CN113493502A

CN113493502A - Alpha-conotoxin peptide TxIE, and pharmaceutical composition and application thereof

Info

Publication number: CN113493502A
Application number: CN202010250411.1A
Authority: CN
Inventors: 罗素兰; 长孙东亭; 朱晓鹏; 吴勇
Original assignee: Guangxi University
Current assignee: Guangxi University
Priority date: 2020-04-01
Filing date: 2020-04-01
Publication date: 2021-10-12
Anticipated expiration: 2040-04-01
Also published as: CN113493502B

Abstract

The invention belongs to the fields of biology and medicine, and relates to a novel alpha-conotoxin peptide TxIE, a pharmaceutical composition thereof and application thereof. Specifically, the invention relates to an isolated polypeptide, which is a polypeptide with an amino acid sequence shown as SEQ ID NO. 1 or a mutant thereof; wherein the amino acid sequence of the mutant is that the 1 st glycine in the sequence shown by SEQ ID NO. 1 is replaced by glutamic acid or aspartic acid; and/or the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced by alanine, leucine or isoleucine. The polypeptide of the invention can specifically block acetylcholine receptors, particularly has high selectivity and strong blocking activity on drug target points alpha 6/alpha 3 beta 2 beta 3nAChR of addiction and Parkinson's disease and drug target points alpha 6/alpha 3 beta 4nAChR related to pain, and has the potential of preparing drugs for smoking cessation, drug rehabilitation or pain relief, or preparing drugs for preventing and/or treating Parkinson's disease, depression, dementia and schizophrenia.

Description

Alpha-conotoxin peptide TxIE, and pharmaceutical composition and application thereof

Technical Field

The invention belongs to the fields of biology and medicine, and relates to a novel alpha-conotoxin peptide TxIE, a pharmaceutical composition thereof and application thereof. The invention also relates to mutants of TxIE.

Background

Conotoxins can be classified into a plurality of pharmacological families such as alpha, omega, mu, delta and the like according to receptor targets. Each superfamily can be further classified into families such as alpha, alpha A, kappa A (A-superfamily), omega, delta, kappa, mu O (O-superfamily), mu, psi, KM (M-superfamily) and the like according to the type of receptor target. Among them, alpha-conotoxins are the most selective Nicotinic Acetylcholine receptor (nAChRs) subtype specific blockers (Wu RJ, Wang L, Xiang H. the Structural Features of alpha-Conotoxin specific Target Difference of animals of Nicotinic Acetylcholine receptors, Current Top Med chem.2015,16(2),156-169.Lebbe EK, Peigneur S, Wijesekara I, Tytgat J. Conotoxin targeting Nicotinic Acetylcholine receptors: an overview of Mar drugs 2014,12(5),2970 3004.) found at present.

Alpha-conotoxin is the first conotoxin discovered by people, generally has a small molecular weight, generally consists of 12-19 amino acid residues, and is rich in disulfide bonds. The alpha-conotoxins have various types, diverse activities and complex structural changes. Alpha-conotoxins can be classified by their highly conserved signal peptide sequence, pharmacological activity and cysteine pattern. The cysteine pattern of alpha-conotoxin is CC-C-C, wherein disulfide bonds are connected in a manner of C1-C3 and C2-C4, 2 loop rings are formed among disulfide bonds, the alpha-conotoxin can be divided into a plurality of subfamilies such as alpha 3/5, alpha 4/7, alpha 4/6, alpha 4/4 and alpha 4/3 according to the difference of the number of amino acids between two, three and four cysteines, the difference of the characteristics and the residue composition of each loop is the basis of the toxin acting on different receptor subtypes (Ulens C, Hogg RC, Celie PH, et al

Nicotinic acetylcholine receptors (nAChRs) are allosteric membrane proteins on the cell membrane that mediate a wide variety of physiological functions of the central and peripheral nervous systems, as well as the immune system, including learning, memory, response, analgesia, and motor control. nAChRs activate the release of various neurotransmitters, such as dopamine, norepinephrine, serotonin, gamma-aminobutyric acid, and the like (Giribaldi J, Duetrre S. alpha. -Conotoxins to exo-molecular, physiological and pathophysiological functions of neurological nicotinic acetylcholinergic receptors. Neurosci Lett.2017Dec 2. pi: S0304-3940(17) 30972-2). nAChRs are assembled from different alpha and beta subunits into a wide variety of subtypes, each with distinct pharmacological profiles. Wherein the muscle-type acetylcholine receptor is composed of 5 subunits, comprising 2 α 1 subunits, 1 β subunit, 1 δ subunit and 1 γ or ε subunit depending on whether it is a fetal or adult acetylcholine receptor. The subtypes of mammalian neural nAChRs are much more complex than muscular nAChRs, with at least 8 α subunits, 3 β subunits, α 2- α 7, α 9, α 10(α 8 is present in chicks), and β 2- β 4, respectively. Wherein α 2, α 3 and α 4 can bind to β 2 or β 4, respectively, to form a functional receptor, such as α 2 β 2, α 3 β 2, α 2 β 4, and the like. Furthermore, α 7 and α 9 can form homomultimers. The lack of highly selective ligand compounds for various subtypes presents a number of challenges in studying and elucidating the fine structure and function of the various subtypes of nAChRs.

