CN113493502B - Alpha-conotoxin peptide TxIE, pharmaceutical composition and application thereof - Google Patents

Abstract

The invention belongs to the field of biology and medicine, and relates to a novel alpha-conotoxin peptide TxIE, a pharmaceutical composition and application thereof. Specifically, the invention relates to an isolated polypeptide which is a polypeptide with an amino acid sequence shown as SEQ ID NO. 1 or a mutant thereof; wherein the amino acid sequence of the mutant is that glycine at the 1 st position in the sequence shown in SEQ ID NO. 1 is replaced by glutamic acid or aspartic acid; and/or the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced by alanine, leucine or isoleucine. The polypeptide provided by the invention can specifically block acetylcholine receptors, has high selectivity and strong blocking activity particularly on drug targets alpha 6/alpha 3 beta 2 beta 3 nAChR of addiction and parkinsonism and drug targets alpha 6/alpha 3 beta 4 nAChR related to pain, and has the potential of preparing drugs for stopping smoking, stopping drug or easing pain or preparing drugs for preventing and/or treating parkinsonism, depression, dementia and schizophrenia.

Description

Alpha-conotoxin peptide TxIE, pharmaceutical composition and application thereof

Technical Field

The invention belongs to the field of biology and medicine, and relates to a novel alpha-conotoxin peptide TxIE, a pharmaceutical composition and application thereof. The invention also relates to mutants of TxIE.

Background

Conotoxins can be divided into a number of pharmacological families, such as alpha, omega, mu, delta, etc., according to their receptor targets. Each superfamily can be further divided into alpha, alpha A, kappa A (A-superfamily), omega, delta, kappa, mu O (O-superfamily), mu, phi, KM (M-superfamily) and other families according to receptor target types. Among them, α -conotoxins are the best-selective nicotinic acetylcholine receptor (nAChRs) subtype specific blockers currently found (Wu RJ, wang L, xiang h.the Structural Features of α -Conotoxin Specifically Target Different Isoforms of Nicotinic Acetylcholine receptors.curr Top Med chem.2015,16 (2), 156-169.Lebbe EK,Peigneur S,Wijesekara I,Tytgat J.Conotoxins targeting nicotinic acetylcholine receptors:an overview.Mar Drugs.2014,12 (5), 2970-3004.).

Alpha-conotoxins are the earliest conus toxins found by people, are usually small in molecular weight, generally consist of 12-19 amino acid residues and are rich in disulfide bonds. Alpha-conotoxins are various in variety, various in activity and complex in structural change. Alpha-conotoxins can be classified by their highly conserved signal peptide sequences, pharmacological activity and cysteine patterns. The alpha-conotoxin has a cysteine pattern of CC-C-C, wherein disulfide bonds are connected in a manner of C1-C3 and C2-C4, 2 loop rings are formed between disulfide bonds, the alpha-conotoxin can be divided into a plurality of subfamilies such as alpha 3/5, alpha 4/7, alpha 4/6, alpha 4/4 and alpha 4/3 according to the different numbers of amino acids between two, three and three four cysteines, the difference of the characteristics and the residue composition of each loop is the basis of toxin acting on different receptor subtypes (Ulens C, hogg RC, celie PH, et al structure determinants of selective alpha-conotoxin binding to a nicotinic acetylcholine receptor homolog AChBP [ J ]. Proc Natl Acad Sci USA ] 2006; 103:3615-20.)

Nicotinic acetylcholine receptors (nAChRs) are allosteric membrane proteins on the cell membrane that mediate a number of physiological functions of the central and peripheral nervous system, as well as the immune system, including learning, memory, response, analgesia, and motor control. nAChRs activate the release of various neurotransmitters such as dopamine, norepinephrine, serotonin, gamma-aminobutyric acid (Giribaldi J, dutertre S. Alpha. -Conotoxins to explore the molecular, physiological and pathophysiological functions of neuronal nicotinic acetylcholine receptors. Neurosci Lett.2017Dec 2.Pii: S0304-3940 (17) 30972-2). nAChRs are assembled from different α and β subunits into a wide variety of subtypes, each with distinct pharmacological characteristics. Wherein the muscle type acetylcholine receptor is composed of 5 subunits, comprising 2 alpha 1 subunits, 1 beta subunit, 1 delta subunit and 1 gamma or epsilon subunit, depending on whether it is fetal or adult acetylcholine receptor. Mammalian neural nAChRs subtypes are much more complex than muscle nAChRs, with at least 8 alpha subunits, 3 beta subunits, α2- α7, α9, α10 (α8 in chicks), and β2- β4, respectively. Wherein α2, α3 and α4 can bind to β2 or β4, respectively, to form functional receptors such as α2β2, α3β2, α2β4, etc. In addition, α7 and α9 can form homomultimers. Because of the lack of highly selective ligand compounds for the various subtypes, there are challenges to study and elucidate the fine structure and function of the various nAChRs subtypes.

Studies have shown that nAChRs containing the α6 subunit (abbreviated as α6 nAChRs) are primarily distributed in the visual system and retina, catecholaminergic nucleus, hippocampus, dorsal root ganglion, and midbrain dopaminergic regions, which mediate some important physiological regulatory functions of organisms, such as: mood, pain, addiction, rewards, depression, and the like. α6 nachrs are primarily important targets for the treatment of nicotine addiction and neurodegenerative diseases caused by dopaminergic nervous system injury. The nAChRs expressed in Dopaminergic (DA) neurons are drug action targets for the treatment of neuropsychiatric diseases such as addiction to nicotine, morphine and cocaine, parkinson's disease, dementia, schizophrenia, depression, etc. (Larsson, a.; jervag, e.; svensson, l.; sodepralm, b.; engel, j.a.; is an Alpha-connoxin MII-sensitive mechanism involved in the neurochemical, stinmulator, and rewarding effects of ethanolAlcohol 2004,34 (2-3), 239-50. Jervhag, e.; egciclov, e.; dickson, s.l.; svensson, l.; engel, j.a.; alpha-connoxin MII-sensitive nicotinic acetylcholine receptors are involved in mediating the ghrelin-induced locomotor stimulation and dopamine overflow in nucleus accumbens. The α6 subunit-containing nAChRs in DA neurons are expressed very highly, and the mechanism of the important role that α6 nAChRs have in addiction is not known due to the lack of pharmacological molecular probes specific for α6 nAChRs. The α6β2-nAChRs subtype on the striatum in the brain of mammals is considered as a drug action target for the treatment of tobacco, drug and alcohol addiction (Exley, r.; clements, m.a.; harteng, h.; mcIntosh, j.m.; cragg, s.j., alpha6-containing nicotinic acetylcholine receptors dominate the nicotine control of dopamine neurotransmission in nucleus accums. Neuroblastology 2008,33 (9), 2158-66.Gao, f.; chen, d.; ma, x.; sudweks, s.; yorgason, j.t.; gao, m.; turner, d.; eaton, j.b.; mcIntosh, j.m.; lukas, r.j.; white, p.; chang, y.; stephen, s. C. 6. 52, u. 52, 6-52. 6. Peak, v..52. 6. Alpha. 6. V..v. The α6 subunit is not widely distributed in the brain, but is enriched in the dopaminergic neuronal region of the midbrain, which is a region closely related to pleasure, rewards and mood control, meaning that α6 nachrs play a key role in the modulation of drug-induced addiction and mood control etc. (Yang, k.c., g.z.jin, et al (2009). Mysterious alpha6-containing nAChRs: function, pharmacology, and pathysiology. Acta Pharmacol 30 (6): 740-751.Klink, r.; de Kerchove d' Exaerde, a.; zoli, M.; changeux, J.P., 52 nucleic acid. The Journal of neuroscience,2001,21 (5), 1452-63.Azam, L., winzer-Serhan, U.H., chen, Y., leslie, F.M., expression of neuronal nicotinic acetylcholine receptor subunit mRNAs within midbrain dopamine nucleic acid. The Journal of comparative neurology, 444 (3), 260-74.Champtiaux, N., gotti, C., cordero-Erausquin, M., david, D.J., przybylski, C., lena, C., clementi, F., moretti, M., rossi, F.M., lemic, N., mcInfish, J.M., gardner, A.M., change, J.P., subunit composition of functional nicotinic receptors in dopaminergic neurons investigated with knock-out, 24, U.S. 35, J., U.S. 35, J., N., 35, N., N J, N, R.M. alpha6-Containing nicotinic acetylcholine receptors in midbrain dopamine neurons are poised to govern dopamine-mediated behaviors and synaptic plausibility.Neuroscience 2015,304,161-175.Chen, D.; gao, f.; ma, x; eaton, j.b.; huang, y; gao, m; chang, Y.; ma, z; der-Ghazarian, t.; neisewander, J.; whiteaker, p.; wu, j; su, Q.Cocaine Directly Inhibits alpha6-Containing Nicotinic Acetylcholine Receptors in Human SH-EP1 Cells and Mouse VTA DA Neurons. Front Pharmacol 2019,10,72).

