 DEG C, 12000rpm, 2min is centrifuged, collects DNA solution.
The connection of 4.PCR product and carrier
It is attached using the pMD19-T Vector of TaKaRa company：
(1) linked system：
The PCR product 4.5ul of recycling
SolutionI 5.0ul
pMD19-T Vector 0.5ul
(2) 16 DEG C connect overnight (about 8~10h).
5. configuring solid LB media (1L)
It adjusts PH7.0 (adding 10M NaOH) and (is free of Amp), be settled to 1000ml.Again in 121 DEG C of sterilizing 30min.On super-clean bench A kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices.
6. conversion
(1) the DH5a competent cell that -80 DEG C save is placed in and is dissolved on ice.After to be dissolved, the connection product of 5ul is drawn In 20ul competent cell, gently piping and druming is uniform, ice bath 30min；
(2) 42 DEG C of heat shock 75s cool down rapidly 3min in ice：
(3) 880ulLB culture medium (not added with antibiotic) is added, 37 DEG C, 200rpm shaken cultivation 1h；
(4) 3500~4000rpm room temperatures are centrifuged 2min, and 600ul supernatant is sucked out, and suction is beaten remaining bacterium solution, mixed；
(5) 100ul is sucked out, is applied on Amp+/LB plate (the final concentration of 100ug/ml of ammonia benzyl)；
10h is cultivated in (6) 37 DEG C of inversions；
7. choosing monoclonal
(1) it is put into aseptic operating platform after preparing the expression of 8 connecting legs, opens ultraviolet sterilization 15-20min；
(2) 30ul sterilizing ddH is added in each PCR pipe2O；
(3) bacterium is chosen with the liquid-transfering gun of 10ul, the corresponding PCR pipe of each single bacterium colony is gently inhaled and beaten for several times.
8. bacterium colony PCR is detected
In order to verify positive colony, bacterium colony PCR detection is carried out, therefore bacterium solution is subjected to PCR amplification.
(1) amplification system (10 μ L) is as follows：
1×PCR Buffer(Mg2+)1.0μL,
0.2mMdNTPs 0.8μL,
5μM M13Primers 1.0μL,
5U/μLTaq DNA polymerase0.06μL,
Bacterium solution DNA1.0 μ L,
dd H2Oup to 10.0μL.
(2) amplification program：
94 DEG C of initial denaturation 4min；
94 DEG C of denaturation 45sec,
60 DEG C of annealing 45sec,
72 DEG C of extension 1min30sec,
Circulation 35 times；
72 DEG C of extension 10min；
12 DEG C of preservations.
(3) whole process carries out on S1000 type thermal cycler (Bio-Rad, California, USA).
(4) agar sugar detection
It takes 10 μ L pcr amplification products that 2 μ L 6 × Loading dye are added, mixes, detected with 1.5% Ago-Gel, By ultraviolet gel imager (Champ Gel 5000) scanography, band is analyzed.
9. sequencing
The corresponding bacterium solution of single band is added in the LB liquid medium containing Amp+ 37 DEG C, 200rpm shaken cultivation 3- 4h, then the positive bacterium colony screened is sent to Beijing AudioCodes prosperous Biotechnology Co., Ltd's sequencing portion and is sequenced.This paper institute There is examining order all to be completed by the prosperous Biotechnology Co., Ltd's sequencing of Beijing AudioCodes.
10. sequence is analyzed
Result BioEdit software and the NCBI for being sequenced out by the prosperous Biotechnology Co., Ltd of Beijing AudioCodes (https://blast.ncbi.nlm.nih.gov/Blast.cgi) on-line analysis.
Interpretation of result
Experimental result is illustrated by taking EST primer BE518255 as an example
(1) Fig. 1 is EST primer BE518255 amplified band in common wheat 7182, shore wheat and psathyrostachys huashanica Agarose gel electrophoresis results, BE518255 is expanded in common wheat 7182, shore wheat and psathyrostachys huashanica as seen from the figure Item have nuance.
(2) it is the reliability of detection monoclonal, has carried out bacterium colony PCR, shown by agarose gel electrophoresis results (Fig. 2) For monoclonal.
(3) sequencing result sequence is analyzed：Extension increasing sequence size of the EST primer BE518255 in psathyrostachys huashanica be 858bp；Sequence information is：>Cap_cap_cap_ psathyrostachys huashanica