Studies have shown that α 6 subunit-containing nAChRs (abbreviated α 6 × nAChRs) are distributed mainly in the visual system and in the retina, catecholaminergic nucleus, hippocampus, dorsal root ganglia and midbrain dopaminergic regions, which mediate some important physiological regulatory functions of the organism, such as: mood, pain, addiction, reward, depression, and the like. α 6 nAChRs are important targets for the treatment of neurodegenerative diseases caused by nicotine addiction and dopaminergic nervous system injury. nAChRs expressed in Dopaminergic (DA) neurons are drug action targets for treating neuropsychiatric diseases, such as addiction to nicotine, morphine and cocaine, Parkinson's disease, dementia, schizophrenia, depression, etc. (Larsson, A.; Jerlhag, E.; Svensson, L.; Soderpalm, B.; Engel, J.A., Is an Alpha-cytotoxic MII-sensory mechanism involved in the neurochemical, stimulation, and stimulation effects of intestinal alcohol 2004,34(2-3),239-50.Jerlhag, E.; endothelial, E.; Dick, S.L.; Svensson, L.; Engel, J.A., Alyin-cytotoxic I-hormone, D.508), and collagen-induced metabolism-18. injection. The expression level of α 6 subunit-containing nAChRs in DA neurons is very high, and the mechanism by which α 6 nAChRs play an important role in addiction is unclear due to the lack of α 6 x nAChRs-specific pharmacological molecular probes. The subtype α 6 β 2-nAChRs on the striatum in the brain of mammals is considered to be the target of drug action for the treatment of tobacco, drug and alcohol addiction (extract, R.; consumers, M.A.; Hartung, H.; McIntosh, J.M.; Cragg, S.J., Alpha 6-conjugating amino acids receptors, the control of nanophase neuroleptics, D.Ma., Ma.X.; Sudweeks, S.; Yorgason, J.T.; Gaholo, M.D.; intake, B.B.149, Earlacer.J.; C.9, Wolving. 9, Wolving. J.S.; C.7. 9, C.7, J.9, C.7, J.4. 9, W.7-66. o.F.; C.M.M.J.M.J.J.149. EarvAN. J.E.J.J.; C.S.S.S.S.2019, C.J.J.. The α 6subunit is not widely distributed in the brain, but is abundantly expressed in dopaminergic neuronal regions of the midbrain, which are regions closely associated with pleasure, reward and mood control, meaning that α 6 nAChRs play a key role in the regulation of drug-induced addiction, mood control, and the like (Yang, K.C., G.Z.jin, et al. (2009), Mysterious alpha 6-connective nAChRs: function, pharmacology, and pathophysiology. Acta Pharmacol Sin 30(6), 740-Klink, R.; de Kerchovid' Exaedics, A.; Zollin M.2001, finger, J.P., Molecular and psychological aspects of hormone, J.P., Molecular and physiological aspects of hormone, Journal, J.P. 63., J.P., P., Molecular and physiological aspects of hormone, J.P. P. P.P. P. P.P.P.P.P.D. Pat. No. 3, J.P.P.P.P.P.P.P.P.P., 260-74 Champtiaux, n.; gotti, c.; coridero-eraussquin, m.; david, d.j.; przybylski, c.; lena, c.; clementi, f.; moretti, m.; rossi, f.m.; le Novere, n.; McIntosh, j.m.; gardier, a.m.; changeux, j.p., minor composition of functional inorganic receivers in nanoparticles induced with knock-out micro.the Journal of neuroscience,2003,23(21),7820-9.Pons, s.; cottore, l.; cossu, g.; tolu, s.; porcu, e.; McIntosh, j.m.; changeux, j.p.; maskos, u.; fratta, W., Crucial role of alpha4 and alpha6 inorganic acetyl choline acceptor subbunits from a vertical regional area in a system nucleotide self-administration, the Journal of neuroscience,2008,28(47), 12318-27. Berry, j.n.; engle, s.e.; McIntosh, j.m.; drean, R.M. alpha.6-Containing nicotinic acetyl choline receptors in monoclonal dopamin neurones area presented to mineral dopamin-mediated bhavimers and synthetic plastics Neuroscience 2015,304,161-175.Chen, D.; gao, f.; ma, x.; eaton, j.b.; huang, y.; gao, m.; chang, y.; ma, z.; Der-Ghazarian, t.; neiswander, j.; whiteaker, p.; wu, j.; su, Q.Cocaine direct inhibition alpha6-Containing Nicotinic acid acetyl Receptors in Human SH-EP1 Cells and Mouse VTA DA neurones Front Pharmacol 2019,10, 72).

Alpha6 nAChRs are also expressed on catecholamine neurons and retinas (Lenovere, N.; Zolin, M.; Changeux, J.P., neural information receptor alpha6 suburbit mRNA is selectively conjugated in catholic nucleus of the said rat damage in the neural network 1996,8(11),2428-39. Vailiti, S.; Hanke, W.; Bejan, A.; alpha 6-conjugated, B.; Longhi, R.; Balestla, B.; Moretti, M.; Clementi, F.; Goetti, C., Functional 6-conjugated in, S.; J.S.; Zollin S.6, J.S.; Zollin S.; Zhang, S.; Zhang, S.S.; Zhang, S.; Zhang, S.S.; Zhang, C., Zhang, C.; C., Zhang, C.; C., N.S.; C., Zhang, C.; n.; S.S.S.; S.S.S.S.S.S.S.S.S.; S.S.; S.S.S.; S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.; S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S. J. C.; H., modulation of polypeptide release in the structure by physiological release levels of amino acids Nat Commun 2014,5, 3925.).

The number of α 6 β 2 nAChRs is significantly reduced in primate 1-methyl-4-phenyl-1,2,3, 6-tetrahydropyrindine animal models and human Parkinson disease models (Champtiaux, N.; Han, Z.Y.; Bessis, A.; Rossi, F.M.; Zoli, M.; Marubio, L.; McIntosh, J.M.; Changeux, J.P., Distribution and pharmaceutical of alpha 6-coordinating organic suspensions and copolymers with longitudinal and longitudinal characteristics, 2002,22(4),1208-17.Quik, M.A., environmental, Y., tensile, J.54. alpha. J.2001. Journal of neural theory, 2002,22(4),1208-17.Quik, M.M., J.P.; J.M.S. P.; P.M.M.M.S. J.M. J.S. J.A. J. 2001. supplement, J.S. J. 25, J. supplement, J. alpha.S. alpha.M. 5, J. alpha.M. 5, U.S. supplement, J. alpha.M. 5, J. supplement, J. No. 5, J. supplement, P. alpha.M. 5, U.M. supplement, J. supplement, P. supplement, J. supplement, P., supplement, P. supplement, U.M. supplement, P. supplement, P, P., supplement, U.M. supplement, P. supplement, U.S. supplement, P., supplement, P. supplement, P. supplement, P. supplement, supplement, 88(3),668-79. Gotti, C., Moretti, M., Bohr, I., Ziaberava, I, Vaili, S, Longhi, R., Riganti, L., Gaimari, A., McKeith, I.G., Perry, R.H., Aarsland, D., Larsen, J.P., Sher, E., Beattie, R., Clementi, F., and Cort, J.A, (2006) selected therapeutic acetic ether derivatives in Alzheimer's disease, Parkinson's disease and depletion with Lewy bodies prediction in Neurosis 23,481 beta.3/3. beta.3. and other drugs exist as tools for the specific treatment of diseases such as Chlamda, and Chlamda, 2. and other diseases.

nAChRs containing α 6 subunits are mainly divided into two subtype combinations (α 6 β 2 or α 6 β 4). The expression distribution of the α 6 β 4nAChRs subtype is relatively limited and the basic function is not known. Studies have shown that subtype α 6 β 4 is found in the retina (Marritt, A.M., Cox, B.C., Yasuda, R.P., McIntosh, J.M., Xiao, Y., Wolfe, B.B., and Kellar, K.J (2005) Nicotinic chromotropic receptors in the said retina, simple and mixed serotropic receptors in Mol. Pharmacol 68,1656 Phalaocher 1668), adrenal chromaffin cells (Hernandez-Vivanco, A.Horne, A.J., Scadden, M.L., Carmonia-Hidalgo, B.McIntosh, J.M., and Albillos, A.A. monolithic and J.S. Pub., Hidalgo 2012, Hippon, J.M.S., and J.S. and H.S. Puff.7, Ha.S. Puff.6, Hazephyne, Haemaphyr.7, Hazephyr.S.7, Hazephyr.A.J.7, Hazephyne, Hazephyh, Hazephyr.A.7, Hazephyh, Hazephyr, Hazephysu, Hazephyr.A.No. No. 7, Hazephysu, Haphysu No. 7, Ha, Haphysu No. alpha, Hazephysu No. 7, Hazephysu No. alpha, Ha, Haphyceae, Hayax acetic choline receptors and blocks-fused norepinephrine release. FASEB J24, 5113-. ) And dorsal root ganglia (Vindler, M., and Eisenach, J.C. (2004) plastics of spinal acrylic receptors following spinal neutral neural neutral lift. neurosci Res 48, 139-145). Hone, A.J., Meyer, E.L., McIntyre, M., and McIntosh, J.M. (2012) Nicotinic acid cycloteners in coarse roots gasification nerves in the alpha6beta4 sub-type. FASEB J26, 917-. Smith, n.j., Hone, a.j., Memon, t., Bossi, s., Smith, t.e., McIntosh, j.m., Olivera, b.m., and Teichert, R.W (2013) Comparative functional expression of nAChR subtypes in cadent DRG nerves front Cell Neurosci 7,225). α 6 β 4nAChRs expressed in DRG have direct interaction and cross-inhibition with P2X2/3 receptor, and the resulting neuropathic pain symptoms are negatively correlated with CHRNA6 expression levels (line, A.J., Talley, T.T., Bobango, J., Huidobro, C., Hararah, F., Gajewick, J., Christensen, S., Harvey, P.J., Craik, D.J., and McIntosh, J.M. (2018) Molecular detectors of alpha-connective tissue of human and 6a 4 microbial antigens, J.Biochemical, 293,17838-852, J.178, Mckinetic for interaction of human and 6a 4 microbial antigens, and D.22. hormone, Lentic, D.22, and 32. hormone, and D.2X 2/3 receptors (mineral, L.12. D.12. and 32. hormone, L.2. and 32. C., L.3. and J. 12. hormone, D.10. and D.3. hormone, D.8). This study suggests that α 6 β 4nAChRs are a new potential therapeutic target for neuropathic pain.