α6 nachrs are also expressed on catecholaminergic neurons and retina (Le Novere, n.; zoli, m.; changeux, j.p., neuronal nicotinic receptor alpha 6subunit mRNA is selectively concentrated in catecholaminergic nuclei of the rat brain.The European journal of neuroscience 1996,8 (11), 2428-39.Vailati, s.; hanke, w.; bejan, a.; barabino, b.; longing, r.; barresta, b.; moretti, m.; clenti, f.; gotti, c.; functional alpha6-containing nicotinic receptors are present in chick bushing. Molecular pharmacology 1999,56 (1), 11-9.; α6β2. Nachrs. Have the function of modulating dopamine release (Wang, l.; shang, s.; kang, x.; s.; zhu, f.; liu, b.; q.; wu., w.; wu.; q.; yu., nu.; z.; 26, c.; mechanical locking, r.; 16. F.; mechanical locking).

The number of α6β2 nachrs was significantly reduced in primate 1-methyl-4-phenyl-1,2,3, 6-tetrahydrochysenodine animal models and in human Parkinson's disease models (Champtiaux, n.; han, z.y.; bessis, a.; the therapy is carried out by the following methods, including the following examples, rossi, F.M., zoli, M., marubio, L., mcIntish, J.M., changeux, J.P., distribution and pharmacology of alpha-containing nicotinic acetylcholine receptors analyzed with mutant mice.the Journal of neuroscience,2002,22 (4), 1208-17.Quik, M., polonskaya, Y., kulak, J.M., mcIntish, J.M., vulnerabiity of 125I-alpha-conotoxin MII binding sites to nigrostriatal damage in Monkey. The application Journal of neuroscience,2001,21 (15), 5494-500.Quik, M., bordia, T., forno, L., mcIntish, J.M., loss of alpha-con oxygen MII-and A85380-sensitive nicotinic receptors in Parkinson's therapeutic 35 (3), 668-79.Gotti, C., borsi, M.A., the application, B.A., visual, A.P., visual, B.A., visual, A.P., visual, A.G., visual, A.C., B.P., visual, A., B.P., B.A., U.P., U.S., visual, A., U.S. visual, A., C.S. visual, A., C.A., B., C.A., A., B., C.A., A., B., A., B.A., C.A., B., C.A., A., B., C.A., C.A., C., C.A., C.A., C.A.A.A., C.A.A.A., C.A.A., C.A.A.A.A.A.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.P.....to.....J.......J.....J.J...J.J....J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J.J..

nAChRs containing the α6 subunit are largely divided into two subtype combinations (α6β2 or α6β4). α6β4 nachrs subtype expression profiles are more restricted and lack knowledge of their basic functions. Studies have shown that the α6β4 subtype is found in the retina (Marritt, a.m., cox, b.c., yasuda, R.P., mcIntosh, J.M., xiao, y., wolfe, b.b., and kelar, k.j. (2005) Nicotinic cholinergic receptors in the rat retina: simple and mixed heteromeric subtypes.mol Pharmacol 68, 1656-1668), adrenal chromaffin cells (Hernandez-Vivanco, a., hoc, a.j., scadden, m.l., carmona-Hidalgo, b., mcIntosh, j.m., and albilos, a. (2014) Monkey adrenal chromaffin cells express alpha beta4 x nicotinic acetylcholine receptors.plos One 9, e94142. Perz-Alvarez, a., hernandez-Vivanco, mcIntosh, j.m., and Albillos, a. (2012) Native alpha6beta4 x nicotinic receptors control exocytosis in human chromaffin cells of the adrenal gland.faseb J26, 346-354), hippocampus (Azam, l., maskos, u., changeux, j.p., dowell, c.d., christensen, s., de Biasi, m., and McIntosh, j.m. (2010) alpha-connoxin BuIA [ T5A; P6O ]: a novel ligand that discriminates between alpha ss4 and alpha6ss2 nicotinic acetylcholine receptors and blocks nicotine-stimulated norepinephrine release. FASEB J24, 5113-5123.) and dorsal root ganglia (Vincler, M, and Eisencach, J.C. (2004) Plasticity of spinal nicotinic acetylcholine receptors following spinal nerve ligation. Neurosci Res 48,139-145. Hoc, A.J., meyer, E.L., mcIntyre, M, and McIntosh, J.M. (2012) Nicotinic acetylcholine receptors in dorsal root ganglion neurons include the alpha.6 beta 4. Sub.type. FASEB J26,917-926. Smith, N.J., hoc, A.J., memon, T., bossi, S., smith, T.E., mcIntosh, J.M., olivera, B.M., and Teicher, all expressed in tissues such as r.w. (2013) Comparative functional expression of nAChR subtypes in rodent DRG neurons, front Cell Neurosci 7,225). α6β4 nachrs expressed in DRG have direct interactions and cross-inhibition with P2X2/3 receptors, and the resulting neuropathic pain symptoms are inversely related to CHRNA6 expression levels (none, a.j., taley, t.t., bobango, j., huidoboro Melo, c., hararah, f., gajewiak, j., christensen, s., harvey, p.j., craik, d.j., and mcintash, j.m. (8) Molecular determinants of alpha-conotoxin potency for inhibition of human and rat alpha beta4 nicotinic acetylcholine receptors, j Biol Chem 293,17838-17852. None, a.j., and McIntosh, j.m. (2018) Nicotinic acetylcholine receptors in neuropathic and inflammatory pin, fett 592,1045-1062. Limach, w., dougher, d.a., and 4 b.m. (263) for 4-specific mechanisms for functional interaction between alpha, and 2. P.m.p.m. shrink, 20167). This study shows that α6β4xnachrs are a new potential therapeutic target for neuropathic pain.

In view of the lack of physiological and pathological studies on α6β4 nAChRs, it is of great importance to find a potent selective α6β4 nAChRs blocker, especially one that can distinguish other structurally similar, overlapping subtypes of nAChRs, such as α3β4 nAChRs, etc.

Disclosure of Invention

The inventors have conducted intensive studies and creative efforts to find a novel alpha-conotoxin peptide (named TxIE) and further prepared a mutant of TxIE. The inventors have surprisingly found that TxIE or a mutant thereof is capable of specifically blocking acetylcholine receptors, in particular has a high selective and strong blocking activity against drug targets α6/α3β2β3 nachrs for addiction and parkinson's disease, and drug targets α6/α3β4 nachrs associated with pain, and has the potential to prepare drugs for smoking cessation, drug withdrawal or analgesia, or for the prevention and/or treatment of parkinson's disease, depression, dementia, schizophrenia. The following invention is thus provided:

one aspect of the invention relates to an isolated polypeptide which is a polypeptide having the amino acid sequence shown in SEQ ID NO. 1 or a mutant thereof;

wherein the amino acid sequence of the mutant is that glycine at the 1 st position in the sequence shown in SEQ ID NO. 1 is replaced by glutamic acid or aspartic acid; and/or, replacing methionine at position 15 in the sequence shown in SEQ ID NO. 1 with alanine, isoleucine or leucine;

Preferably, the amino acid sequence of the mutant is shown as any one of SEQ ID NOs 2-7.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 for glutamic acid.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 for aspartic acid.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of methionine at position 15 in the sequence shown in SEQ ID NO. 1 with alanine (SEQ ID NO. 2).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of methionine at position 15 in the sequence shown in SEQ ID NO. 1 for isoleucine (SEQ ID NO: 3).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of methionine at position 15 in the sequence shown in SEQ ID NO. 1 for leucine (SEQ ID NO. 4).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 for glutamic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced with alanine (SEQ ID NO. 5).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 for glutamic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced with isoleucine (SEQ ID NO. 6).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 for glutamic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced with leucine (SEQ ID NO. 7).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 for aspartic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced with alanine.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 for aspartic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced with isoleucine.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 for aspartic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced with leucine.

