CN108866068B

CN108866068B - Gene and polypeptide of conotoxin GeXXVIIA and application thereof

Info

Publication number: CN108866068B
Application number: CN201710322678.5A
Authority: CN
Inventors: 王春光; 姜姗彤; 徐少琼; 邵晓霞; 大卫·亚当; 戴涵深
Original assignee: University of Wollongong; Tongji University
Current assignee: University of Wollongong; Tongji University
Priority date: 2017-05-09
Filing date: 2017-05-09
Publication date: 2021-11-12
Anticipated expiration: 2037-05-09
Also published as: CN108866068A

Abstract

The invention provides a gene and a polypeptide of conotoxin GeXXVIIA and application thereof, wherein the gene of the conotoxin GeXXVIIA is from conus general in south China sea, the coded mature peptide of the conotoxin GeXXVIIA can spontaneously form a homodimer, and the monomer GeXXVIIA linear peptide of the homodimer can inhibit an acetylcholine receptor, so the gene and the polypeptide have good application prospect in the aspect of preparing a medicament or a reagent for inhibiting the acetylcholine receptor.

Description

Gene and polypeptide of conotoxin GeXXVIIA and application thereof

Technical Field

The invention belongs to the technical field of biochemistry, and relates to a gene and polypeptide of conotoxin GeXXVIIA and application thereof.

Background

Conotoxins are small peptides secreted in venom ducts by mollusk conus living in tropical or subtropical marine shallow water areas, can quickly and specifically act on a nervous system, and have shown important application values clinically.

The expression sequence (propeptide) of the conotoxin typically includes a signal peptide. The signal peptides are relatively conserved evolutionarily, and the currently known conotoxins are divided into 27 superfamilies, including A-, B1-, B2-, B3-, C-, D-, E-, F-, G-, H-, I1-, I2-, I3-, J-, K-, L-, M-, N-, O1-, O2-, O3-, P-, S-, T-, V-, Y- (Q.Kaas, R.Yu, A.H.jin, S.Dultere and D.J.Craik,2012: Converer: updated content, updated, and modified peptides in the related complex of nucleic acids, 40, D325-330) and Q-superfamilies (A.Lu, L.Yang, S.Xu. 13,105-118). The mature peptide is an active sequence of the conotoxin, generally contains about 10-40 amino acids and is rich in cysteine.

One conotoxin propeptide can form a plurality of mature peptides (A.Lu, L.Yang, S.Xu and C.Wang,2014: Various conotoxin diversitions recovered by a viral study of molecular & cellular proteins MCP,13,105 and 118) by different shearing modes, but the biological function difference of different mature peptides is still unknown.

The currently known functional conotoxins have strong biological activity, can specifically act on receptors and ion channels on animal cell membranes, and have high recognition power for different subtypes of the receptors and ion channels (H.Terlau and B.M.Olivera,2004: Consujns venoms: a rich source of novel channel-targeted peptides. physical dimensions reviews,84, 41-68). Depending on the receptor and ion channel target, conotoxins with known functions can be divided into 12 different families (Q.Kaas, R.Yu, A.H.jin, S.Dutertre and D.J.Craik,2012: ConoServer: updated content, knowledge, and discovery tools in the confidential database nucleic acids research,40, D325-330), including alpha (alpha), chi (chi), delta (delta), epsilon (epsilon), gamma (gamma), iota (iota), kappa (kappa), mu (mu), omega (omega), rho (rho), sigma (sigma) and tau (tau) families, conotoxins of the same superfamily tend to have one functional activity and a few families have functional activities of multiple families.

Nicotinic acetylcholine receptors (nAChRs) are ubiquitous transmembrane proteins with important physiological effects and clinical research significance in the animal kingdom, are a class of ligand-gated ion channel receptors, and are composed of different alpha and beta subunits, which have distinct pharmacological characteristics.