.CAAGAGCTTGCCAACAATGACAGCCCCTTCTACGCCCGCATTTGTAGCAATGGTGTGTACTGGGGTCTGCAGAATT GTCCAGTCATCAGGATTTTACCCTTCTTT-ATGCAGTA-GCCGTG-AACCAATTG-A- AAAAAAAAAGAATTTTACATACCTTCAAAGCGTTTTGAATGA TCTGGACACCAATCTCTTGGTCAAAGTTTGCTGTAGGCAATTTATCCAAGTCCTTTGACGCATAAAGAAGGGCAACA CCACCACCTATGTTAATCACAGACAGAT-GAGACTTTCAG- TCATGATGATTTCCCGATATTTGTTAACACCCCAACAACTCAACAACAGTCTAAAAATAACTCAACAGCAGTGCTCC AGTATGGTACCTGGTACAATACCCTCCTCTACTGCAGCTTTTGTAGCATTTAGCGCATCTGTCACTCTGTCCTTCTT CTCACCAACTTCTGCTTCACTCGCTCCACCAATCTAAAAGTGAATCAATACGATAAATACAGTGCTACTTTTCTTAT TGGTACTAACATACAATTATGCACCTATCTGCCATTTTTATGCATTATTACTTAAAT- ATGACAAGTAAGCAATAGCACCATAGTTATCATCTTAATATA-- GATAATGAATTTTACCTTCAGAACTGCGACACCACCAGAAAGCTTTGCCAAACGCTCCTGTATCTTTTCCTTATCAT AGTCAGAAG-AGCATTGCTCAATTGAAGATCTCAGCTGTACAAAACA-AATTTAACAGAGATAAGCATG-- TAACATAATGTTCAAACTAATTCATAACTAATTTAATTTAATAT-- GAACAGACCAGCTCAGCTCTCTCTCCAATGGCCTTCTTATCACCCGCTCCATCEST primer BE518255 is in the wheat of shore Extension increasing sequence size be 902bp, sequence information is：>The shore cap_cap_ wheat GCTTGCCAACAATGACAGCCCCTTCTACACCCGCATTTGTAGCAATGGTGTGTACTGGGGTCTGCAGAATTGTCCAG TTATCAGGATTTTACCCTTCTTT-ATGCAGAA-GACATG-AACCAATAG-G- GGGAAAAAAGAATTTTACATACCTTCAACGCATTTTGAATGATCTGGACACCAATCTTTTGGTCAAAGTTTGCGGTA GGCAATTTATCCAAGTCTTTTGACGCATAAAGAAGGGCAACACCACCACCTATGTAAATCATAGACAGAT- CAGACTTTCAG-CCATGATGATTTCCCGATATTTGTTAACACCC- AACAACTCAACAACAGACTAAAAATAACTCAACAGCAGAGCTCCTGTATGGTACCTGGCACAATACCCTCCTCTACT GCAGCTTTTGTAGCATTTAGCGCATCCGTCACTCTGTCCTTCTTCTCACCAACTTCAGCTTCACTCGCTCCACCAAT CTAAAGGTGAATCAAAATACTCAAAACTAGCAACTCAGAGAACATAATCAATACCGTAAATACAATGGTACTTTTCT TATCG-GTACTAGCATACAATTATGCAC-A-TATCTGCCATTTTTATGCATTATTACTTAAAC- ATGAGAAGTAAGCAATAGTACCATAG--TTTAAT-AGTGCTC-T-ACAGATCA- TCTTCATAGATAATGAATTTTACCTTCAGAACTGCAACACCACCAGAAAGCTTTGCCAACCGCTCCTGTATCTTTTC CTTGTCATAGTCAGAAGTA-CATTGTTCAATTGAAGATCTCAGCTGTACAAAA- AGAATTTAACAGTGATTAGCATG--TAACATAATGTTCAAACTGATTCATAACTAATTTAATAAAATAT-- GAACAGACCAGCTCAGCTCTCTCTTCGATGGCCTTCTTATCACCCGCTCCATC
(4) in sequencing procedure, extension increasing sequence of the EST primer BE518255 in shore wheat and psathyrostachys huashanica is had found Sequence location corresponding with common wheat, TGACv1_scaffold_289198_4AL, TGACv1_scaffold_323009_ 4BL, TGACv1_scaffold_343597_4DL, as shown in Figure 3 as BE518255
The sequence expanded in the wheat of shore position corresponding with wheat 4DL sequence.
Fig. 4 the result shows that, extension increasing sequence of the primer BE518255 in psathyrostachys huashanica and common wheat 4AL, 4BL, 4DL Sequence is essentially identical on base sequence 503-551bp, and shore wheat and common wheat and psathyrostachys huashanica are significantly different, therefore special Property label BE518255 can be used to distinguish and common wheat and shore wheat and psathyrostachys huashanica.Therefore it can be concluded that shore wheat specially primer BE518255 has amplified the distinguished sequence of shore wheat.
Fig. 5 the result shows that：Extension increasing sequence of the EST primer BE518255 in the wheat of shore and common wheat 4AL, 4BL, 4DL alkali Sequence similarity is higher on basic sequence 650-690bp, and psathyrostachys huashanica and the sequence differences of common wheat are larger, therefore special Property EST label BE518255 can be used to distinguish and common wheat and shore wheat and psathyrostachys huashanica, while also showing EST label This section of sequence that BE518255 is expanded in the wheat of shore is not from the Ns genome of psathyrostachys huashanica, but the sequence that shore wheat is special Column.
The foregoing is only a preferred embodiment of the present invention, the scope of protection of the present invention is not limited to this, it is any ripe Know those skilled in the art within the technical scope of the present disclosure, the letter for the technical solution that can be become apparent to Altered or equivalence replacement are fallen within the protection scope of the present invention.
Sequence table
<110>Xibei Univ. of Agricultural & Forest Science & Technology
<120>A kind of application of shore wheat genome specific molecular marker
<160> 36
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gtggaaaccc tgtctggtgt 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ttatcgtcgt catcatggga 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ccgtcatcga tagcaatcct 20
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gctcccatgc accaatatct 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
cgttggaact gctctgatga 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
agcagcattt cctctttcca 20
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
cagttggaga ggaattggga 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
aatcgttcaa agtgggcaac 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
ggagactgct catcgtgtca 20