In some embodiments of the invention, the polypeptide has an amino acid sequence that is one glycine (position 17) or two glycine (positions 17 and 18) added to the C-terminus of any one of SEQ ID NOs 1-7.

In some embodiments of the invention, the amino acid sequence of the polypeptide is one glycine (position 17, SEQ ID NO: 9) or two glycine (positions 17 and 18, SEQ ID NO: 10) added to the C-terminal end of the sequence shown in SEQ ID NO: 1.

In some embodiments of the invention, the polypeptide has an amino acid sequence that is one glycine (position 17) or two glycine (positions 17 and 18) added to the C-terminus of any one of SEQ ID NOs 2-7.

In some embodiments of the invention, the polypeptide wherein:

the first cysteine at the N-terminus of the polypeptide forms a disulfide bond with the third cysteine and the second cysteine forms a disulfide bond with the fourth cysteine; or alternatively

The first cysteine at the N-terminus of the polypeptide forms a disulfide bond with the fourth cysteine, and the second cysteine forms a disulfide bond with the third cysteine; or alternatively

The first cysteine at the N-terminus of the polypeptide forms a disulfide bond with the second cysteine, and the third cysteine forms a disulfide bond with the fourth cysteine;

preferably, the carboxy terminus of the polypeptide is amidated.

In the invention, the following components are added:

the amino acid sequence is shown in SEQ ID NO:1 is a mature Peptide, also known as alpha-connoxin TxIE or Peptide 1;

TxIE is conotoxin peptide; in particular, it is an alpha-conotoxin peptide.

The amino acid sequence is shown as SEQ ID NOs:2-7 are also referred to as peptides 2-7, or are in turn referred to as [ M15A ] TxIE, [ M15I ] TxIE, [ M15L ] TxIE, [ G1E, M15A ] TxIE, [ G1E, M15I ] TxIE, [ G1E, M15L ] TxIE, respectively;

the amino acid sequence is shown in SEQ ID NO:8 is a precursor peptide, also known as alpha-conotoxin TxIE precursor or TxIE procursor.

Another aspect of the invention relates to a method for the preparation of a polypeptide according to any one of the invention, comprising the steps of:

1) On an ABI Prism 433a polypeptide synthesizer or other polypeptide synthesizers, or synthesizing linear polypeptide by a manual method, wherein the side chain protecting groups of Fmoc amino acid are Pmc (Arg), trt (Cys), but (Thr, ser, tyr), OBut (Asp) and Boc (Lys); the cysteine uses Trt or Acm protecting group to form disulfide bond between corresponding cysteines;

2) Cleaving the linear polypeptide obtained in step 1) from the resin, precipitating with glacial ethyl ether, washing to recover crude linear polypeptide, and purifying with preparative reverse HPLC C18 column (Vydac);

3) And 2) performing two-step oxidative folding on the product obtained in the step 2).

Another aspect of the invention relates to an isolated fusion protein comprising at least one polypeptide according to any one of the invention.

A further aspect of the invention relates to an isolated polynucleotide encoding a polypeptide according to any one of the invention.

Yet another aspect of the invention relates to a nucleic acid construct comprising a polynucleotide of the invention; preferably, the nucleic acid construct is a recombinant vector; preferably, the nucleic acid construct is a recombinant expression vector.

A further aspect of the invention relates to a transformed cell comprising a polynucleotide of the invention, or a nucleic acid construct of the invention.

A further aspect of the invention relates to a pharmaceutical composition comprising at least one polypeptide according to any one of the invention; optionally, it further comprises one or more pharmaceutically acceptable excipients.

The pharmaceutical composition can be used for researching, diagnosing, relieving or treating diseases or symptoms related to addiction, neuralgia, cancers, mental retardation, pain, parkinsonism, psychosis, depression, myasthenia gravis and the like. In one embodiment, a pharmaceutical composition comprising a therapeutically effective amount of a polypeptide of the invention is formulated and administered in a pharmaceutically acceptable manner, taking into account the clinical condition of the individual patient, the site of delivery, the method of administration, the schedule of administration and other factors known to the physician. An "effective amount" for purposes herein is therefore determined by these considerations.

Pharmaceutical compositions containing a therapeutically effective amount of the polypeptide of the invention are administered parenterally, orally, intracisternally, intrathecally, and the like. "pharmaceutically acceptable excipients" refers to non-toxic solid, semi-solid or liquid fillers, diluents, capsule materials or any type of formulation aid. The term "parenteral" as used herein means modes of administration including intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous, intrathecal and intra-articular injection and infusion. The polypeptides of the invention may also be administered appropriately by a slow release system.

A further aspect of the invention relates to the use of a polypeptide according to any of the invention for the preparation of a medicament for blocking the α6-acetylcholine receptor; preferably, the α6-acetylcholine receptor is an α6/α3β2β3 acetylcholine receptor or an α6/α3β4 acetylcholine receptor.

In a further aspect, the invention relates to the use of a polypeptide according to any one of the invention for the manufacture of a medicament for the treatment and/or prophylaxis of neurological disorders, or for the manufacture of a medicament for the treatment of analgesia, smoking cessation or drug addiction;

preferably, the neurological disease is at least one of addiction, neuralgia, parkinson's disease, dementia, schizophrenia and depression;

Preferably, the addiction is caused by at least one of the following factors: various psychoactive substances such as nicotine, opiates, heroin, methamphetamine (methamphetamine), morphine, marijuana, cocaine or alcohol;

preferably, the neuralgia is selected from at least one of the following: sciatica, trigeminal neuralgia, lymphodynia, multi-point motor neuralgia, acute severe spontaneous neuralgia, compression neuralgia, and compound neuralgia;

preferably, the neuralgia is caused by at least one of the following factors: cancer, cancer chemotherapy, alcoholism, diabetes, sclerosis, shingles, mechanical injury, surgical injury, aids, head nerve paralysis, drug intoxication, industrial pollution intoxication, myeloma, chronic congenital sensory neuropathy, vasculitis, ischemia, uremia, childhood biliary liver disease, chronic respiratory disorders, multiple organ failure, sepsis/sepsis, hepatitis, porphyria, vitamin deficiency, chronic liver disease, primary biliary cirrhosis, hyperlipidemia, leprosy, lyme arthritis, sensory fasciitis, or allergy.

Research shows that the alpha 6/alpha 3 beta 2 beta 3 nAChR is a drug action target for treating neuropsychiatric diseases, such as addiction of nicotine, morphine, cocaine and the like, parkinson's disease, dementia, schizophrenia, depression and the like; α6β4 nachrs are a new potential therapeutic target for neuropathic pain (see literature in the background). Therefore, the novel alpha-conotoxin TxIE and the mutant thereof have extremely high application value in the aspects of mechanism research, diagnosis and treatment of the diseases.

The dosage to be administered will depend on a number of factors, such as the severity of the condition being treated, the sex, age, weight and individual response of the patient or animal, and the condition and past history of the patient to be treated. It is common practice in the art to gradually increase the dosage from a level below that required to obtain the desired therapeutic effect until the desired effect is obtained.

A further aspect of the invention relates to a method of blocking the α6 acetylcholine receptor or modulating the α6 acetylcholine level in vivo or in vitro comprising the step of administering to a subject or to a cell an effective amount of a polypeptide of any of the invention; preferably, the α6-acetylcholine receptor is an α6/α3β2β3 acetylcholine receptor or an α6/α3β4 acetylcholine receptor.

In the invention, the following components are added:

the term "addiction" means that the psychoactive substance is in a periodically or chronically toxic state in repeated use. The psychoactive substances include nicotine, opium, heroin, methamphetamine (ice toxin), morphine, hemp, cocaine, and other narcotics and psychotropic drugs regulated by national regulations capable of addiction. Addiction is associated with the massive production of Dopamine (Dopamine) in the brain. The method is characterized in that the preferential substances are irrevocably applied, the self-made or difficult to correct use behaviors are difficult to prepare, and means can be omitted for obtaining the psychoactive substances to achieve the purposes of good feeling or avoiding withdrawal pains. Typically, tolerance is increased and withdrawal symptoms often occur after substance use is discontinued. The life of the addict may be completely dominated by substance use, thus severely affecting and even discarding other important activities and all responsibilities. Thus, the use of substances is both personal and social damaging. When used for alcohol use, is equivalent to the concept of chronic alcoholism. The term addiction also covers both physical and psychological aspects. Psychological addiction emphasizes impaired experience of self-control of alcohol consumption and medication, while physical addiction refers to tolerance and withdrawal symptoms.