Nicotinic acetylcholine receptors can be broadly divided into two categories: muscle-type acetylcholine receptors and neuronal-type acetylcholine receptors. Among these, the muscle-type acetylcholine receptors are generally composed of 5 subunits, i.e., 2 α 1 subunits, 1 β subunits, 1 δ subunit, and 1 γ or ε subunit, depending on whether it is a fetal acetylcholine receptor or an adult acetylcholine receptor. The subtypes of mammalian neural nAChRs are much more complex than those of muscular nAChRs, with at least 8 α subunits, 3 β subunits, α 2- α 7, α 9, α 10(α 8 is present in chicks), and β 2- β 4, respectively. Wherein α 2, α 3 and α 4 can bind to β 2 or β 4, respectively, to form functional receptors, such as α 2 β 2, α 3 β 2, α 2 β 4, and the like. Furthermore, α 7 and α 9 can form homomultimers. The lack of highly selective ligand compounds for various subtypes presents a number of challenges in studying and elucidating the fine structure and function of different subtypes of nAChRs. In general, however, the allosteric membrane proteins nAChRs on cell membranes mediate numerous physiological functions of the central and peripheral nervous systems, including learning, memory, response, analgesia, and motor control. nAChRs activate the release of various neurotransmitters, such as dopamine, norepinephrine, serotonin, γ -aminobutyric acid (TalaA, Corringer PJ, GuedinD, LestageP, ChangeuxJP. Nicotinic receptors: allosteric transitions and theroetic targets in the neural system. Nat Rev Drug Discov.2009,8(9): 733-50). nAChRs have proven key targets for screening drugs for the diagnosis and treatment of a large class of important diseases, including pain, alcohol and drug addiction, mental retardation, dementia, schizophrenia, central nervous disorders, epilepsy, parkinson's disease, psychosis, neuromuscular blockade, myasthenia gravis, depression, hypertension, arrhythmia, asthma, muscle relaxation, stroke, breast cancer, and lung cancer, among others (Livett BG, SandallDW, KeaysD, down j, gaylerg, satkunanathan, khalil z. therapeutic topical administration of bacterial acetic acid receptor. toxicon,2006,48(7):810 829). There is no remedy for the above mentioned diseases. Frequently used non-selective nAChR agonists, such as nicotine, while alleviating the symptoms of the above mentioned neurological disorders, produce strong side effects on the heart and gastrointestinal tract and are addictive. Therefore, the development of ligand drugs with high selectivity against various subtypes of nAChRs is a key point in the treatment of the above-mentioned diseases.

Disclosure of Invention

The first purpose of the invention is to provide a gene of conotoxin GeXXVIIA from conus of south China sea, and coded conotoxin GeXXVIIA precursor peptide and conotoxin GeXXVIIA mature peptide thereof.

The invention also aims to provide application of the mature peptide of the conotoxin GeXXVIIA from conus of south China sea.

In order to achieve the above purpose, the solution of the invention is as follows:

a conotoxin GeXXVIIA gene from conus of south China sea has a base sequence shown in SEQ ID NO: 1 is shown.

The amino acid sequence of the precursor peptide of the conotoxin GeXXVIIA coded by the conotoxin GeXXVIIA gene is shown as SEQ ID NO: 2, respectively.

The amino acid sequence of the mature peptide of the conotoxin GeXXVIIA coded by the conotoxin GeXXVIIA gene is shown as SEQ ID NO: 3, respectively.

The conotoxin GeXXVIIA mature peptide can be used for inhibiting acetylcholine receptors. Wherein, the acetylcholine receptor can be a nerve type acetylcholine receptor or a muscle type acetylcholine receptor. Further, the neural type acetylcholine receptor may be an α 9 α 10 acetylcholine receptor subtype, an α 4 β 2 acetylcholine receptor subtype, an α 3 β 4 acetylcholine receptor subtype, an α 7 acetylcholine receptor subtype or an α 4 β 4 acetylcholine receptor subtype. The muscle-type acetylcholine receptor may be the α 1 β 1 δ epsilon acetylcholine receptor subtype.

The conotoxin GeXXVIIA mature peptide can be used for preparing a reagent capable of inhibiting acetylcholine receptors. Wherein, the reagent can be used for inhibiting the activity of the acetylcholine receptor in scientific research.

The conotoxin GeXXVIIA mature peptide can be used for preparing a medicament capable of inhibiting acetylcholine receptors. Wherein the drug can be a drug for treating nervous system diseases, a drug for preventing nervous system diseases, or a drug for treating cancers.

The above nervous system diseases are neuralgia type, addiction type, mental retardation type, dementia type, schizophrenia type, central nervous disorder type, epilepsy type, Parkinson disease type, psychosis type, neuromuscular blockade type, poisoning type, myasthenia gravis type, depression type, hypertension type, hyperlipemia type, inflammation type, leprosy type, arrhythmia type, asthma type, allergy type, muscle relaxation type, diabetes type, sclerosis type, herpes zoster type, or apoplexy type; the cancer is breast cancer, lung cancer, or myeloma.