In view of the lack of physiological and pathological studies on α 6 β 4nAChRs, it is important to find a blocker of α 6 β 4nAChRs with strong selectivity, especially a blocker capable of distinguishing between subtypes of other similarly structured and overlapping nAChRs, such as α 3 β 4 nAChRs.

Disclosure of Invention

The inventor finds a new alpha-conotoxin peptide (named as TxIE) through intensive research and creative work, and further prepares a TxIE mutant. The inventor surprisingly finds that the TxIE or the mutant thereof can specifically block the acetylcholine receptor, has high-selectivity and strong blocking activity on drug target points alpha 6/alpha 3 beta 2 beta 3nAChR of addiction and Parkinson's disease and drug target points alpha 6/alpha 3 beta 4nAChR related to pain, and has the potential of preparing drugs for smoking cessation, drug rehabilitation or pain relief, or preparing drugs for preventing and/or treating Parkinson's disease, depression, dementia and schizophrenia. The following invention is thus provided:

one aspect of the invention relates to an isolated polypeptide which is a polypeptide having an amino acid sequence as shown in SEQ ID NO. 1 or a mutant thereof;

wherein the amino acid sequence of the mutant is that the 1 st glycine in the sequence shown by SEQ ID NO. 1 is replaced by glutamic acid or aspartic acid; and/or the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced by alanine, isoleucine or leucine;

preferably, the amino acid sequence of the mutant is shown as any sequence in SEQ ID NOs: 2-7.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 in the sequence shown in SEQ ID NO. 1 with glutamic acid.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 of the sequence shown in SEQ ID NO. 1 with aspartic acid.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of methionine at position 15 in the sequence shown in SEQ ID NO:1 with alanine (SEQ ID NO: 2).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of methionine at position 15 in the sequence shown in SEQ ID NO:1 with isoleucine (SEQ ID NO: 3).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of methionine to leucine at position 15 of the sequence shown in SEQ ID NO:1 (SEQ ID NO: 4).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 in the sequence shown in SEQ ID NO. 1 with glutamic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO:1 was replaced with alanine (SEQ ID NO: 5).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 in the sequence shown in SEQ ID NO. 1 with glutamic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO:1 was replaced with isoleucine (SEQ ID NO: 6).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 in the sequence shown in SEQ ID NO. 1 with glutamic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO:1 was replaced with leucine (SEQ ID NO: 7).

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 in the sequence shown in SEQ ID NO. 1 with aspartic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced by alanine.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 in the sequence shown in SEQ ID NO. 1 with aspartic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 was replaced with isoleucine.

In some embodiments of the invention, the amino acid sequence of the mutant is a substitution of glycine at position 1 in the sequence shown in SEQ ID NO. 1 with aspartic acid; and, the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced by leucine.

In some embodiments of the invention, the polypeptide has an amino acid sequence in which one glycine (position 17) or two glycines (positions 17 and 18) are added to the C-terminus of any of SEQ ID NOs: 1-7.

In some embodiments of the invention, the polypeptide has an amino acid sequence in which one glycine (position 17, SEQ ID NO:9) or two glycines (positions 17 and 18, SEQ ID NO:10) are added to the C-terminus of the sequence shown in SEQ ID NO: 1.

In some embodiments of the invention, the polypeptide has an amino acid sequence in which one glycine (position 17) or two glycines (positions 17 and 18) are added to the C-terminus of any of SEQ ID NOs: 2-7.

In some embodiments of the invention, the polypeptide, wherein:

the first cysteine at the N-terminus of the polypeptide forms a disulfide bond with the third cysteine, and the second cysteine forms a disulfide bond with the fourth cysteine; or

The first cysteine at the N-terminus of the polypeptide forms a disulfide bond with the fourth cysteine, and the second cysteine forms a disulfide bond with the third cysteine; or

The first cysteine at the N-terminus of the polypeptide forms a disulfide bond with the second cysteine, and the third cysteine forms a disulfide bond with the fourth cysteine;

preferably, the carboxy terminus of the polypeptide is amidated.

In the invention:

the amino acid sequence is shown as SEQ ID NO:1 is a mature Peptide, also known as α -conotoxin TxIE or Peptide 1;

TxIE is conotoxin peptide; in particular, alpha-conotoxin peptides.

The amino acid sequence is shown as SEQ ID NOs in sequence: 2-7 or [ M15A ] TxIE, [ M15I ] TxIE, [ M15L ] TxIE, [ G1E, M15A ] TxIE, [ G1E, M15I ] TxIE, [ G1E, M15L ] TxIE);

the amino acid sequence is shown as SEQ ID NO: the polypeptide shown in 8 is a precursor peptide, also called alpha-conotoxin TxIE precorsor or TxIE precorsor.

Another aspect of the present invention relates to a method for preparing a polypeptide according to any of the present invention, comprising the steps of:

1) synthesizing linear polypeptide on ABI Prism 433a polypeptide synthesizer or other polypeptide synthesizers or by manual method, wherein the side chain protecting group of Fmoc amino acid is Pmc (Arg), Trt (Cys), But (Thr, Ser, Tyr), OBut (Asp), Boc (Lys); cysteine uses Trt or Acm protecting group to form disulfide bond between corresponding cysteine;

2) cleaving the linear polypeptide obtained in step 1) from the resin and precipitating and washing with glacial ethyl ether to recover a crude linear polypeptide, which is purified using a preparative reverse phase HPLC C18 column (Vydac);

3) carrying out two-step oxidation folding on the product obtained in the step 2).

Another aspect of the invention relates to an isolated fusion protein comprising at least one polypeptide according to any of the invention.

Yet another aspect of the invention relates to an isolated polynucleotide encoding a polypeptide according to any of the invention.

Yet another aspect of the invention relates to a nucleic acid construct comprising a polynucleotide of the invention; preferably, the nucleic acid construct is a recombinant vector; preferably, the nucleic acid construct is a recombinant expression vector.

Yet another aspect of the invention relates to a transformed cell comprising a polynucleotide of the invention, or a nucleic acid construct of the invention.