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
gttcagcaag aacacagcca 20
<210> 11
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
tcctcaagga ccccgactac 20
<210> 12
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
tgaagggtga gagaactccg 20
<210> 13
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
ttccacaaga aaatgcctcc 20
<210> 14
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
gctcccgtag ctcatcaaag 20
<210> 15
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
cacaagctgc caagcattta 20
<210> 16
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
cagacgagca gctcccat 18
<210> 17
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
atcaggaatg acatggggaa 20
<210> 18
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
tggttcatca cccaaatcct 20
<210> 19
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
gctgagatca agaaggtggc 20
<210> 20
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
ccataacctc gctgaccatt 20
<210> 21
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 21
tggaattgaa gattgcctgc 20
<210> 22
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 22
cacaaggacc aggttgaggt 20
<210> 23
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 23
gatggagcgg gtgataagaa 20
<210> 24
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 24
caagagcttg ccaacaatga 20
<210> 25
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 25
tcaatcccat ccttggagag 20
<210> 26
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 26
gtgcgcccaa atatcaagtt 20
<210> 27
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 27
gacttctgca tgtcagccaa 20
<210> 28
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 28
ttaacatgtc agcacgagcc 20
<210> 29
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 29
ggatgctggt gatccttcat 20
<210> 30
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 30
ggacaacaga aaggaggcag 20
<210> 31
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 31
aagcttgctg agctttctgg 20
<210> 32
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 32
ttgagggatg tagggcaaag 20
<210> 33
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 33
gctctcgctc atcatcaaca 20
<210> 34
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 34
ctcgcaatgg taccaaggtt 20
<210> 35
<211> 859
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 35
caagagcttg ccaacaatga cagccccttc tacgcccgca tttgtagcaa tggtgtgtac 60
tggggtctgc agaattgtcc agtcatcagg attttaccct tctttatgca gtagccgtga 120
accaattgaa aaaaaaaaga attttacata ccttcaaagc gttttgaatg atctggacac 180
caatctcttg gtcaaagttt gctgtaggca atttatccaa gtcctttgac gcataaagaa 240
gggcaacacc accacctatg ttaatcacag acagatgaga ctttcagtca tgatgatttc 300
ccgatatttg ttaacacccc aacaactcaa caacagtcta aaaataactc aacagcagtg 360
ctccagtatg gtacctggta caataccctc ctctactgca gcttttgtag catttagcgc 420
atctgtcact ctgtccttct tctcaccaac ttctgcttca ctcgctccac caatctaaaa 480
gtgaatcaat acgataaata cagtgctact tttcttattg gtactaacat acaattatgc 540
acctatctgc catttttatg cattattact taaatatgac aagtaagcaa tagcaccata 600
gttatcatct taatatagat aatgaatttt accttcagaa ctgcgacacc accagaaagc 660
tttgccaaac gctcctgtat cttttcctta tcatagtcag aagagcattg ctcaattgaa 720
gatctcagct gtacaaaaca aatttaacag agataagcat gtaacataat gttcaaacta 780
attcataact aatttaattt aatatgaaca gaccagctca gctctctctc caatggcctt 840
cttatcaccc gctccatcs 859
<210> 36
<211> 902
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 36
gcttgccaac aatgacagcc ccttctacac ccgcatttgt agcaatggtg tgtactgggg 60
tctgcagaat tgtccagtta tcaggatttt acccttcttt atgcagaaga catgaaccaa 120
tagggggaaa aaagaatttt acataccttc aacgcatttt gaatgatctg gacaccaatc 180
ttttggtcaa agtttgcggt aggcaattta tccaagtctt ttgacgcata aagaagggca 240
acaccaccac ctatgtaaat catagacaga tcagactttc agccatgatg atttcccgat 300
atttgttaac acccaacaac tcaacaacag actaaaaata actcaacagc agagctcctg 360
tatggtacct ggcacaatac cctcctctac tgcagctttt gtagcattta gcgcatccgt 420
cactctgtcc ttcttctcac caacttcagc ttcactcgct ccaccaatct aaaggtgaat 480
caaaatactc aaaactagca actcagagaa cataatcaat accgtaaata caatggtact 540
tttcttatcg gtactagcat acaattatgc acatatctgc catttttatg cattattact 600
taaacatgag aagtaagcaa tagtaccata gtttaatagt gctctacaga tcatcttcat 660
agataatgaa ttttaccttc agaactgcaa caccaccaga aagctttgcc aaccgctcct 720
gtatcttttc cttgtcatag tcagaagtac attgttcaat tgaagatctc agctgtacaa 780
aaagaattta acagtgatta gcatgtaaca taatgttcaa actgattcat aactaattta 840
ataaaatatg aacagaccag ctcagctctc tcttcgatgg ccttcttatc acccgctcca 900
tc 902