Further, the above neuralgia type is sciatica, trigeminal neuralgia, lymphatic neuralgia, multiple-point motor neuralgia, acute severe idiopathic neuralgia, extrusion neuralgia, or compound neuralgia; the addiction symptoms are alcohol addiction, drug addiction, nicotine addiction, morphine addiction or cocaine addiction; the poisoning type is alcoholism, drug poisoning, or industrial pollution poisoning; the inflammatory type is vasculitis, hepatitis, Lyme arthritis, or sensory neurofasciitis.

Due to the adoption of the scheme, the invention has the beneficial effects that:

the mature peptide of the conotoxin GeXXVIIA coded by the conotoxin GeXXVIIA gene can spontaneously form a homodimer in nature, and the monomer GeXXVIIA linear peptide of the homodimer has extremely high capacity of inhibiting an acetylcholine receptor, and has good application prospect in the aspect of preparing medicines or reagents for inhibiting the acetylcholine receptor.

Drawings

FIG. 1 is a graph showing the elution profile of the conotoxin GeXXVIIA of example 2 of the present invention. Wherein, the abscissa represents Time (Time) in minutes (min); the ordinate represents the OD value (214 nm).

FIG. 2 is a complete cDNA sequence diagram of the conotoxin GeXXVIIA of example 3 of the present invention.

FIG. 3 is a graph showing the elution profiles of four isomers of the mature peptide monomer GeXXVIIA of conotoxin GeXXVIIA of example 4 of the present invention. Wherein the abscissa represents the elution Time (Time) in minutes (min); the ordinate represents the OD value (214 nm).

Fig. 4 is a schematic flow chart of the preparation of the conotoxin GeXXVIIA monomer linear peptide and the truncated fragment thereof in embodiment 5 of the present invention.

FIG. 5 is an elution profile of GeXXVIIA linear peptide, a derivative of example 5 of the present invention (left panel) and a truncated fragment thereof (right panel). The abscissa represents the elution Time (Time) in minutes (min), and the ordinate represents the OD value (214 nm).

FIG. 6 is a diagram showing the activity of different isomers of the mature peptide monomer of conotoxin GeXXVIIA of the present invention inhibiting different subtypes of acetylcholine receptors. Where the abscissa represents different acetylcholine subtypes and the ordinate is relative to current amplitude in the absence of toxin.

FIG. 7 is a diagram showing the activity of the monomeric derivatives and truncated fragments of the mature peptide of conotoxin GeXXVIIA of the present invention inhibiting acetylcholine receptors in example 6. Where the abscissa represents different acetylcholine subtypes and the ordinate represents current amplitude relative to the absence of toxin.

Fig. 8 is a dose dependence graph of monomeric linear peptide and N-terminal truncated fragment of conotoxin GeXXVIIA mature peptide of the present invention inhibiting acetylcholine receptor alpha 9 alpha 10 subtype and alpha 1 beta 1 delta epsilon subtype. Where the abscissa is the log of the concentration of toxin added and the ordinate represents the current amplitude relative to the absence of toxin.

Detailed Description

The invention provides a conotoxin GeXXVIIA gene from conus general Conus in south China sea, a conotoxin GeXXVIIA precursor peptide and a conotoxin GeXXVIIA mature peptide coded by the gene, and application of the GeXXVIIA mature peptide.

< conotoxin GeXXVIIA Gene >

The conotoxin GeXXVIIA gene is obtained from conus chinensis (Conusgeneralis) of south China sea, and the base sequence of the conotoxin GeXXVIIA gene is shown as SEQ ID NO: 1 is shown. The conotoxin GeXXVIIA gene has at least 425 bp.

< precursor peptide encoded by the Conus toxin GeXXVIIA Gene >

The amino acid sequence of the precursor peptide coded by the conotoxin GeXXVIIA gene is shown as SEQ ID NO: 2, contains 74 amino acids in total.

< mature peptide encoded by the Conus toxin GeXXVIIA Gene >

The precursor peptide coded by the conotoxin GeXXVIIA gene is cut into mature peptide, and the amino acid sequence of the mature peptide is shown as SEQ ID NO: 3, the amino acid sequence of the polypeptide contains 41 amino acids in total.

The inventor finds in the research that: the monomer GeXXVIIA of the conotoxin GeXXVIIA mature peptide can inhibit the activity of an acetylcholine receptor. The mature peptide has strong inhibitory action on muscle type acetylcholine receptor subtype alpha 1 beta 1 delta epsilon and alpha 9 alpha 10 and alpha 4 beta 2 subtypes of nerve type acetylcholine receptor, and shows moderate inhibitory action on alpha 3 beta 2, alpha 3 beta 4, alpha 7 and alpha 4 beta 4 subtypes of nerve type acetylcholine receptor.