The term "nucleic acid construct", defined herein as a single-stranded or double-stranded nucleic acid molecule, preferably refers to an artificially constructed nucleic acid molecule. Optionally, the nucleic acid construct further comprises 1 or more regulatory sequences operably linked.

In the present invention, the term "operably linked" refers to a functional spatial arrangement of two or more nucleotide regions or nucleic acid sequences. The "operative linkage" may be achieved by means of gene recombination.

In the present invention, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide that inhibits a protein can be inserted. For example, the carrier comprises: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosome (YAC), bacterial Artificial Chromosome (BAC) or P1-derived artificial chromosome (PAC); phages such as lambda phage or M13 phage, animal viruses, etc. Animal virus species used as vectors are retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex viruses), poxviruses, baculoviruses, papillomaviruses, papilloma-virus-papilloma-vacuolated viruses (e.g., SV 40). One vector may contain a variety of elements that control expression.

In the present invention, the term "host cell" refers to a cell into which a vector is introduced, and includes many cell types such as prokaryotic cells such as E.coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 drosophila cells or Sf9, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, heLa cells, BHK cells, HEK 293 cells or human cells.

The term "effective amount" refers to the amount that achieves treatment, prevention, alleviation and/or relief of a disease or condition of the present invention in a subject.

The term "disease and/or disorder" refers to a physical state of the subject that is associated with the disease and/or disorder of the present invention.

The term "subject" may refer to a patient or other animal, particularly a mammal, such as a human, dog, monkey, cow, horse, etc., receiving a pharmaceutical composition of the invention to treat, prevent, ameliorate and/or alleviate a disease or disorder described herein.

In the present invention, if not specified, the concentration unit/. Mu.M represents/. Mu.mol/L, mM represents mmol/L, and nM represents nmol/L.

In the present invention, when the amount of drug to be added to cells is mentioned, it is generally referred to as the final concentration of the drug after the drug is added unless otherwise specified.

The term "amino acid" or a specific amino acid name in the present invention refers to an amino acid of L-form unless otherwise specified.

Advantageous effects of the invention

The conotoxin peptide can play a role by combining with alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta 4 acetylcholinergic receptors (nAChR), and has the activities of abstinence from addiction and analgesia. Can be used for researching, diagnosing and treating nervous system diseases such as addiction, neuralgia, parkinsonism, dementia, schizophrenia, depression and the like, and can be used as a useful molecular probe for research and the like. Different α -CTXs have different affinities for vertebrate receptors, sometimes by several orders of magnitude. This interplanting allows α -CTX to be used as a useful probe for studying the phylogenetic events of vertebrate nachrs and as a molecular probe to determine different subtypes of nachrs. They are drug candidates for new drug development, lead drugs and therapeutic drugs.

Drawings

Fig. 1: the sequence of alpha-conotoxin TxIE (polypeptide 1, peptide 1) and its mutant (polypeptide 2-7, peptide 2-7) and its disulfide bond linkage Cys (I-III, II-IV). Each substituted amino acid is underlined. Cysteine is shown in italics. # represents C-terminal amidation.

Fig. 2A: alpha-conotoxin TxIE propeptide gene sequence, and coded propeptide and post-translational modification generated mature peptide thereof. The arrow indicates the processing site of the post-translational modification. Inferred proteolytic processing site 1 (processing site 1) is behind the basic amino acid lysine (K); the C-terminal amidation site may be at the position of the two glycine residues indicated by the arrow, i.e., processing site 2. The glycine residue immediately adjacent to the cysteine (Cys) at the C-terminus of the mature peptide is often the processing site for amidation post-translational modification, and the mature peptide resulting from amidation from processing site 2 is designated TxIE and has the sequence: GCCSNPPCIAKNPHMC # (# denotes C-terminal amide. The propeptide region is shown in italics, the mature peptide is shown underlined, and the cysteine (C) is shown in bold, and the stop codon is shown.

FIG. 2B, α -conotoxin TxIE and disulfide bond linkage pattern Cys (I-III, II-IV), # represents C-terminal amidation.

Fig. 3A-3B: a high pressure liquid chromatogram of TxIE and an ESI-MS mass chromatogram, respectively.

Fig. 3C-3D: the high-pressure liquid chromatogram and the ESI-MS mass chromatogram of [ M15A ] TxIE (polypeptide 2), respectively.

Fig. 3E-3F: the high-pressure liquid chromatogram of [ M15I ] TxIE (polypeptide 3) and the ESI-MS mass chromatogram, respectively.

Fig. 3G-3H: the high-pressure liquid chromatogram and the ESI-MS mass chromatogram of [ M15L ] TxIE (polypeptide 4), respectively.

Wherein in fig. 3A, 3C, 3E and 3G:

the HPLC analysis conditions were: c18 column (Vydac) with a linear gradient of elution ranging from 10 to 40% B60 (60% acetonitrile in water) over 0 to 40min and a monitoring wavelength of 214nm. Solvent B60 is an aqueous solution containing 90% Acetonitrile (ACN), 0.05% tfa (trifluoroacetic acid); solvent a is an aqueous solution of 0.05% tfa;

minutes in the HPLC chromatogram, representing the retention time of the chromatographic peak;

the abscissa is elution time in minutes (min); the ordinate is the ultraviolet absorption (UV) at a wavelength of 214nm ₂₁₄ )。

Fig. 4A-4B: the HPLC chromatogram and the mass spectrum of [ G1E, M15A ] TxIE (polypeptide 5), respectively.

Fig. 4C-4D: the HPLC chromatogram and the mass spectrum of [ G1E, M15I ] TxIE (polypeptide 6), respectively.

Fig. 4E-4F: the HPLC chromatogram and the mass spectrum of [ G1E, M15L ] TxIE (polypeptide 7), respectively.

Wherein the HPLC analysis conditions in fig. 4A, 4C and 4E are the same as those in fig. 3A, 3C, 3E and 3G.

Fig. 5: effects of alpha-CTx TxIE (polypeptide 1) (10. Mu.M) on currents of the individual subtypes of nAChRs expressed in Xenopus oocytes. All data represent mean±s.e.m, n=4-6. The abscissa is the current response percentage, and the calculation formula is: the current at a concentration of TxIE 10 μm for each nAChRs subtype divided by the percentage of the respective Control current (Control ND 96). Control here means that the current generated by Ach excitation is the Control current after the ND96 buffer solution with the same volume as the TxIE drug is added into the cell tank for incubation for 5 min.

Fig. 6A-6H: txIE (polypeptide 1) and [ M15I ] TxIE (polypeptide 3) block the current trace patterns of rat alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta 4 nAChRs, and are high-selectivity specific blockers of alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta 4 nAChRs. In the figure, "C" refers to the control (ND 96) current, followed by the concentration of the polypeptide. The arrow indicates the current trace formed by the first Ach pulse of the corresponding receptor subtype blocked by the polypeptide after 5 minutes of incubation. Wherein:

fig. 6A: current influence of 1 μM TxIE on α6/α3β4nAChR;

fig. 6B: current influence of 1 μM TxIE on α6/α3β2β3 nAChR;

fig. 6C: current influence of 10 μM TxIE on α3β4 nAChR;

fig. 6D: current influence of 10 μM TxIE on α3β2 nachrs;

fig. 6E: current influence of 1 μM [ M15I ] TxIE on α6/α3β4nAChR;

fig. 6F: current influence of 1 μM [ M15I ] TxIE on α6/α3β2β3nAChR;

fig. 6G: current influence of 10 μM [ M15I ] TxIE on α3β4 nAChR;

fig. 6H: current influence of 10 μM [ M15I ] TxIE on α3β2 nAChR.

Rats α6/α3β2β3 and α6/α3β4 nAChRs were expressed in xenopus oocytes with a clamp voltage of-70 mV at electrophysiological recordings, given Ach pulses of 1 second(s) every 1 minute according to the experimental procedure. TxIE is able to block current flow to α6/α3β4 (fig. 6A) and α6/α3β2β3 (fig. 6B) nachrs completely, but is free of blocking activity to α3β4 (fig. 6C) and α3β2 (fig. 6D) nachrs. The [ M15I ] TxIE was also able to block completely the currents of α6/α3β4 (FIG. 6E) and α6/α3β2β3 (FIG. 6F) nAChR, but was not blocking the activity of α3β4 (FIG. 6G) and α3β2 (FIG. 6H) nAChR.