Yet another aspect of the invention relates to a pharmaceutical composition comprising at least one polypeptide according to any of the invention; optionally, it further comprises one or more pharmaceutically acceptable excipients.

The pharmaceutical composition can be used for research, diagnosis, alleviation or treatment of diseases or disorders related to addiction, neuralgia, cancer, mental retardation, pain, Parkinson's disease, psychosis, depression, myasthenia gravis, and the like. In one embodiment, a pharmaceutical composition comprising a therapeutically effective amount of a polypeptide of the invention is formulated and administered in a manner that facilitates pharmaceutical use, taking into account the clinical condition of the individual patient, the site of delivery, the method of administration, the schedule of administration, and other factors known to practitioners. Thus an "effective amount" for the purposes herein is determined by consideration of these aspects.

The pharmaceutical composition containing a therapeutically effective amount of the polypeptide of the present invention can be administered parenterally, orally, intracisternally, intrathecally, etc. "pharmaceutically acceptable adjuvant" refers to a non-toxic solid, semi-solid or liquid filling, diluent, encapsulating material or formulation auxiliary of any type. The term "parenteral" as used herein means modes of administration including intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous, intrathecal and intraarticular injection and infusion. The polypeptides of the invention may also be suitably administered by a sustained release system.

A further aspect of the invention relates to the use of a polypeptide according to any of the invention for the manufacture of a medicament for blocking α 6 acetylcholine receptors; preferably, the α 6 acetylcholine receptor is an α 6/α 3 β 2 β 3 acetylcholine receptor or an α 6/α 3 β 4 acetylcholine receptor.

In a further aspect, the present invention relates to the use of a polypeptide according to any of the present invention for the preparation of a medicament for the treatment and/or prevention of neurological diseases, or for the preparation of a medicament for analgesia, smoking cessation or drug addiction;

preferably, the neurological disease is at least one of addiction, neuralgia, parkinson's disease, dementia, schizophrenia, and depression;

preferably, the addiction is caused by at least one of the following factors: various psychoactive substances such as nicotine, opium, heroin, methamphetamine (methamphetamine), morphine, cannabis, cocaine or alcohol;

preferably, the neuropathic pain is selected from at least one of: sciatica, trigeminal neuralgia, lymphatics neuralgia, multiple-point motion neuralgia, acute severe idiopathic neuralgia, extrusion neuralgia, and compound neuralgia;

preferably, the neuropathic pain is caused by at least one of the following factors: cancer, cancer chemotherapy, alcoholism, diabetes, cirrhosis, shingles, mechanical injury, surgical wound, aids, cranial nerve paralysis, drug intoxication, industrial contamination intoxication, myeloma, chronic congenital sensory neuropathy, vasculitis, ischemia, uremia, childhood biliary liver disease, chronic respiratory disorder, multiple organ failure, sepsis/sepsis, hepatitis, porphyria, vitamin deficiency, chronic liver disease, primary biliary cirrhosis, hyperlipidemia, leprosy, lyme arthritis, sensory neurofasciitis, or allergy.

Researches show that the alpha 6/alpha 3 beta 2 beta 3nAChR is a drug action target point for treating neuropsychiatric diseases, such as addiction to nicotine, morphine, cocaine and the like, Parkinson's disease, dementia, schizophrenia, depression and the like; α 6 β 4nAChRs are a new potential therapeutic target for neuropathic pain (see literature in the background). Therefore, the novel alpha-conotoxin TxIE and the mutant thereof have high application value in the aspects of mechanism research, diagnosis and treatment of the diseases.

The dosage to be administered will depend on a number of factors, such as the severity of the condition being treated, the sex, age, weight and individual response of the patient or animal, and the condition and past medical history of the patient being treated. It is common practice in the art to start doses at levels below those required to achieve the desired therapeutic effect and to gradually increase the dose until the desired effect is achieved.

Yet another aspect of the invention relates to a method of blocking α 6 acetylcholine receptors or modulating α 6 acetylcholine levels in vivo or in vitro comprising the steps of administering to a subject or applying to a cell an effective amount of a polypeptide of any of the invention; preferably, the α 6 acetylcholine receptor is an α 6/α 3 β 2 β 3 acetylcholine receptor or an α 6/α 3 β 4 acetylcholine receptor.

In the invention:

the term "addiction" refers to a periodic or chronic toxic state of repeated use of psychoactive substances. The psychoactive substance is nicotine, opium, heroin, methamphetamine (methamphetamine), morphine, marijuana, cocaine, and other narcotics and psychotropic drugs regulated by national regulation and capable of forming addiction. Addiction is associated with the production of large amounts of Dopamine (Dopamine) in the brain. The behavior is manifested by the irreducible application of the preferred substances and the difficulty in self-control or correction of the use, and no means can be selected for obtaining the psychoactive substance to achieve the purpose of good feeling or avoiding the pain of withdrawal. Typically, tolerance is increased and withdrawal symptoms often occur after interruption of substance use. The lives of addicts may be completely dominated by substance use, thus severely influencing and even abandoning other important activities and everything. Thus, the use of substances is damaging to both individuals and society. When used for alcohol use, the concept of chronic alcoholism is equivalent. The term addiction also covers both physical and psychological aspects. Psychological addiction emphasizes the impaired experience of the ability to self-control alcohol consumption and medication, while physical addiction refers to tolerance and withdrawal symptoms.

The term "nucleic acid construct", defined herein as a single-or double-stranded nucleic acid molecule, preferably refers to an artificially constructed nucleic acid molecule. Optionally, the nucleic acid construct further comprises 1 or more regulatory sequences operably linked.

In the present invention, the term "operably linked" refers to a functional spatial arrangement of two or more nucleotide regions or nucleic acid sequences. The "operably linked" may be achieved by means of genetic recombination.

In the present invention, the term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide inhibiting a protein is inserted. By way of example, the carrier includes: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosomes (YACs), Bacterial Artificial Chromosomes (BACs), or artificial chromosomes (PACs) derived from P1; bacteriophage such as lambda phage or M13 phage, animal virus, etc. Animal virus species used as vectors are retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpes virus (e.g., herpes simplex virus), poxvirus, baculovirus, papilloma virus vacuolatum (e.g., SV 40). A vector may contain a variety of elements that control expression.

In the present invention, the term "host cell" refers to a cell into which a vector is introduced, and includes many cell types such as prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblast, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells, or human cells.

The term "effective amount" refers to a dose that achieves treatment, prevention, alleviation and/or amelioration of a disease or disorder described herein in a subject.

The term "disease and/or disorder" refers to a physical condition of the subject that is associated with the disease and/or disorder of the present invention.

The term "subject" can refer to a patient or other animal, particularly a mammal, e.g., a human, dog, monkey, cow, horse, etc., that receives a pharmaceutical composition of the invention to treat, prevent, ameliorate, and/or alleviate a disease or disorder described herein.

In the present invention, the concentration unit. mu.M means. mu. mol/L, mM means mmol/L, and nM means nmol/L, unless otherwise specified.

In the present invention, when referring to the amount of drug to be added to cells, it is generally referred to the final concentration of the drug after the addition of the drug, unless otherwise specified.

In the present invention, the term "amino acid" or a specific amino acid name refers to an L-form amino acid unless otherwise specified.