The inventor also found in the research that: the monomer GeXXVIIA of the mature peptide coded by the conotoxin GeXXVIIA gene extremely inhibits the activity of a human source nerve type acetylcholine receptor alpha 9 alpha 10 subtype in a linear peptide mode, and the half-inhibition concentration reaches 16.2 nanomole; meanwhile, the linear peptide of the conotoxin GeXXVIIA monomer also shows higher inhibitory activity to the muscle type acetylcholine receptor subtype alpha 1 beta 1 delta epsilon, and reaches the level of 16.2 micromoles; the inhibitory activity of the monomers of the conotoxin GeXXVIIA in different folding modes on the acetylcholine receptors of the two subtypes is reduced by several to ten times compared with the activity of the linear peptide of the monomer. Considering that the amino acid sequence of the conotoxin GeXXVIIA monomer contains more basic amino acid residues, the linear peptide of the monomer is cut into two fragments, and the results show that the inhibition activities of the two fragments on the human nerve type acetylcholine receptor alpha 9 alpha 10 and muscle type acetylcholine receptor alpha 1 beta 1 delta epsilon subtype are both greatly lower than that of the full-length linear peptide, which indicates that the complete sequence of the linear peptide of the conotoxin GeXXVIIA monomer is very important for the high-efficiency inhibition of the activity of the acetylcholine receptor, and the high inhibition activity is independent of the space structure maintained by cysteine. The conotoxins that act on acetylcholine receptors found so far do not depend on the steric structure maintained by cysteine.

< application of mature peptide coded by conotoxin GeXXVIIA gene >

Because the monomer GeXXVIIA of the mature peptide coded by the conotoxin GeXXVIIA gene can inhibit the acetylcholine receptor, the gene can be used for producing the inhibitor of the acetylcholine receptor. Acetylcholine receptors that can be inhibited include neuronal acetylcholine receptors or muscle acetylcholine receptors. Wherein the nerve type acetylcholine receptor is alpha 9 alpha 10 acetylcholine receptor subtype, alpha 4 beta 2 acetylcholine receptor subtype, alpha 3 beta 4 acetylcholine receptor subtype, alpha 7 acetylcholine receptor subtype or alpha 4 beta 4 acetylcholine receptor subtype. The muscle acetylcholine receptor is the alpha 1 beta 1 delta epsilon acetylcholine receptor subtype.

Furthermore, because the monomeric peptide of the mature peptide coded by the gene GeXXVIIA of the conotoxin has the function of inhibiting acetylcholine receptors, the monomeric peptide can be used for preparing medicaments or reagents for inhibiting the acetylcholine receptors, such as medicaments for treating nervous system diseases, medicaments for preventing the nervous system diseases, medicaments for treating cancers and the like.

Neurological diseases are in particular neurological diseases related to acetylcholine receptors, such as: nervous system diseases of neuralgia type, nervous system diseases of addiction type, nervous system diseases of mental retardation type, nervous system diseases of dementia type, nervous system diseases of schizophrenia type, nervous system diseases of central nervous system disorder type, nervous system diseases of epilepsy type, nervous system diseases of Parkinson's disease type, nervous system diseases of psychosis type, nerve muscle block type, nervous system diseases of poisoning type, nervous system diseases of myasthenia gravis type, nervous system diseases of depression type, nervous system diseases of hypertension type, nervous system diseases of hyperlipidemia type, nervous system diseases of inflammation type, nervous system diseases of leprosy type, nervous system diseases of arrhythmia type, nervous system diseases of asthma type, nervous system diseases of allergy type, nervous system diseases of muscle relaxation type, nervous system diseases of inflammation type, nervous system diseases of mental retardation type, nervous system diseases of peripheral nerve system, nerve diseases of peripheral nerve system diseases, nerve diseases of peripheral nerve diseases, nerve diseases of peripheral nervous system diseases, nerve diseases of peripheral nervous system diseases, etc Diabetes type nervous system diseases, sclerosis type nervous system diseases, herpes zoster type nervous system diseases, or apoplexy type nervous system diseases.

Among them, neuralgia type nervous system diseases are manifested by symptoms such as sciatica, trigeminal neuralgia, lymphatic neuralgia, multiple-point motor neuralgia, acute severe idiopathic neuralgia, crush neuralgia, or complex neuralgia.