Fig. 7A-7D: txIE (polypeptide 1) and mutants thereof (polypeptides 2-7) response to the concentrations of rat α6/α3β2β3 and α6/α3β4 nAChRs. The abscissa in the figure shows the logarithmic value (Log [ Peptide ] M) of the molar concentration (M) of the polypeptide used; the ordinate is the percent concentration Response (Response) and refers to the percentage ratio of acetylcholine receptor current to control current at the corresponding concentration of polypeptide. The individual values in the figure are the average of the currents taken from 4-6 xenopus oocytes, i.e. mean±s.e.m, n=4-6. Wherein:

fig. 7A: concentration-response profile of TxIE and its mutants (polypeptides 2-4) for rat α6/α3β2β3 nachrs;

fig. 7B: concentration-response profile of TxIE and its mutants (polypeptides 5-7) for rat α6/α3β2β3 nachrs;

fig. 7C: concentration-response profile of TxIE and its mutants (polypeptides 2-4) for rat α6/α3β4 nachrs;

fig. 7D: concentration-response profile of TxIE and its mutants (polypeptides 5-7) for rat α6/α3β4 nachrs.

Fig. 8: concentration dose response curves of TxIE (polypeptide 1) versus all nAChRs subtypes, with the abscissa in the figure being the Log (Peptide) M of the molar concentration (M) of TxIE polypeptide used; the ordinate is the percent concentration Response (Response) and refers to the percentage ratio of acetylcholine receptor current to control current at the corresponding concentration of polypeptide. The individual values in the figure are the average of the currents taken from 4-6 xenopus oocytes, i.e. mean±s.e.m, n=4-6.

Fig. 9A-9C: nuclear Magnetic Resonance (NMR) spatial structure of TxIE (polypeptide 1) and mutants thereof (polypeptides 2-4). Wherein:

fig. 9A: alpha H secondary chemical shift of polypeptides 1-4;

fig. 9B: the 20 lowest energy spatial structure overlapping diagrams of TxIE (polypeptide 1), wherein a blue curve represents an atomic framework of the polypeptide and a yellow curve represents disulfide bonds; wherein N-terminal represents the N-terminus and C-terminal represents the C-terminus.

Fig. 9C: txIE (polypeptide 1) is a three-dimensional structure color ribbon diagram showing 2 alpha helical structures and the way of connecting two pairs of disulfide bonds.

Fig. 10A-10H: model of interaction molecular docking of TxIE (polypeptide 1) with positive binding sites of the alpha/beta interface of α3β2, α3β4, α6β2 and α6β4 nAChRs. FIGS. 10A-10D show models of interactions of TxIE at positive binding sites of the alpha/beta interface, the color of the solvent-contactable surface being determined by the electrostatic potential generated by the receptor, from red (-5 kT/e) to white (0 kT/e) to blue (5 kT/e). FIGS. 10E-10H show enlarged views of the region of interaction between Lys-11 of TxIE and the receptor, where the alpha subunit is blue and the beta subunit is green. The molecular docking model shown in this figure is a centroid frame generated by 100ns molecular dynamics simulation for each system. In all molecular docking models, conotoxin TxIE is represented by orange cartoon and bar figures. In the upper part of the figure, the white dotted outline represents the region of interaction between the Lys-11 head charged group of TxIE and the receptor. The N-terminus of the TxIE is indicated by a white "N". The electrostatic potential was calculated using APBS 1.4 with default parameters at a salt concentration of 150 mM.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The specific techniques or conditions are not noted in the examples, and are carried out according to techniques or conditions described in the literature in the art (for example, refer to J. Sam Brookfield et al, guidelines for molecular cloning experiments, third edition, scientific Press, et al), corresponding references, or according to the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1: cloning and sequence analysis of alpha-conotoxin TxIE gene

1. Extraction of brocade taro spiral gene group DNA

Respectively taking living bodies of brocade conoids (C.textile Linnaeus) collected from coasts such as southwest island and cissamphire as materials, and storing at-80 ℃ for standby. The conotoxin glands were first dissected out and weighed. Then extracting genome DNA of the poison gland by using a marine animal genome DNA extraction kit (purchased from Beijing Tiangen Biochemical technology Co., ltd.) and referring to the specification of the kit for specific operation.

The total DNA of the extracted cono genome was dissolved in 100. Mu.L of TE, 5. Mu.L was subjected to 1.0% agarose gel electrophoresis, and the integrity and size of the obtained DNA were examined with lambda-EcoT 14I digest DNA Marker as a standard. OD260, OD280 value and OD260/OD280 ratio of the DNA solution were measured with a nucleic acid protein analyzer, and the concentration of DNA (. Mu.g.ml) was calculated ^-1 ) Purity and DNA yield (. Mu.g.g) ^-1 ). The extracted complete DNA is used for the next PCR amplification to clone the conotoxin gene.

Cloning, sequencing, and sequence analysis of PCR reactions and products thereof

Alpha-conotoxin specific primers are designed according to the sequence of an intron of an alpha-conotoxin precursor gene and the sequence of an untranslated region (3 '-UTR) at the 3' end of the alpha-conotoxin precursor gene, and each primer is an oligonucleotide fragment of 18 bases.

The upstream intron primer sequence was 5'-GTGGTTCTGGGTCCAGCA-3' (SEQ ID NO: 11);

the downstream 3' -UTR primer sequence is 5'-GTCGTGGTTCAGAGGGTC-3' (SEQ ID NO: 12).

The extracted genomic DNA stock solution is diluted and used as a template for PCR amplification. The PCR specific amplified product was recovered, and after ligation with T-easy vector (Promega), E.coli XL1 strain was transformed, and recombinants were selected using blue Bai Junla and ampicillin resistance, and the recombinant plasmid was purified by extraction for sequencing analysis.

The obtained PCR specific amplified product sequence is analyzed by DNAStar software to obtain the coding protein sequence and the 3' -untranslated region (UTR) sequence. The signal peptide, propeptide and mature peptide of the conotoxin precursor protein were predicted and analyzed using an on-line ProP 1.0Server (Duckert, P.; brunak, S.; blom, N.; prediction of proprotein convertase cleavage sis. Protein engineering, design & selection: PEDS 2004,17 (1), 107-12.).

By sequence analysis and comparison, a novel alpha-conotoxin (named TxIE) precursor gene (figure 2A) is obtained:

GTGGTTCTGGGTCCAGCATCTGATGGCAGGAAAGCTGCAGTGTCTGACCTGATCACTCTGACCATCAAGGGATGCTGTTCTAATCCTCCCTGTATCGCGAAGAATCCACACATGTGTGGTGGAAGACGCTGA(SEQ ID NO:13)

according to the characteristics of the precursor gene and the conotoxin, the TxIE conotoxin propeptide is deduced, and the amino acid sequence of the TxIE conotoxin propeptide is as follows:

VVLGPASDGRKAAVSDLITLTIKGCCSNPPCIAKNPHMCGGRR(SEQ ID NO：8)

mature peptide TxIE was further deduced from the pro-peptide sequence and its amino acid sequence was GCCSNPPCIAKNPHMC (SEQ ID NO: 1), for methods and principles of deduction please refer to Luo S, zhangsun D, zhang B, quan Y, wu Y.Novel alpha-conotoxins identified by gene sequencing from cone snails native to Hainan, and their sequence diversity J Pept Sci.2006,12 (11): 693-704. The deduction results are shown in detail in fig. 1 and fig. 2A-2B.

TxIE (polypeptide 1) is a novel alpha-conotoxin with amidated modification at the C-terminus. TxIE contains a CC-C-C cysteine pattern with a disulfide bond linkage of Cys (I-III, II-IV) (FIG. 1, FIG. 2B), i.e., two pairs of disulfide bonds are formed between the first and third cysteines, and between the second and fourth cysteines, respectively. TxIE is different from other known alpha-conotoxins.