Advantageous effects of the invention

The conotoxin peptide can play a role by combining alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta4 acetylcholine receptors (nAChR), and has the activity of abstaining from addiction and relieving pain. Can be applied to research, diagnosis and treatment of addiction, neuralgia, Parkinson's disease, dementia, schizophrenia, depression and other nervous system diseases, and can be used as a useful molecular probe for research and other aspects. Different α -CTX have different affinities for vertebrate receptors, sometimes by orders of magnitude. This phylogenetic difference makes α -CTX useful as a probe for studying vertebrate nAChR phylogeny and as a molecular probe for determining different subtypes of nAChR. They are candidates, lead drugs and therapeutic drugs for new drug development.

Drawings

FIG. 1: the sequences of alpha-conotoxin TxIE (polypeptide 1, Peptide 1) and mutants thereof (polypeptide 2-7, Peptide 2-7) and the disulfide bond connection mode Cys (I-III, II-IV). Each substituted amino acid is underlined. Cysteines are italicized. # denotes C-terminal amidation.

FIG. 2A: alpha-conotoxin TxIE propeptide gene sequence, propeptide generated by coding the alpha-conotoxin TxIE propeptide and mature peptide generated by posttranslational modification. Arrows indicate processing sites for post-translational modifications. The putative proteolytic processing site 1(processing site 1) follows the basic amino acid lysine (K); the C-terminal amidation processing site may be at the position of the two glycines indicated by the arrows, i.e., processing site 2. The glycine residue immediately C-terminal to cysteine (Cys) of the mature peptide is often the processing site for amidation post-translational modification, and the mature peptide produced by amidation from processing site 2 is named TxIE and has the sequence: GCCSNPPCIAKNPHMC # (# denotes the C-terminal amide.the propeptide region is in italics, the mature peptide is underlined, cysteine (C) is shown in bold font, and the stop codon is indicated by an x.

FIG. 2B, alpha-conotoxin TxIE and its disulfide bond linkage Cys (I-III, II-IV), # denotes C-terminal amidation.

FIGS. 3A-3B: respectively are a high-pressure liquid chromatogram and an ESI-MS mass spectrum of TxIE.

FIGS. 3C-3D: high pressure liquid chromatogram and ESI-MS mass spectrum of [ M15A ] TxIE (polypeptide 2), respectively.

FIGS. 3E-3F: high pressure liquid chromatogram and ESI-MS mass spectrum of [ M15I ] TxIE (polypeptide 3), respectively.

FIGS. 3G-3H: high pressure liquid chromatogram and ESI-MS mass spectrum of [ M15L ] TxIE (polypeptide 4), respectively.

Wherein in FIGS. 3A, 3C, 3E and 3G:

the HPLC analysis conditions were as follows: c18 column (Vydac) eluting with a linear gradient of 10-40% B60 (60% in acetonitrile) over 0-40min, monitoring wavelength 214 nm. Solvent B60 is an aqueous solution containing 90% Acetonitrile (ACN), 0.05% tfa (trifluoracetic acid); solvent a was 0.05% TFA in water;

the number of minutes in the HPLC chromatogram, representing the retention time of the chromatographic peak;

the abscissa is elution time in minutes (min); the ordinate is the ultraviolet absorption (UV) at a wavelength of 214nm₂₁₄)。

FIGS. 4A-4B: HPLC chromatogram and mass spectrum of [ G1E, M15A ] TxIE (polypeptide 5), respectively.

FIGS. 4C-4D: HPLC chromatogram and mass spectrum of [ G1E, M15I ] TxIE (polypeptide 6), respectively.

FIGS. 4E-4F: HPLC chromatogram and mass spectrum of [ G1E, M15L ] TxIE (polypeptide 7), respectively.

Wherein the HPLC analysis conditions in FIGS. 4A, 4C and 4E are the same as those in FIGS. 3A, 3C, 3E and 3G.

FIG. 5: effect of α -CTx TxIE (polypeptide 1) (10 μ M) on the current of various subtypes of nAChRs expressed in Xenopus oocytes. All data represent Mean ± s.e.m, n ═ 4 to 6. The abscissa is the percent current response, calculated as: the current at a concentration of 10 μ M of TxIE for each subtype of nAChRs was divided by the percentage of the respective Control current (Control ND 96). Here, Control refers to the current generated by Ach excitation after adding ND96 buffer solution with the same volume as the drug TxIE into a cell tank and incubating for 5min, which is the Control current.

FIGS. 6A-6H: the current trace graphs of TxIE (polypeptide 1) and [ M15I ] TxIE (polypeptide 3) for blocking rat alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta 4nAChRs are high-selectivity specific blocking agents of alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta4 nAChRs. In the figure, "C" refers to the control (ND96) current, and the concentration of the polypeptide immediately follows "C". The arrows indicate the current traces formed by the first Ach pulse that the polypeptide blocked the corresponding receptor subtype after 5 minutes of incubation. Wherein:

FIG. 6A: the current influence of 1 μ M TxIE on α 6/α 3 β 4 nAChR;

FIG. 6B: the current influence of 1 μ M TxIE on α 6/α 3 β 2 β 3 nAChR;

FIG. 6C: current contribution of 10 μ M TxIE to α 3 β 4 nAChR;

FIG. 6D: current contribution of 10 μ M TxIE to α 3 β 2 nAChR;

FIG. 6E: the current influence of 1 μ M [ M15I ] TxIE on α 6/α 3 β 4 nAChR;

FIG. 6F: the current influence of 1 μ M [ M15I ] TxIE on α 6/α 3 β 2 β 3 nAChR;

FIG. 6G: the current influence of 10 μ M [ M15I ] TxIE on α 3 β 4 nAChR;

FIG. 6H: current contribution of 10 μ M [ M15I ] TxIE to α 3 β 2 nAChR.

Rat α 6/α 3 β 2 β 3 and α 6/α 3 β 4nAChRs were expressed in Xenopus oocytes, the clamp voltage at electrophysiological recording was-70 mV, and 1 second(s) Ach pulses were given every 1 minute according to the experimental protocol. TxIE completely blocked the α 6/α 3 β 4 (fig. 6A) and α 6/α 3 β 2 β 3 (fig. 6B) nachrs currents, but had no blocking activity for α 3 β 4 (fig. 6C) and α 3 β 2 (fig. 6D) nachrs. [ M15I ] TxIE was also able to completely block α 6/α 3 β 4 (FIG. 6E) and α 6/α 3 β 2 β 3 (FIG. 6F) nAChR currents, but had no blocking activity against α 3 β 4 (FIG. 6G) and α 3 β 2 (FIG. 6H) nAChR.

FIGS. 7A-7D: concentration response profiles of TxIE (polypeptide 1) and its mutants (polypeptides 2-7) for rat α 6/α 3 β 2 β 3 and α 6/α 3 β 4 nAChRs. The abscissa of the graph is the Log [ Peptide ] M of the molar concentration (M) of the polypeptide used; the ordinate is the percent Response (Response%) of the concentration, which is the percentage ratio of the acetylcholine receptor current to the control current at the corresponding concentration of the polypeptide. The individual values in the figure are the Mean values of the currents taken from 4-6 xenopus oocytes, i.e. Mean ± s.e.m, n-4-6. Wherein:

FIG. 7A: concentration-response curve diagram of TxIE and its mutant (polypeptide 2-4) to rat alpha 6/alpha 3 beta 2 beta 3 nAChR;

FIG. 7B: concentration-response curves of TxIE and its mutants (polypeptides 5-7) against rat α 6/α 3 β 2 β 3 nAChR;

FIG. 7C: concentration-response curves of TxIE and its mutants (polypeptides 2-4) against rat α 6/α 3 β 4 nAChR;

FIG. 7D: concentration-response curves of TxIE and its mutants (polypeptides 5-7) against rat α 6/α 3 β 4 nAChR.