The nervous system diseases of addiction type are manifested by symptoms of alcohol addiction, drug addiction, nicotine addiction, morphine addiction, or cocaine addiction.

The toxic type nervous system diseases are manifested by alcoholism, drug intoxication, or industrial pollution intoxication, etc.

Inflammatory type of nervous system diseases are manifested by vasculitis, hepatitis, Lyme arthritis, or sensory perineuritis.

Cancer is particularly a cancer associated with acetylcholine receptors, for example: breast cancer, lung cancer, myeloma, or the like.

The invention will be further described with reference to examples of embodiments shown in the drawings.

Example 1: crude toxin extraction of natural conotoxin GeXXVIIA

The natural conotoxin GeXXVIIA is extracted from conus chinensis (Conusgeneralis) collected from the south China sea, and the crude toxin extraction method comprises the following steps:

(1) separating venom tube tissues of living conus armoricanus and placing the venom tube tissues in a culture dish;

(2) the venom tube was minced with surgical scissors (this operation was performed on ice), 25mL of 0.1% TFA (0.1% TFA in pure water) was added, and the minced venom tube in the petri dish was washed into a 100mL small beaker;

(3) placing the small beaker on ice, magnetically stirring for 30 minutes, centrifuging for 15min at 4 ℃ and 12000g, collecting supernatant into a 500mL freeze-drying bottle, extracting the precipitate once with 25mL of 20% acetonitrile (containing 0.1% TFA), then centrifuging for 15min at 4 ℃ and 12000g, collecting supernatant, combining the supernatant into the 500mL freeze-drying bottle, and extracting the precipitate three times in the same way, wherein the extraction solutions for the three times are sequentially 30% acetonitrile (containing 0.1% TFA), 40% acetonitrile (containing 0.1% TFA) and 50% acetonitrile (containing 0.1% TFA), and the freeze-drying supernatant obtained by each extraction is combined into the 500mL freeze-drying bottle;

(4) the resulting supernatant was lyophilized, dissolved with 0.1% TFA and dispensed into EP tubes and frozen at-20 ℃ until use.

Example 2: separation and purification of natural conotoxin GeXXVIIA

The method for separating and purifying the natural conotoxin GeXXVIIA comprises the following steps: the crude toxin sample frozen at-20 deg.C was centrifuged at 4 deg.C and 12000g for 15min to remove the precipitate, and the supernatant was separated by HPLC using a hydrophobic reverse phase column ZORBAX 300SB-C18 (9.4X 250 mm). The reagents and procedures used for the isolation and purification were set as follows: buffer A was prepared from 0.1% TFA and pure water, and Buffer B was prepared from 0.1% TFA and pure acetonitrile, the detection wavelengths were 214nm and 280nm, and the concentration of Buffer B was from 5% to 55% in 50 minutes, and the fractions were collected and lyophilized. The collected fractions were then further purified on an analytical ZORBAX 300SB-C18 (4.6X 250mm) reverse phase column to give pure samples which were lyophilized for use. The results of the separation are shown in FIG. 1. As shown in FIG. 1, ZORBAX 300SB-C18 semi-prepared reverse phase column, detection wavelength of 214nm, flow rate of 0.5mL/min, elution gradient: 0-50min, 5-55% Buffer B (Buffer A: 0.1% TFA in water, Buffer B: 0.1% TFA in ACN). In the figure,' > indicates the position of the peak of GeXXVIIA.

Example 3: preparation of the complete cDNA sequence of the native conotoxin GeXXVIIA

The preparation method of the complete cDNA sequence of the natural conotoxin GeXXVIIA comprises the following steps: taking out a venom tube of conus radiatus from a refrigerator at-80 deg.C, quickly placing into a mortar precooled by liquid nitrogen, carefully grinding into powder in the liquid nitrogen, and continuously adding liquid nitrogen during the process; total RNA was then extracted according to the method recommended by Trizol Total RNA Isolation Reagent Kit, and the complete cDNA sequence of GeXXVIIA was cloned by 3'-RACE and 5' -RACE. The method for cloning the complete cDNA sequence comprises the following specific steps: two 0.5mL EP tubes (treated with DEPC water) were taken, 8. mu.l of RNase-free water was added, 2. mu.l of total RNA extracted was added, 1. mu.l of the universal primer AP was added, and first strand cDNA synthesis was performed under the action of Superscript II reverse transcriptase, and the specific procedures were according to the method recommended by the Invitrogen 3' -RACE kit.