Example 2: design of alpha-conotoxin TxIE mutant

Based on the sequence structure of TxIE, 6 mutants (polypeptides 2-7, shown in Table 1) shown in FIG. 1, the amino acid sequences of which are shown in SEQ ID NOs, were designed for point mutation of glycine (G) at position 1 and methionine (M) at position 15, respectively: 2-7. Further, the disulfide linkage of the 6 mutants was C-terminally amidated.

The DNA sequence of the precursor gene was deduced from the sequences of the polypeptides 2 to 7 as shown in Table 1.

TABLE 1 polypeptide sequences of TxIE and mutants thereof

Name of the name	Sequence(s)
		TxIE	GCCSNPPCIAKNPHMC#
[M15A]TxIE	GCCSNPPCIAKNPHAC#
		[M15I]TxIE	GCCSNPPCIAKNPHIC#
[M15L]TxIE	GCCSNPPCIAKNPHLC#
		[G1E,M15A]TxIE	ECCSNPPCIAKNPHAC#
[G1E,M15I]TxIE	ECCSNPPCIAKNPHIC#
		[G1E,M15L]TxIE	ECCSNPPCIAKNPHLC#

Note that: the mutated amino acid positions are underlined and the cysteines are italicized.

Example 3: artificial synthesis of alpha-conotoxin TxIE and mutant thereof

Based on the amino acid sequence of the alpha-conotoxin mature peptide TxIE and its mutants (Table 1), the linear peptide was synthesized artificially by Fmoc method (FIG. 1). The specific method comprises the following steps:

the resin peptide is synthesized artificially by Fmoc chemical method, and can be synthesized by polypeptide synthesizer or manual synthesis method. The remaining amino acids except cysteine were protected with standard side chain protecting groups. the-SH of 1 st and 3 rd cysteines (Cys) of TxIE and its mutants are protected with Trt (S-trityl), and the-SH of 2 nd and 4 th cysteines are protected in pairs with Acm (S-acetamidomethyl).

The specific synthesis steps are as follows: 7 linear peptides of FIG. 1 were synthesized on an ABI Prism 433a polypeptide synthesizer using Fmoc and FastMoc methods in solid phase synthesis. The side chain protecting groups of Fmoc amino acid are Pmc (Arg), trt (Cys), but (Thr, ser, tyr), OBut (Asp) and Boc (Lys). The synthesis steps were performed using Fmoc HOBT DCC method, rink amidated resin and Fmoc amino acid, with reference to the instrument synthesis manual. In order to complete the reaction, the deprotection time and the coupling time of piperidine are respectively prolonged properly, and double coupling is adopted for amino acid which is difficult to connect, so as to obtain resin peptide. The linear peptide was cleaved from the resin with reagent K (trifluoroacetic acid/water/ethane dithiol/phenyl/thioanisole; 90:5:2.5:7.5, v/v/v/v/v) and crude linear peptide was recovered by precipitation with glacial ethyl ether and washing, purified with a preparative reverse HPLC C18 column (Vydac) eluting with a linear gradient of 10-40% B90 over 0-40min with a monitored wavelength of 214nm. Solvent B90 is an aqueous solution containing 90% acetonitrile (CAN, acetonitrile), 0.05% tfa (trifluoroacetic acid); solvent a was 0.05% tfa in water.

The purified linear peptide was subjected to purity detection using an analytical HPLC C18 column (Vydac) under the same elution conditions as above at a flow rate of 1mL/min. The purity of the product reaches more than 95 percent, and the product is used for oxidative folding.

Reference (Dowell, c.; olivera, b.m.; garrett, j.e.; staheli, s.t.; watkins, m.; kuryatov, a.; yoshikami, d.; lindstrom, j.m.; mcIntosh, j.m.; alpha-conotoxin PIA is selective for Alpha, subset-containing nicotinic acetylcholine receptors. The Journal of neuroscience 2003,23 (24), 8445-52.) the two-step oxidative folding reaction of linear peptides of TxIE and mutants thereof was performed as follows:

first a first pair of disulfide bonds is formed between the two cysteines of the Trt protecting group by potassium ferricyanide oxidation (20mM potassium ferricyanide,0.1M Tris,pH 7.5, 45 min). The monocyclic peptide was purified by reverse phase HPLC C18 column (Vydac) and subjected to iodination (10 mM iodine in H) ₂ Acm on the other 2 cysteines was removed and a second pair of disulfide bonds was formed between the 2 cysteines, O trifluoroacetic acid, acetonitrile (78:2:20by volume,10min). The bicyclic peptide was further purified by reverse phase HPLC C18 column (Vydac) to obtain the alpha-conotoxin with disulfide bond formation oriented between the corresponding cysteines in the order from N-terminus to C-terminus, and identified by mass spectrometry (electrophorey-mass spectroscopy, ESI-MS).

HPLC chromatograms and ESI-MS mass chromatograms of the TxIE and its mutants after oxidative folding are shown in FIGS. 3A-3H and FIGS. 4A-4F. The purity of the synthesized TxIE and the mutant thereof is more than 95 percent. The measured molecular weight of TxIE and its mutant is consistent with the theoretical molecular weight (Table 2), and the synthesized 7 polypeptides have correct molecular weight and high purity. The concentration of the polypeptide was determined colorimetrically at a wavelength of 280nm and the concentration and mass of the polypeptide were calculated according to the Beer-Lambert equation (equation). These quantified folded polypeptides were used for subsequent activity testing.

TABLE 2 molecular weight of alpha-CTx TxIE and mutants thereof

Polypeptides	Theoretical molecular weight (Da, average)	Measured molecular weight (Da)
			TxIE	1670.00	1669.80
[M15A]TxIE	1609.89	1609.68
			[M15I]TxIE	1651.97	1651.98
[M15L]TxIE	1651.97	1651.89
			[G1E,M15A]TxIE	1681.95	1681.80
[G1E,M15I]TxIE	1724.03	1724.01
			[G1E,M15L]TxIE	1724.03	1723.92

Example 4: alpha-conotoxin TxIE pairs of alpha 6/alpha 3 beta 2 beta 3, alpha 6/alpha 3 beta 4nAChRs, and all other nAChRs subunits Activity studies

The concentration of cRNA of various rat neurogenic nAChRs subtypes (α3β2, α6/α3β2β3, α6/α3β4, α9α10, α4β2, α4β4, α3β4, α2β2, α2β4, α7), and mouse muscle-type ChnARs (α1β1δε) was measured using OD values at UV 260nm, as described in the literature (Azam L, yoshikami D, mcIntosh JM. Amino acid residues that confer high selectivity of the alpha nicotinic acetylcholine receptor subunit to alpha-connoxin MII [ S4A, E11A, L15A ]. J Biol chem.2008;283 (17): 11625-32 ]) and in vitro transcription kit (mMessage mMachine in vitro transcription kit (Ambion, austin, TX)). Xenopus laevis (Xenopus laevis) oocytes (frog eggs) were dissected and cRNA was injected into the frog eggs at an injection rate of 5ng cRNA per subunit. Muscle nachrs were injected with 0.5-2.5ng DNA per subunit. Frog eggs were cultured in ND-96. cRNA was injected 1-2 days after frog egg collection and voltage clamp recordings for nAChRs 1-4 days after injection.

1 frog egg injected with cRNA was placed in 30uL Sylgard recording tank (diameter 4 mm. Times.depth 2 mm), and ND96 perfusion solution (96.0mM NaCl,2.0mM KCl,1.8mM CaCl) containing 0.1mg/ml BSA (bovine serum albumin) was gravity-perfused ₂ ,1.0mM MgCl ₂ 5mM HEPES, pH 7.1-7.5) or ND96 containing 1mM atropine (ND 96A), flow rate was 1ml/min. All conotoxin solutions also contained 0.1mg/ml BSA to reduce non-specific adsorption of toxins, were freely switchable between infused toxins or acetylcholine (ACh) using a switching valve (SmartValve, cavro Scientific Instruments, sunnyvale, calif.), and were freely switchable between infused ND96 and ACh, etc., using a series of three-way solenoid valves (model 161TO31,Neptune Research,Northboro,MA). The Ach gated current is set at a "slow" clamp by a dual electrode voltage clamp amplifier (model OC-725B,Warner Instrument Corp, hamden, CT), and clamp gain was recorded online at the maximum (x 2000) position. Glass electrodes were drawn with a 1mm outer diameter by 0.75 inner diameter glass capillary (fiber-filled borosilicate capillaries, WPI inc., sarasota, FL) and filled with 3M KCl as voltage and current electrodes. The membrane voltage was clamped at-70 mV the whole system was computer controlled and data recorded. ACh pulse is ACh automatically perfused for 1s every 5 min. ACh concentrations were 10. Mu.M in the eggs expressing muscle-type nAChRs and neuro-type α9α10nAChRs, respectively; α7 expressing neuronal nAChRs was 200 μm and the other subtypes were 100 μm. At least 4 eggs were recorded for current responses of a subtype expressed to different toxin concentrations, as well as current traces.