FIG. 8: concentration dose response curves for TxIE (polypeptide 1) against all subtypes of nAChRs, plotted on the abscissa as the Log [ Peptide ] M of the molar concentration (M) of the TxIE polypeptide used; the ordinate is the percent Response (Response%) of the concentration, which is the percentage ratio of the acetylcholine receptor current to the control current at the corresponding concentration of the polypeptide. The individual values in the figure are the Mean values of the currents taken from 4-6 xenopus oocytes, i.e. Mean ± s.e.m, n-4-6.

FIGS. 9A-9C: nuclear Magnetic Resonance (NMR) spatial structure of TxIE (polypeptide 1) and its mutants (polypeptides 2-4). Wherein:

FIG. 9A: the secondary chemical shift of alpha H of the polypeptide 1-4;

FIG. 9B: the 20 lowest-energy spatial structure overlap graphs of TxIE (polypeptide 1), wherein the blue curve represents the atomic skeleton of the polypeptide and the yellow curve represents the disulfide bond; wherein N-terminal represents the N-terminus and C-terminal represents the C-terminus.

FIG. 9C: the three-dimensional structure of TxIE (polypeptide 1) has a color band diagram, showing 2 alpha helical structures and a connection mode of two pairs of disulfide bonds.

Fig. 10A to fig. 10H: an interactive molecular docking model of TxIE (polypeptide 1) with the α/β interface positive binding sites of α 3 β 2, α 3 β 4, α 6 β 2 and α 6 β 4 nAChRs. 10A-10D show interaction models for TxIE at the α/β interface positive binding sites, with the color of the solvent-contactable surface determined by the electrostatic potential generated by the receptor, from red (-5kT/e) to white (0kT/e) to blue (5 kT/e). FIGS. 10E-10H show magnified views of the binding region between Lys-11 and the receptor of TxIE, in which the α subunit is blue and the β subunit is green. The molecular docking model shown in this figure is a centroid framework generated by a 100ns molecular dynamics simulation for each system. In all molecular docking models, conotoxin TxIE is represented by orange cartoon and rod-like diagrams. In the upper part of the figure, the white dotted encircled portion represents the region of interaction between the Lys-11 head charged group of TxIE and the receptor. The N-terminus of TxIE is indicated by the white "N". The electrostatic potential was calculated with APBS 1.4 with default parameters at 150mM salt concentration.

Detailed Description

Embodiments of the present invention will be described in detail with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not show the specific techniques or conditions, and the techniques or conditions are described in the literature in the art (for example, refer to J. SammBruk et al, molecular cloning, A laboratory Manual, third edition, science Press, translated by Huang Petang et al), the corresponding references, or the product instructions. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1: cloning and sequence analysis of alpha-conotoxin TxIE gene

1. Extraction of genomic DNA of conus littoralis

Living bodies of brocade conus (C.textile Linnaeus) collected from coastal areas such as Hainan island, West Shajie island and the like are respectively used as materials and stored at-80 ℃ for later use. The conus venom glands were dissected out first and weighed. Then, using a marine animal genome DNA extraction kit (purchased from Beijing Tiangen Biochemical technology Co., Ltd., China) to extract the genome DNA of the toxic gland, and the specific operation is shown in the kit specification.

Dissolving the extracted conus genome total DNA in 100 mu L of TE, taking 5 mu L of TE to perform 1.0% agarose gel electrophoresis, and detecting the integrity and the size of the obtained DNA by taking lambda-EcoT 14I digest DNA Marker as a standard. Determination of OD260, OD280 and OD280 of DNA solution with nucleic acid protein analyzer260/OD280 ratio, and calculating the concentration of DNA (. mu.g.ml)^-1) Purity and DNA yield (. mu.g.g.g)^-1). The extracted complete DNA is used for the next PCR amplification to carry out the template of the conotoxin gene cloning.

PCR reaction and cloning, sequencing, and sequence analysis of the product thereof

According to the intron sequence of the alpha-conotoxin precursor gene and the 3 'untranslated region (3' -UTR) sequence thereof, alpha-conotoxin specific primers are designed, and each primer is an oligonucleotide fragment with 18 basic groups.

The upstream intron primer sequence is 5'-GTGGTTCTGGGTCCAGCA-3' (SEQ ID NO: 11);

the downstream 3 ' -UTR primer sequence is 5'-GTCGTGGTTCAGAGGGTC-3' (SEQ ID NO: 12).

Diluting the extracted genome DNA stock solution to be used as a template for PCR amplification. And recovering a PCR specific amplification product, connecting the PCR specific amplification product with a T-easy vector (Promega), transforming an escherichia coli XL1 strain, selecting a recombinant by utilizing a blue-white colony and ampicillin resistance, and extracting and purifying a recombinant plasmid for sequencing analysis.

The sequence of the obtained PCR specific amplification product is analyzed by DNAStar software, and the sequence of the coding protein and the sequence of the 3' -untranslated region (UTR) are obtained. Prediction of signal, propeptide and mature peptides of the conotoxin precursor protein was analyzed using an on-line ProP 1.0Server (Duckert, P.; Brunak, S.; Blum, N., Prediction of protein converting cleavage sites, design & selection: PEDS 2004,17(1), 107-12.).

Through sequence analysis and comparison, a new alpha-conotoxin (named TxIE) precursor gene is obtained (FIG. 2A):

GTGGTTCTGGGTCCAGCATCTGATGGCAGGAAAGCTGCAGTGTCTGACCTGATCACTCTGACCATCAAGGGATGCTGTTCTAATCCTCCCTGTATCGCGAAGAATCCACACATGTGTGGTGGAAGACGCTGA(SEQ ID NO:13)

according to the characteristics of precursor gene and conotoxin, the amino acid sequence of the TxIE conotoxin propeptide is deduced as follows:

VVLGPASDGRKAAVSDLITLTIKGCCSNPPCIAKNPHMCGGRR(SEQ ID NO：8)

the mature peptide TxIE was further deduced from the propeptide sequence and has the amino acid sequence GCCSNPPCIAKNPHMC (SEQ ID NO: 1), and the methods and principles of inference are described in Luo S, Zhang Sun D, Zhang B, Quan Y, Wu Y. novel alpha-toxins identified by gene sequencing from the group of genes from native to Haian, and the sequence diversity. J Pept Sci.2006,12(11): 693-. The derivation results are shown in detail in FIG. 1, FIGS. 2A-2B.

TxIE (polypeptide 1) is a novel alpha-conotoxin with an amidated modification at its C-terminus. TxIE contains the CC-C-C cysteine pattern with the disulfide bond pattern Cys (I-III, II-IV) (FIG. 1, FIG. 2B), i.e., two pairs of disulfide bonds are formed between the first and third cysteines, and the second and fourth cysteines, respectively. TxIE is different from other known alpha-conotoxins.