Design of primers

GSP 1: 5 ' -ATGTCNACNGGNACNAAYTAY-3 ' (Y: T/C, N: A/T/C/G) ("/" indicates "or"), 3' -RACE upstream degenerate primer 1, corresponding to the sequenced N-terminal sequence MSTGTNY;

GSP 2: 5 ' -ATGAGYACNGGNACNAAYTAY-3 ' (Y: T/C, N: A/T/C/G), 3' -RACE upstream degenerate primer 2, corresponding to the sequenced N-terminal sequence MSTGTNY;

GSP 3: 5 ' -GCNYTNATGTCNACNGGNACN-3 ', 3' -RACE upstream degenerate primer 3 corresponding to the sequenced N-terminal sequence ALMSTGT;

GSP 4: 5 ' -GCNYTNATGAGYACNGGNACN-3 ', 3' -RACE upstream degenerate primer 4 corresponding to the sequenced N-terminal sequence ALMSTGT;

GSP 5: 5 ' -ACNGGNACNAAYTAYCGNYT-3 ', 3' -RACE upstream degenerate primer 5 corresponding to the sequenced N-terminal sequence TGTNYRL;

GSP 6: 5 ' -ACNGGNACNAAYTAYAGRYT-3 ' (Y: T/C, R: G/A, N: A/T/C/G), 3' -RACE upstream degenerate primer 6, corresponding to the sequenced N-terminal sequence TGTNYRL;

GSP 7: 5 ' -YTNCCNCCNACNACNTGY-3 ', 3' -RACE upstream degenerate primer 7, corresponding to the sequenced N-terminal sequence LPPTTC;

GSP 8: 5 ' -YTNCCNCCNACNAARTGY-3 ', 3' -RACE upstream degenerate primer 8 corresponding to the sequenced N-terminal sequence LPPTKC;

GSP 9: 5 ' -GCNYTRATGTCNACNGGNACNAAYTAY-3 ', 3' -RACE upstream degenerate primer 9, corresponding to the sequenced N-terminal sequence ALMSTGTNY;

GSP 10: 5 ' -GCNYTRATGAGYACNGGNACNAAYTAY-3 ', 3' -RACE upstream degenerate primer 10, corresponding to the sequenced N-terminal sequence ALMSTGTNY;

GSP 11: 5'-CACAGGTATGGATGACTCAGG-3', gene specific antisense primer 1 designed based on 3' cDNA obtained by 3' -RACE, a gene sequence CCTGAGTCATCCATACCTGTG corresponding to 3' -untranslated region;

GSP 12: 5'-CCAGCTCTATACGCACGCATCC-3', gene specificity antisense primer 2 designed according to 3 'end cDNA obtained by 3' -RACE, corresponding to C end sequence DACV of conopeptide;

AUAP: 5'-GGCCACGCGTCGACTAGTAC-3', 3' -RACE downstream universal primers;

signal primer: 5'-CATCGTCAAGATGAAACTGACG-3', a sequence corresponding to the signal peptide of Mik 41.

3' -RACE step: the first PCR reaction was performed using the Outer primer GSP9/10 near the N-terminus of the degenerate primers synthesized above and the Outer primer provided in TaKaRa 3' -RACE kit, annealing at 55 ℃. And if the target product cannot be obtained in the first round of PCR reaction, pairing an upstream Inner periphery primer GSP1/2 with an Inner primer in the kit, and carrying out second round of PCR amplification by using the first round of PCR product as a template, wherein the annealing temperature is 52 ℃, and finally obtaining the 3' -terminal sequence of the gene corresponding to the conotoxin GeXXVIIA.

Because the signal peptide of the same family in the conotoxin is very conservative, a primer corresponding to the known signal peptide sequence of MiK41 is paired with a 3' -end specific antisense primer for PCR amplification, and finally, a complete cDNA sequence of the conotoxin GeXXVIIA is obtained.

The complete cDNA sequence of the conotoxin GeXXVIIA is shown in FIG. 2. The signal peptide sequence is shown in phantom in FIG. 2, with the mature peptide underlined, the Pro region in the middle, and the stop codon indicated by an asterisk.

Example 4: in vitro oxidation folding of conotoxin GeXXVIIA mature peptide monomer

The inventor finds in the research that: in nature, the mature peptide of the conotoxin GeXXVIIA encoded by the gene of the conotoxin GeXXVIIA can spontaneously form homodimers containing 5 pairs of disulfide bonds, and each monomer contains 5 cysteine residues. However, the proportion of the natural GeXXVIIA in the venom is very small, and the research on the structure and the function cannot be satisfied, and a method for chemically synthesizing linear GeXXVIIA and performing in-vitro oxidation folding must be used.