The current data tested were statistically analyzed using GraphPad Prism software (San Diego, CA), a dose response curve was drawn, and the semi-blocking concentration IC of conotoxin was calculated ₅₀ And the like, various parameters related to blocking of nAChRs by polypeptides.

The results indicate that TxIE (prepared in example 3) has the strongest blocking activity against rat α6/α3β2β3 nAChR, its half blocking dose (IC ₅₀ ) Only 2.4nM, followed by α6/α3β4 nAChR, half-blocking dose (IC ₅₀ ) 91nM. TxIE has 39-fold stronger blocking activity against α6/α3α02α33 than against α16/α23α64 nAChR subtype (FIGS. 5, 6A-6H, 7A-7D, 8, table 3-4). TxIE had no blocking effect on all other subtypes of receptors at high concentrations of 10. Mu.M, and their current was more than 90% in response compared to the control current (FIGS. 5, 6C, 6D, table 3-4). The 1 μm TxIE almost completely blocked the currents generated by Ach-gated rat α46/α53α72β3 (fig. 6B) and α86/α93β04 (fig. 6A) nAChRs opening. After the TxIE blocks the alpha 6/alpha 3 beta 2 beta 3 receptor, the elution rate is high, the control current can be eluted back within 4 minutes (figure 6B), while after the TxIE blocks the alpha 6/alpha 3 beta 4 receptor, the elution rate is low, and the control current can be eluted back within 19 minutes (figure 6A). The blocking of both subtypes by TxIE was reversible, with very different elution rates (fig. 6A, 6B).

TxIE has strong blocking activity against α6 subunit (α6) containing nAChR subtype, i.e., α6/α3β2β3 (tables 3-4) and α6/α3β4, and high selectivity. 10 μM TxIE had no effect on both α3β4 and α3β2 nAChRs very close to α6 nAChRs (fig. 6A, 6B, 6C, 6D).

TABLE 3 alpha-CTx TxIE and mutants thereof

IC that acts on alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta 4 nAChRs ₅₀ Value summary table

Note that: a represents Hill constant; b represents an AChR IC acting on alpha 6/alpha 3 beta 4 and alpha 6/alpha 3 beta 2 beta 3 nAChR ₅₀ Ratio of (2)

TABLE 4 TxIE and [ M15I ] TxIE

IC acting on different nicotinic acetylcholine receptor subtypes respectively ₅₀ Value of

^a Representing an inhibition of less than 50% at a concentration of 10 μm.

Example 5: activity study of alpha-conotoxin TxIE mutant on alpha 6/alpha 3 beta 2 beta 3, alpha 6/alpha 3 beta 4 nAChRs

The activity of 6 mutants of TxIE (SEQ ID NOs:2-7, FIG. 1) on each subtype of nAChRs was determined according to the method of example 4 and the results are shown in FIGS. 6A-6H and 7A-7D, table 3. The 6 mutants of TxIE can almost completely block the currents to the α6/α3β2β3 and α6/α3β4 nAChRs at high concentrations of 10. Mu.M. The concentration-response curves of 6 mutants of TxIE for α6/α3β2β3 and α6/α3β4 nAChRs are shown in FIGS. 7A-7D.

Table 3 and FIGS. 7A-7D summarize TxIE IC of 6 mutants of alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta 4nAChRs ₅₀ And activity changes. It can be seen that the TxIE mutants are dose dependent on the blocking activity of α6/α3β2β3 and α6/α3β4 nAChRs. 3 mutants with methionine at position 15 substituted [ M15A ]]TxIE(SEQ ID NO：2),[M15I]TxIE (SEQ ID NO: 3) and [ M15L ]]TxIE (SEQ ID NO: 4) showed NO significant change in the inhibitory activity to α6/α3β2β3nAChR, while slightly enhanced the inhibitory activity to α6/α3β4nAChR. Wherein [ M15I]TxIE (SEQ ID NO: 3) has the strongest blocking effect on alpha 6/alpha 3 beta 2 beta 3nAChR, IC thereof ₅₀ Has a value of 1 (0.7-1.4) nM and also has an approximately 3-fold enhancement of the activity of α6/α3β4nAChR compared to the bulk TxIE, IC ₅₀ The value was 31 (28-34) nM. In contrast, the activity of the 3 mutants substituted at position 1 on α6/α3β2β3 and α6/α3β4nAChRs was greatly reduced compared to the wild-type TxIE, and their concentration-response curves shifted to the right overall (fig. 7B and 7D). [ M15I ]]The TxIE has 31-fold greater blocking activity against α6/α3β2β3 than the α6/α3β4nAChR subtype. TxIE (SEQ ID NO: 1) and [ M15I ]]TxIE (SEQ ID NO: 3) showed NO significant blocking effect on other receptor subtypes, such as mα1β1δε, rβ13β02, rβ33β24, rβ52β42, rβ62β4, rβ7β2, rα4β4, rα7 and rα9α10nAChRs, at 10. Mu.M concentration (Table 4 and FIG. 8). Thus, mutant [ M15I ] ]TxIE (SEQ ID NO: 3) has significantly enhanced activity compared with wild type TxIE, and is a novel polypeptide capable of efficiently and specifically acting on alpha 6 nAChRs.

Example 6: nuclear Magnetic Resonance (NMR) three-dimensional structural analysis of alpha-conotoxin TxIE and mutants thereof

The structure of TxIE (SEQ ID NO: 1) and its 3 mutants (SEQ ID NO: 2-4) with 15 th position substituted were analyzed by nuclear magnetic resonance. Specific methods refer to Shen, y; bax, a.protein backbone and sidechain torsion angles predicted from NMR chemical shifts using artificial neural networks.j. Biomol. Nmr.2013,56,227-241, and Brunger, a.t.; adams, p.d.; clore, G.M.; deLano, w.l.; gros, p.; grose-Kunstleve, R.W.; jiang, j.s.; kuszewski, j.; nilges, m.; pannu, n.s.; read, r.j.; rice, l.m.; simonson, t.; warren, G.L. crystal & NMR system A new software suite for macromolecular structure determination, acta crystal, sect.D. biol. Crystal, 1998,54,905-921.

In aqueous solution, all 4 peptides had good folding conformation, although the overall structure was observed to have a small number of isomers (less than 20%) due to the presence of one or more cis-trans isomerizations in the three proline residues. The backbone protons of each major isomer, except for the N-terminal amide protons, achieve complete resonance. The changes in the αh secondary chemical shift of TxIE and its 3 mutants are very similar. This indicates that the change in the host structure due to methionine substitution is negligible. The sequence of the short alpha-helical structure portion located in the middle is represented by a negative histogram of chemical shift of the secondary structure αH of each amino acid residue, which is less than-0.1 ppm (FIG. 9A).

The three-dimensional solution structure of TxIE was calculated from 111 distance constraint values from NOESY spectra at temperature 288K. From the 17 dihedral structures generated by the chemical shift of TALOS-N and the temperature coefficient, 20 spatial structures with the lowest energy were calculated (FIG. 9B). The three-dimensional structure of TxIE (SEQ ID NO: 1) is shown in FIG. 9C, where there are 2 alpha-helical secondary structures, and two distinct pairs of disulfide bonds and their manner of attachment. Table 5 shows the data on NMR structure and its energy calculation, with RMSD ofBased on analysis of the inter-hαi-1-hδpi proton NOE effect and carbon 13 chemical shift for three prolines and their previous amino acid residues, the major configuration of all three prolines was in the trans-conformation. As can be seen from FIGS. 9A and 9C, a longer alpha-helical structure is formed between Pro-6 and Lys-11, and contains two helical loops; the N-terminus of TxIE, from Cys-2 to Ser-4, also has a shorter alpha-helix of the "3, 10-type".

TABLE 5 data analysis of TxIE (SEQ ID NO: 1) Structure

^a All statistics are given as mean±SD.