Claims (3)

1. a kind of application of shore wheat genome specific molecular marker primer in the wheat variety qualification process of shore.
2. application according to claim 2, the sequence such as SEQ of the shore wheat genome specific molecular marker primer:ID: NO:1-SEQ:ID:NO:Shown in 34.
3. shore wheat genome specific molecular marker primer answering in the wheat variety qualification process of shore according to claim 1 With, which is characterized in that the shore wheat sequence that amplification obtains is compared with the sequence with reference to genome and psathyrostachys huashanica, thus The special sequence of shore wheat is obtained, concrete application method is as follows：
Common wheat 7182, shore wheat, psathyrostachys huashanica are marked with the above EST-STS specific primer and carry out PCR expansion by step 1. Increase, the specific method is as follows：
(1) amplification reaction system, 10 μ L of bulking property include following component：
(2) amplification program：
94 DEG C of initial denaturation 4min；
94 DEG C of denaturation 45sec,
60 DEG C of annealing 45sec,
72 DEG C of extension 1min30sec,
Circulation 35 times；
72 DEG C of extension 10min；
12 DEG C of preservations；
(3) whole process carries out on S1000 type thermal cycler (Bio-Rad, California, USA)；
Step 2. agarose gel electrophoresis
It takes 10 μ L pcr amplification products that 2 μ L 6 × Loading dye are added, mixes, detected, passed through with 1.5% Ago-Gel Ultraviolet 5000 scanography of gel imager Champ Gel, count band, analyze polymorphism, and choose common wheat 7182, There are notable difference and brighter band carries out cutting glue between shore wheat and psathyrostachys huashanica, corresponding volume is put into after blob of viscose is cut The 1.5ml centrifuge tube of good number, deposit in 4 DEG C it is spare；
Step 3.PCR product gel extraction
The gel extraction of PCR product uses the Universal DNA Purification Kit of Tiangeng company, and concrete operations are pressed Kit specification carries out：
(1) 500ulBL is added in adsorption column CB2,4 DEG C, 12000rpm, is centrifuged 1min, outwells the waste liquid in collecting pipe, will adsorb Column places back in collecting pipe；
(2) single target DNA band is put into clean centrifuge tube from cutting in Ago-Gel, weighs weight；
(3) it is added into blob of viscose isometric PC (if blob of viscose weight is 0.1g, volume is considered as 100ul, then 100ulPC is added), 50 10min is placed in DEG C water-bath, and during which constantly mild spins upside down centrifuge tube, to ensure that blob of viscose sufficiently dissolves；
(4) previous step acquired solution is added in an adsorption column CB2,4 DEG C, 12000rpm, is centrifuged 1min, outwells in collecting pipe Waste liquid, adsorption column is placed back in into collecting pipe；
(5) 600ul rinsing liquid PW is added into CB2, first adds ethyl alcohol using preceding, 4 DEG C, 12000rpm, is centrifuged 1min, outwells collection Adsorption column is placed back in collecting pipe by the waste liquid in pipe；
(6) (5) are repeated；
(7) CB2 is put into collecting pipe, 4 DEG C, 12000rpm, is centrifuged 2min, as far as possible removing rinsing liquid, adsorption column is placed in temperature Room is placed several minutes, is thoroughly dried；