Example 2: design of alpha-conotoxin TxIE mutant

Based on the sequence structure of TxIE, 6 mutants shown in fig. 1 (polypeptides 2-7, as shown in table 1) were designed by point mutation of glycine (G) at position 1 and methionine (M) at position 15, respectively, and the amino acid sequences thereof are shown in SEQ ID NOs: 2-7. Further, 6 mutants were disulfide-linked, C-terminally amidated.

The DNA sequences of the precursor genes were deduced from the sequences of the polypeptides 2 to 7 and are shown in Table 1.

TABLE 1 polypeptide sequences of TxIE and mutants thereof

Name (R)	Sequence of
		TxIE	GCCSNPPCIAKNPHMC#
[M15A]TxIE	GCCSNPPCIAKNPHAC#
		[M15I]TxIE	GCCSNPPCIAKNPHIC#
[M15L]TxIE	GCCSNPPCIAKNPHLC#
		[G1E,M15A]TxIE	ECCSNPPCIAKNPHAC#
[G1E,M15I]TxIE	ECCSNPPCIAKNPHIC#
		[G1E,M15L]TxIE	ECCSNPPCIAKNPHLC#

Note: the mutated amino acid positions are underlined and the cysteines are italicized.

Example 3: artificial synthesis of alpha-conotoxin TxIE and mutant thereof

Linear peptides were artificially synthesized by Fmoc method based on the amino acid sequences of the α -conotoxin mature peptide TxIE and its mutant (table 1) (fig. 1). The specific method comprises the following steps:

the resin peptide is artificially synthesized by adopting an Fmoc chemical method, and can be synthesized by using a polypeptide synthesizer or a manual synthesis method. The remaining amino acids, except cysteine, are protected with standard side chain protecting groups. the-SH of the 1 st and 3 rd cysteines (Cys) of TxIE and its mutants is protected with Trt (S-trityl), and the-SH of the 2 nd and 4 th cysteines is protected in pairs with Acm (S-acetamidomethyl).

The specific synthesis steps are as follows: 7 linear peptides in FIG. 1 were synthesized on an ABI Prism 433a polypeptide synthesizer using Fmoc and FastMoc methods among solid phase synthesis methods. The side chain protecting groups of the Fmoc amino acid are Pmc (Arg), Trt (Cys), But (Thr, Ser, Tyr), OBut (Asp) and Boc (Lys). The Fmoc HOBT DCC method, Rink amidated resin and Fmoc amino acid are adopted, and the synthetic steps are carried out according to an instrument synthesis manual. In order to complete the reaction, the piperidine deprotection and coupling time are respectively and properly prolonged, and the amino acid difficult to be grafted is subjected to double coupling to obtain the resin peptide. The linear peptide was cleaved from the resin with reagent K (trifluoracetic acid/water/ethanol/phenol/thionisole; 90:5:2.5:7.5:5, v/v/v/v/v) and the crude linear peptide recovered by precipitation and washing with glacial ethyl ether, purified with a preparative reverse phase HPLC C18 column (Vydac) eluting a linear gradient of 10-40% B90 in 0-40min and monitoring wavelength 214 nm. Solvent B90 is an aqueous solution containing 90% acetonitrile (CAN), 0.05% tfa (trifluoracetic acid); solvent a was 0.05% TFA in water.

The purity of the purified linear peptide was checked by analytical HPLC C18 column (Vydac) under the same elution conditions as above and at a flow rate of 1 mL/min. The purity of the product reaches more than 95 percent, and the product is used for oxidation folding.

Reference is made to the literature (Dowlell, C.; Olivera, B.M.; Garrett, J.E.; Stahelli, S.T.; Watkins, M.; Kuryatov, A.; Yoshikami, D.; Lindstrom, J.M.; McIntosh, J.M., Alpha-keto PIA is selected for Alpha6 Subunit-contacting organic acetyl chloride receptors. the Journal of neuroscience 2003,23(24),8445-52.) for a two-step oxidative folding reaction of linear peptides of TxIE and its mutants, as follows:

first, a first pair of disulfide bonds was formed between the two cysteines of the Trt protecting group by potassium ferricyanide oxidation (20mM potassium ferricyanidide, 0.1M Tris, pH 7.5, 45 min). The monocylic peptide was purified by reverse phase HPLC C18 column (Vydac) and subjected to iodoxidation (10mM iododine in H)₂Trifluoroacetic acid Acetonitrile (78:2:20by volume, 10min), Acm on the other 2 cysteines was removed, while a second pair of disulfide bonds was formed between these 2 cysteines. The bicyclic peptide was further purified by reverse phase HPLC C18 column (Vydac) to obtain the corresponding moiety in the order from N-terminus to C-terminusAlpha-conotoxins with oriented formation of disulfide bonds between cystines were identified by mass spectrometry (ESI-MS).

HPLC chromatogram and ESI-MS mass spectrum of the oxidized and folded TxIE and the mutant thereof are shown in FIGS. 3A-3H and FIGS. 4A-4F. The purity of the synthesized TxIE and the mutant thereof is over 95 percent. The measured molecular weight of TxIE and its mutant is consistent with the theoretical molecular weight (Table 2), and the synthesized 7 polypeptides have correct molecular weight and high purity. The polypeptide concentration was determined colorimetrically at a wavelength of 280nm and the polypeptide concentration and mass were calculated according to the Beer-Lambert equation (equalisation). These quantified folded polypeptides were used for subsequent activity testing.

TABLE 2 molecular weights of α -CTx TxIE and its mutants

Polypeptides	Theoretical molecular weight (Da, average)	Measured molecular weight (Da)
			TxIE	1670.00	1669.80
[M15A]TxIE	1609.89	1609.68
			[M15I]TxIE	1651.97	1651.98
[M15L]TxIE	1651.97	1651.89
			[G1E,M15A]TxIE	1681.95	1681.80
[G1E,M15I]TxIE	1724.03	1724.01
			[G1E,M15L]TxIE	1724.03	1723.92

Example 4: alpha-conotoxin TxIE pairs alpha 6/alpha 3 beta 2 beta 3, alpha 6/alpha 3 beta 4nAChRs, and all other nAChRs Study of the Activity of forms

With reference to the literature (Azam L, Yoshikami D, McIntosh JM. amino acid residues with high selectivity of the alpha6 nicotinic acid receptor subunit to alpha-deoxygen MII [ S4A, E11A, L15A ]. J Biol chem.2008; 283(17):11625-32.), and the in vitro transcription kit (Ambion, Austin TX)) description, various rat neural nAChRs subtypes (α 3 β 2, α 6/α 3 β 2 β 3, α 6/α 3 β 4, α 9 α 10, α 4 β 2, α 4 β 4, α 3 β 4, α 2 β 2, α 2 β 4, α 7 β 4, and mouse RNA concentration at α 1nm were prepared and measured using UV-type RNA concentration measurements at α 1 nm. Xenopus laveus oocytes (frog eggs) were dissected and injected with cRNA in an amount of 5ng per subunit. Intramuscular nachrs were injected with 0.5-2.5ng of DNA per subunit. Frog eggs were cultured in ND-96. The cRNA was injected 1-2 days after frog egg collection and voltage clamp recordings for nAChRs were made 1-4 days after injection.