In the invention, through exploration of the in vitro oxidation folding conditions of chemically synthesized GeXXVIIA, the oxidation folding conditions are finally determined as follows: to a buffer containing 50mM Tris-HCl, pH 8.0,400mM argine, 0.02mM DTT and 0.3mM oxidized DTT, 20. mu.M of synthesized GeXXVIIA was added and reacted at 4 ℃ for one week to obtain 4 folded isomers of the mature peptide monomer of conotoxin GeXXVIIA, i.e., M1, M2, M3 and M4. The elution profiles of the 4 isomers of the resulting GeXXVIIA monomeric peptides are shown in fig. 3. In fig. 3, m1, m2, m3 and m4 represent different isomers, respectively. The abscissa of FIG. 3 represents elution time (time), and the ordinate represents OD value (214 nm).

Example 5: preparation of monomeric peptide derivative of conotoxin GeXXVIIA mature peptide

The inventor finds in the research that: the inhibitory activity of 4 isomers (GeXXVIIAm1-m4) of the mature peptide monomer of the conotoxin GeXXVIIA on acetylcholine receptors is quite similar, for example, they can all strongly inhibit the subtypes of nervous type alpha 9 alpha 10 and muscle type alpha 1 beta 1 delta gamma acetylcholine receptors, which indicates that the disulfide bond in the mature peptide monomer of the conotoxin GeXXVIIA may not participate in the interaction process with the receptors. Therefore, it is necessary to protect the cysteine in the monomer with a modifier and then to examine its activity on the receptor.

In the invention, 5 cysteines in synthesized conotoxin GeXXVIIA mature peptide monomers are all modified by 10 mu M Iodoacetamide (IAA), so that the cysteines cannot spontaneously form disulfide bonds, and the Cys-blocked GeXXVIIA-L is obtained. Meanwhile, considering that the sequence of the conotoxin GeXXVIIA mature peptide monomer contains a plurality of basic amino acids, the GeXXVIIA-L is cut into two fragments by using Asp-N enzyme, the two fragments are GeXXVIIA-L-Nter and GeXXVIIA-L-Cter respectively, and the two fragments are separated and purified by using high performance liquid chromatography, and finally the two fragments after enzyme cutting are obtained. The two fragments after cleavage are shown in FIGS. 4 and 5.

Example 6: biological activity determination of monomer and derivative of conotoxin GeXXVIIA mature peptide

In order to accurately determine the selectivity of monomer GeXXVIIAm and derivative GeXXVIIA-L, GeXXVIIA-L-Nter/Cter of conotoxin GeXXVIIA mature peptide to acetylcholine receptor subtype (nAChR subtype), the invention adopts electrophysiological experiments to test the effects of the monomer GeXXVIIAm and the derivative GeXXVIIA-L, GeXXVIIA-L-Nter/Cter on the alpha 9 alpha 10 subtype, alpha 7 subtype, alpha 3 beta 2 subtype, alpha 3 beta 4 subtype, alpha 4 beta 2 subtype, alpha 4 beta 4 subtype and muscle type acetylcholine receptor alpha 1 beta 1 delta gamma expressed by Xenopus oocytes.

The specific steps of the electrophysiological experiment are as follows: expressing different subtypes of acetylcholine receptor on Xenopus laevis oocyte surface, and recording the current generated by acetylcholine receptor opening caused by acetylcholine addition by double-electrode voltage clamp method. When conotoxin GeXXVIIA monomer and linear peptide derivative GeXXVIIA-L, GeXXVIIA-L-Nter/Cter with different concentrations are added, the current generated by acetylcholine receptor can be inhibited to different extent. The inhibition degree is plotted against the concentration of different conotoxins, and the half inhibition concentration IC can be obtained by fitting the following equation₅₀：

E_x＝E_maxX^nH/(X^nH+IC₅₀ ^nH)

The test results of the electrophysiological experiments are shown in table 1 and fig. 6, 7, and 8. The ordinate in the figure represents Relative current amplitude.