(8) CB2 is put into a clean centrifuge tube, the elution of suitable 68 DEG C of preheatings is vacantly added dropwise to adsorption column middle position Buffer, EB:ddH2O=2:1, it is placed at room temperature for 5min, 4 DEG C, 12000rpm, 2min is centrifuged, collects DNA solution；
The connection of step 4.PCR product and carrier
It is attached using the pMD19-T Vector of TaKaRa company：
(1) linked system：
The PCR product 4.5ul of recycling
SolutionI 5.0ul
pMD19-T Vector 0.5ul
(2) 16 DEG C of connections are stayed overnight, 8~10h；
Step 5. configures solid LB media 1L
PH7.0 is adjusted, 10M NaOH is added, Amp is free of, is settled to 1000ml；Again in 121 DEG C of sterilizing 30min；A kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices on super-clean bench；
Step 6. conversion
(1) the DH5a competent cell that -80 DEG C save is placed in and is dissolved on ice；After to be dissolved, draw the connection product of 5ul in In 20ul competent cell, gently piping and druming is uniform, ice bath 30min；
(2) 42 DEG C of heat shock 75s cool down rapidly 3min in ice：
(3) 880ulLB culture medium is added, not added with antibiotic, 37 DEG C, 200rpm shaken cultivation 1h；
(4) 3500~4000rpm room temperatures are centrifuged 2min, and 600ul supernatant is sucked out, and suction is beaten remaining bacterium solution, mixed；
(5) 100ul is sucked out, is applied on Amp+/LB plate, the final concentration of 100ug/ml of ammonia benzyl；
10h is cultivated in (6) 37 DEG C of inversions；
Step 7. chooses bacterium
(1) it is put into aseptic operating platform after preparing the expression of 8 connecting legs, opens ultraviolet sterilization 15-20min；
(2) 30ul sterilizing ddH is added in each PCR pipe2O；
(3) bacterium is chosen with the liquid-transfering gun of 10ul, the corresponding PCR pipe of each single bacterium colony is gently inhaled and beaten for several times；
Step 8. bacterium colony PCR detection
In order to verify positive colony, bacterium colony PCR detection is carried out, therefore bacterium solution is subjected to PCR amplification；
(1) 10 μ L of amplification system, it is as follows：
(2) amplification program：
94 DEG C of initial denaturation 4min；
94 DEG C of denaturation 45sec,
60 DEG C of annealing 45sec,
72 DEG C of extension 1min30sec,
Circulation 35 times；
72 DEG C of extension 10min；
12 DEG C of preservations；
(3) whole process carries out on S1000 type thermal cycler；
(4) agar sugar detection
It takes 10 μ L pcr amplification products that 2 μ L 6 × Loading dye are added, mixes, detected, passed through with 1.5% Ago-Gel Ultraviolet gel imager scanography analyzes band；
Step 9. sequencing
The corresponding bacterium solution of single band is added in the LB liquid medium containing Amp+ 37 DEG C, 200rpm shaken cultivation 3-4h, then The positive bacterium colony screened is sent to Beijing AudioCodes prosperous Biotechnology Co., Ltd's sequencing portion to be sequenced；All sequencings herein Work is all completed by the prosperous Biotechnology Co., Ltd's sequencing of Beijing AudioCodes；
The analysis of step 10. sequence
Result BioEdit software and the NCBIhttps for being sequenced out by the prosperous Biotechnology Co., Ltd of Beijing AudioCodes:// Blast.ncbi.nlm.nih.gov/Blast.cgi on-line analysis.
CN201811035249.0A 2018-09-06 2018-09-06 A kind of application of shore wheat genome specific molecular marker Pending CN108866237A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811035249.0A CN108866237A (en) 2018-09-06 2018-09-06 A kind of application of shore wheat genome specific molecular marker