^b According to MolProbity

Example 7: phases of alpha-conotoxin TxIE (SEQ ID NO: 1) with alpha 3 beta 2, alpha 3 beta 4, alpha 6 beta 2 and alpha 6 beta 4 nAChRs Interaction molecule docking analysis

Reference Sali, a; bluntell, T.L. complex protein modelling by satisfaction of spatial retrains.J. mol. Biol.1993,234,779-815. Dutertre, S.; ulens, C.; buttner, R.; fisher, a; van Elk, r.; kendel, y; hoping, g.; alewood, p.f.; schroeder, c.; nickel, a.; smit, a.b.; sixma, t.k.; lewis, R.J. AChBP-targeted alpha-conotoxin correlates distinct binding orientations with nAChR subtype selection I.EMBO J.2007,26,3858-3867. An interaction molecular docking model of TxIE with the alpha/beta interface binding sites of the 4 nAChRs subtypes (. Alpha.3β2,. Beta.03β4,. Beta.16β2 and. Alpha.6β4) was constructed by homology modeling and refined using 100ns molecular dynamics modeling. RMSD for evaluating stability of molecular docking analog structures, RMSD size fluctuations of TxIE in combination with α3 and α6 nachrs were maintained within 20-60ns In the range, the molpromit score of the four molecular docking model is between 1.44 and 1.68 (molpromit score<2.0 indicates a high quality structure).

The interactions of TxIE with the 4 subtypes described above all occur in the alpha/beta interface binding site pocket, with a similar pattern of 4 ligand-receptor binding to each other (fig. 10A-10H). These molecular docking models are similar to the complex crystal structure produced by the mutual binding of alpha-conotoxin and AChBP. The entire orthosteric binding site of the constructed molecular docking model is negatively charged, but a potential difference is seen outside the binding site. TxIE blocks α6β2 and α6β4 nAChRs, but has no significant activity on α3β2 and α3β4 nAChRs. This suggests that the α3 subunit-containing receptors, including α3β2 and α3β4 nAChRs, have binding sites that are incompatible with TxIE due to steric exclusion or strong electrostatic repulsion. In contrast, amino acids 154 of the two subunits, α3 and α6, are different and are occupied by the Lys (K) residue, which is the α3 subunit positive charge, and the Glu (E) residue, which is the α6 subunit negative charge, respectively. The different charge at position 154 helps to change the electrostatic potential outside the binding site and also affects the electrostatic potential near the charged side chain groups of TxIE and Lys (K) -11. Thus, electrostatic repulsion between Lys-11 of TxIE and amino acid 154 of the receptor alpha 3 subunit is critical for distinguishing between the alpha 3-containing and alpha 6-containing nAChRs subtypes. The molecular docking model can also explain the reason why the activity of the first amino acid Gly (G1) in TxIE is reduced after being substituted by glutamic acid Glu. G1 is the N-terminal residue of TxIE, located in a negatively charged environment in the molecular model (FIGS. 10A-10H). Thus, the reduced activity of mutant Peptide 5-7 (SEQ ID NOs: 5-7) observed by the present inventors is presumably due to the negative charges being mutually exclusive after G1 is replaced with Glu of negative charge.

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate. Numerous modifications and substitutions of details are possible in light of all the teachings disclosed, and such modifications are contemplated as falling within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

SEQUENCE LISTING

<110> university of Guangxi

<120> alpha-conotoxin peptide TxIE, pharmaceutical composition and use thereof

<130> IDC200092

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> TxIE

<400> 1

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Met Cys

1 5 10 15

<210> 2

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [M15A]TxIE

<400> 2

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Ala Cys

1 5 10 15

<210> 3

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [M15I]TxIE

<400> 3

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Ile Cys

1 5 10 15

<210> 4

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [M15L]TxIE

<400> 4

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Leu Cys

1 5 10 15

<210> 5

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [G1E,M15A]TxIE

<400> 5

Glu Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Ala Cys

1 5 10 15

<210> 6

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [G1E,M15I]TxIE

<400> 6

Glu Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Ile Cys

1 5 10 15

<210> 7

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [G1E,M15L]TxIE

<400> 7

Glu Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Leu Cys

1 5 10 15

<210> 8

<211> 43

<212> PRT

<213> Artificial Sequence

<220>

<223> TxIE conotoxin propeptide

<400> 8

Val Val Leu Gly Pro Ala Ser Asp Gly Arg Lys Ala Ala Val Ser Asp

1 5 10 15

Leu Ile Thr Leu Thr Ile Lys Gly Cys Cys Ser Asn Pro Pro Cys Ile

20 25 30

Ala Lys Asn Pro His Met Cys Gly Gly Arg Arg

35 40

<210> 9

<211> 17

<212> PRT

<213> Artificial Sequence

<220>

<223> mutant

<400> 9

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Met Cys

1 5 10 15

Gly

<210> 10

<211> 18

<212> PRT

<213> Artificial Sequence

<220>

<223> mutant

<400> 10

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Met Cys

1 5 10 15

Gly Gly

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 11

gtggttctgg gtccagca 18

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 12

gtcgtggttc agagggtc 18

<210> 13

<211> 132

<212> DNA

<213> Artificial Sequence

<220>

<223> TxIE precursor Gene

<400> 13

gtggttctgg gtccagcatc tgatggcagg aaagctgcag tgtctgacct gatcactctg 60

accatcaagg gatgctgttc taatcctccc tgtatcgcga agaatccaca catgtgtggt 120

ggaagacgct ga 132

Claims (16)

1. An isolated polypeptide having an amino acid sequence as set forth in any one of SEQ ID NO 1 through SEQ ID NO 7;

wherein:

the first cysteine at the N-terminus of the isolated polypeptide forms a disulfide bond with the third cysteine and the second cysteine forms a disulfide bond with the fourth cysteine; and is also provided with

The carboxy terminus of the isolated polypeptide is amidated.

2. An isolated fusion protein comprising at least one isolated polypeptide of claim 1.

3. An isolated polynucleotide encoding the isolated polypeptide of claim 1.

4. A nucleic acid construct comprising the isolated polynucleotide of claim 3.

5. The nucleic acid construct of claim 4, wherein the nucleic acid construct is a recombinant vector.

6. The nucleic acid construct of claim 4, wherein the nucleic acid construct is a recombinant expression vector.

7. A transformed cell comprising the isolated polynucleotide of claim 3, or the nucleic acid construct of any one of claims 4 to 6.

8. A pharmaceutical composition comprising at least one isolated polypeptide of claim 1.

9. The pharmaceutical composition of claim 8, further comprising one or more pharmaceutically acceptable excipients.

10. Use of the isolated polypeptide of claim 1 for the manufacture of a medicament for the treatment and/or prevention of neurological diseases;

wherein the neurological disorder is at least one of addiction, neuralgia, parkinson's disease, dementia, schizophrenia, and depression.

11. The use of claim 10, wherein the addiction is caused by at least one of the following factors: nicotine, opiates, heroin, methamphetamine, morphine, marijuana, cocaine or alcohol.

12. The use of claim 10, wherein the neuralgia is selected from at least one of the following: sciatica, trigeminal neuralgia, lymphodynia, multi-point motor neuralgia, acute severe spontaneous neuralgia, compression neuralgia, and compound neuralgia.

13. The use of claim 10, wherein neuralgia is caused by at least one of the following factors: cancer, cancer chemotherapy, alcoholism, diabetes, sclerosis, shingles, mechanical injury, surgical injury, aids, head nerve paralysis, drug intoxication, industrial pollution intoxication, myeloma, chronic congenital sensory neuropathy, vasculitis, ischemia, uremia, childhood biliary liver disease, chronic respiratory disorders, multiple organ failure, sepsis/sepsis, hepatitis, porphyria, vitamin deficiency, chronic liver disease, primary biliary cirrhosis, hyperlipidemia, leprosy, lyme arthritis, sensory fasciitis, or allergy.

14. Use of the isolated polypeptide of claim 1 for the manufacture of a medicament for analgesia, smoking cessation or drug addiction.

15. A method of blocking α6 acetylcholine receptors or modulating α6 acetylcholine levels in vitro comprising the step of administering to a cell an effective amount of the isolated polypeptide of claim 1.

16. The method of claim 15, wherein the α6-acetylcholine receptor is an α6/α3β2β3 acetylcholine receptor or an α6/α3β4 acetylcholine receptor.