TABLE 1 test results of electrophysiological experiments

H in Table 1 indicates human, i.e. acetylcholine receptor isOf human origin, r denotes rat, i.e. the acetylcholine receptor is of murine origin. As shown in the data in Table 1, GeXXVIIA-L, a monomer derivative of mature peptide of conotoxin GeXXVIIA, can interact with a plurality of acetylcholine receptor subtypes, wherein the monomer derivative has strong antagonistic effect on the neuronal acetylcholine receptor subtype alpha 9 alpha 10, and IC₅₀Can reach the nanomole per liter level; the effect on the muscle type acetylcholine receptor subtype alpha 1 beta 1 delta gamma is strong, and the micromole per liter level is achieved; moderate effect on beta 04 beta 12 subtype; the effects on α 3 β 2, α 3 β 4, α 7 and α 4 β 4 are weak.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. It will be readily apparent to those skilled in the art that various modifications to these embodiments may be made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above embodiments, and those skilled in the art should make improvements and modifications within the scope of the present invention based on the disclosure of the present invention.

SEQUENCE LISTING

<110> Wulun university of Tongji university

Gene and polypeptide of <120> conotoxin GeXXVIIA and application thereof

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 425

<212> DNA

<213> Conusgeneralis

<400> 1

catcgtcaag atgaaactga cgtgcgtgtt gatcatcacc gtgctgttcc tgacggcctg 60

tcaactcact acagctgtga cttactccag aggtgagcat aagcatcgtg ctctgatgtc 120

aactggcaca aactacaggt tgctcaagac atgccgtggt tccggtcgtt attgtcgctc 180

accttatgat tgccgcagaa gatattgcag acgcatttcg gatgcgtgcg tatagagctg 240

gtctggcgtc tgatattccc cttctgtgct ctatcccctt ttgcctgagt catccatacc 300

tgtgagtgat catgaaccac tcaataccta ctgctctgga ggcttcagag gaactacatt 360

gaaataaaac cgcattgcaa tgaaaaaaaa aaacctatag tgaaatcact agtggaggat 420

ccgcg 425

<210> 2

<211> 74

<212> PRT

<213> Conusgeneralis

<400> 2

Met Lys Leu Thr Cys Val Leu Ile Ile Thr Val Leu Phe Leu Thr Ala

1 5 10 15

Cys Gln Leu Thr Thr Ala Val Thr Tyr Ser Arg Gly Glu His Lys His

20 25 30

Arg Ala Lys Met Ser Thr Gly Thr Asn Tyr Arg Leu Leu Lys Thr Cys

35 40 45

Arg Gly Ser Gly Arg Tyr Cys Arg Ser Pro Tyr Asp Cys Arg Arg Arg

50 55 60

Tyr Cys Arg Arg Ile Ser Asp Ala Cys Val

65 70

<210> 3

<211> 41

<212> PRT

<213> Conusgeneralis

<400> 3

Ala Lys Met Ser Thr Gly Thr Asn Tyr Arg Leu Leu Lys Thr Cys Arg

1 5 10 15

Gly Ser Gly Arg Tyr Cys Arg Ser Pro Tyr Asp Cys Arg Arg Arg Tyr

20 25 30

Cys Arg Arg Ile Ser Asp Ala Cys Val

35 40

Claims

1. A conotoxin GeXXVIIA gene from conus of south China sea is characterized in that: the base sequence is shown as SEQ ID NO: 1, the amino acid sequence of the encoded conotoxin GeXXVIIA mature peptide is shown as SEQ ID NO: 3, respectively.

2. A precursor peptide of conotoxin GeXXVIIA encoded by the conotoxin GeXXVIIA gene of claim 1, wherein: the amino acid sequence is shown as SEQ ID NO: 2, respectively.

3. A mature peptide of conotoxin GeXXVIIA encoded by the conotoxin GeXXVIIA gene of claim 1, wherein: the amino acid sequence is shown as SEQ ID NO: 3, respectively.

4. A use of a mature peptide of conotoxin GeXXVIIA according to claim 3, wherein: the application of the conotoxin GeXXVIIA mature peptide in preparing an acetylcholine receptor inhibiting reagent;

the acetylcholine receptor is a nerve-type acetylcholine receptor or a muscle-type acetylcholine receptor.

5. Use according to claim 4, characterized in that: the neural acetylcholine receptor is alpha 9 alpha 10 acetylcholine receptor subtype, alpha 4 beta 2 acetylcholine receptor subtype, alpha 3 beta 4 acetylcholine receptor subtype, alpha 7 acetylcholine receptor subtype or alpha 4 beta 4 acetylcholine receptor subtype; alternatively, the muscle-type acetylcholine receptor is the α 1 β 1 δ epsilon acetylcholine receptor subtype.