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811035249.0A CN108866237A (en) 2018-09-06 2018-09-06 A kind of application of shore wheat genome specific molecular marker

Publications (1)

Publication Number Publication Date
CN108866237A true CN108866237A (en) 2018-11-23

Family

ID=64323392

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811035249.0A Pending CN108866237A (en) 2018-09-06 2018-09-06 A kind of application of shore wheat genome specific molecular marker

Country Status (1)

Country Link
CN (1) CN108866237A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103518615A (en) * 2013-09-29 2014-01-22 西北农林科技大学 Cultivation method and identification method for wheat-leymus mollis multiple alien substitution line containing 3Ns, 6Ns and 7Ns chromosomes
CN103688846A (en) * 2013-12-02 2014-04-02 西北农林科技大学 Wheat-tritileymus 3D (3Ns) alien substitution line cultivation method and identification method
CN104109666A (en) * 2014-05-26 2014-10-22 扬州大学 Chromosome specific marker of elytrigia elongata in wheat background and use thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103518615A (en) * 2013-09-29 2014-01-22 西北农林科技大学 Cultivation method and identification method for wheat-leymus mollis multiple alien substitution line containing 3Ns, 6Ns and 7Ns chromosomes
CN103688846A (en) * 2013-12-02 2014-04-02 西北农林科技大学 Wheat-tritileymus 3D (3Ns) alien substitution line cultivation method and identification method
CN104109666A (en) * 2014-05-26 2014-10-22 扬州大学 Chromosome specific marker of elytrigia elongata in wheat background and use thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
孙文静: "滨麦草特异标记的筛选及抗条锈病小滨麦种质系鉴定", 《中国优秀硕士学位论文全文数据库 农业科技辑》 *

Similar Documents

Publication Publication Date Title
Saha et al. Simple sequence repeats as useful resources to study transcribed genes of cotton
CN109913577B (en) Molecular marker closely linked with wheat stripe rust resistance gene Yr1152 and application thereof
US20100021916A1 (en) Microsatellite-based fingerprinting system for saccharum complex
CN101970669A (en) Gray leaf spot tolerant maize and methods of production
CN106811462B (en) Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof
CN110512025B (en) Molecular marker closely linked with wheat powdery mildew resistance gene PmJM23 and application thereof
Azhaguvel et al. Methodological advancement in molecular markers to delimit the gene (s) for crop improvement
CN106243208A (en) A kind of Oryza sativa L. uneven class sizes gene and the protein of coding thereof
CN110331222B (en) Molecular marker related to cotton fertility restoration and application thereof
CN110699480B (en) Primer group for hybridization of EST-SSR (expressed sequence tag-simple sequence repeat) markers of cymbidium kanran and screening method
CN110777218B (en) Molecular marker linked with wheat powdery mildew resistance gene Pm37 and application thereof
Kitahara et al. Molecular characterization of apple cultivars in Japan by S-RNase analysis and SSR markers
CN108866237A (en) A kind of application of shore wheat genome specific molecular marker
CN108004346B (en) Wheat gene Yr10 molecular marker and application thereof in screening wheat with wheat stripe rust resistance
CN113637791B (en) Molecular marker for simultaneously identifying restorability and authenticity of pepper male sterile three-line hybrid and identification method thereof
CN110106281B (en) Hexaploid I.trifida genome specific SNP molecular marker primer and application
CN104694650B (en) A kind of molecular detecting method and its application and kit for differentiating chicken feed utilization ratio
CN110643728B (en) Method for improving breeding efficiency of poplar crossbreeding
CN111793706A (en) Cowpea InDel molecular marker detection primer group and kit
CN112011637A (en) Molecular marker closely linked with wheat powdery mildew resistance gene Pm68 and application thereof
CN101955988B (en) Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411&lt;7&gt;
Ahmed et al. Assessment of the combining ability and authentication of F 1 hybrids using SSR markers in wheat (Triticum aestivum L.)
Xing et al. A SSR marker for leaf rust resistance gene Lr19 in wheat
CN107828781A (en) A kind of simple and quick paddy DNA extracting method
CN113999934B (en) Rice blast resistance Pik locus allele identification molecular marker and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20181123