1 frog egg injected with cRNA was placed in 30uLND96 perfusate (96.0mM NaCl,2.0mM KCl,1.8mM CaCl) containing 0.1mg/ml BSA (bone serum album) was gravity perfused in a Sylgard recording tank (diameter 4 mM. times.depth 2mM)₂,1.0mM MgCl₂5mM HEPES, pH 7.1-7.5) or ND96 containing 1mM atropine (ND96A) at a flow rate of 1 ml/min. All conotoxin solutions also contained 0.1mg/ml BSA TO reduce non-specific adsorption of toxins, free switching between perfusion toxins or acetylcholine (ACh) using a switching valve (SmartValve, Cavro Scientific Instruments, Sunnyvale, CA), and free switching between perfusion ND96 and ACh etc. using a series of three-way solenoid valves (solenoid valves, model 161TO31, Neptune Research, Northboro, MA). The Ach-gated current is set in a "slow" clamp by a two-electrode voltage clamp amplifier (model OC-725B, Warner Instrument core, Hamden, CT), and recorded online with clamp gain at the maximum (x 2000) position. The glass electrode was drawn with a 1mm outer diameter x 0.75 mm inner diameter glass capillary (fiber-filtered boron ceramics, WPI inc., Sarasota, FL) and filled with 3M KCl as a voltage and current electrode. The film voltage clamp was controlled at-70 mV. and the entire system was computer controlled and data recorded. The ACh pulse was automatically perfused with ACh for 1s every 5 min. The concentration of ACh is 10 mu M in the eggs expressing muscle type nAChRs and nerve type alpha 9 alpha 10nAChRs respectively; α 7 of nAChRs expressing the neural type was 200. mu.M, and the other subtypes were 100. mu.M. At least 4 eggs were recorded expressing the current response of a certain subtype to different toxin concentrations, as well as the current traces.

The current data measured were statistically analyzed using GraphPad Prism software (San Diego, Calif.), dose-response curves were plotted, and the half-blocking concentration IC of conotoxin was calculated₅₀And various parameters related to polypeptide blocking nAChRs.

The results show that TxIE (prepared in example 3) has the strongest blocking activity on rat alpha 6/alpha 3 beta 2 beta 3nAChR and half-blocking dose (IC)₅₀) 2.4nM only, followed by α 6/α 3 β 4nAChR, half-blocking dose (IC)₅₀) Was 91 nM. The blockade activity of TxIE on α 6/α 3 β 2 β 3 was 39-fold stronger than that of α 6/α 3 β 4nAChR subtype (fig. 5, fig. 6A to 6H, fig. 7A to 7D, fig. 8, table 3 to table 4). TxIE at a high concentration of 10. mu.M, at all other subtypes of receptorNone had blocking effect and all of them had a percent response of more than 90% in current compared to control current (FIG. 5, FIG. 6C, FIG. 6D, tables 3-4). 1 μ M TxIE almost completely blocked the currents generated by the opening of Ach-gated rat α 6/α 3 α 02 α 33 (FIG. 6B) and α 16/α 23 β 4 (FIG. 6A) nAChRs. After the TxIE blocks the α 6/α 3 β 2 β 3 receptor, the elution rate is faster and can be eluted back to the control current level within 4min (fig. 6B), while after the TxIE blocks the α 6/α 3 β 4 receptor, the elution rate is slower and needs 19min to be eluted back to the control current level (fig. 6A). Blockade of both subtypes by TxIE was reversible with widely different elution rates (fig. 6A, 6B).

TxIE has strong and highly selective blocking activity against nAChR subtypes containing the α 6subunit (α 6), i.e., α 6/α 3 β 2 β 3 (table 3-table 4) and α 6/α 3 β 4. 10 μ M TxIE had no effect on both α 3 β 4 and α 3 β 2 nAChRs, which are very close to α 6 × nAChRs (fig. 6A, 6B, 6C, 6D).

TABLE 3. alpha-CTx TxIE and mutants thereof

IC acting on alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta 4nAChRs₅₀Value summary table

Note: a represents a Hill constant; b represents the IC acting on alpha 6/alpha 3 beta4 and alpha 6/alpha 3 beta 2 beta 3nAChR₅₀Ratio of

TABLE 4 TxIE and [ M15I ] TxIE

IC acting on different nicotinic acetylcholine receptor subtypes₅₀Value of

^aRepresenting an inhibition of less than 50% at a concentration of 10. mu.M.

Example 5: activity research of alpha-conotoxin TxIE mutant on alpha 6/alpha 3 beta 2 beta 3 and alpha 6/alpha 3 beta 4nAChRs

The activity of 6 mutants of TxIE (SEQ ID NOs:2-7, FIG. 1) on various subtypes of nAChRs was determined according to the method of example 4, and the results are shown in FIGS. 6A-6H and FIGS. 7A-7D, Table 3. The 6 mutants of TxIE blocked almost completely the current of α 6/α 3 β 2 β 3 and α 6/α 3 β 4nAChRs at high concentrations of 10 μ M. The concentration-response curves for the 6 mutants of TxIE for α 6/α 3 β 2 β 3 and α 6/α 3 β 4nAChRs are shown in FIGS. 7A-7D.

Table 3 and FIGS. 7A-7D summarize the IC's of 6 mutants of TxIE for α 6/α 3 β 2 β 3 and α 6/α 3 β 4nAChRs₅₀And activity changes. It can be seen that the TxIE mutants are dose-dependent on the blocking activity of α 6/α 3 β 2 β 3 and α 6/α 3 β 4 nAChRs. 3 mutants in which the 15 th methionine was substituted [ M15A ]]TxIE(SEQ ID NO：2),[M15I]TxIE (SEQ ID NO:3) and [ M15L]The inhibitory activity of TxIE (SEQ ID NO:4) on alpha 6/alpha 3 beta 2 beta 3nAChR has NO obvious change, while the inhibitory activity on alpha 6/alpha 3 beta 4nAChR is slightly enhanced. Wherein [ M15I]TxIE (SEQ ID NO:3) has the strongest blocking effect on alpha 6/alpha 3 beta 2 beta 3nAChR, and the IC thereof is₅₀The value was 1(0.7-1.4) nM and activity on α 6/α 3 β 4nAChR was also enhanced by about 3-fold compared to bulk TxIE, IC₅₀The value was 31(28-34) nM. In contrast, the 3 mutants substituted in position 1 had greatly reduced activity on α 6/α 3 β 2 β 3 and α 6/α 3 β 4nAChRs compared to the wild-type TxIE, and their concentration-response curves shifted overall to the right (fig. 7B and 7D). [ M15I]The blocking activity of TxIE on alpha 6/alpha 3 beta 2 beta 3 is 31 times stronger than that of alpha 6/alpha 3 beta 4nAChR subtype. TxIE (SEQ ID NO: 1) and [ M15I]TxIE (SEQ ID NO:3) showed NO significant blocking effect at 10. mu.M concentrations for other receptor subtypes, such as m.alpha.1. beta.1. delta. epsilon., r.beta.13. beta.02, r.beta.33. beta.24, r.beta.52. beta.42, r.beta.62. beta.4, r.beta.74. beta.2, r.alpha.4. beta.4, r.alpha.7 and r.alpha.9. alpha.10 nAChRs (Table 4 and FIG. 8). Thus, mutant [ M15I]TxIE (SEQ ID NO:3) has significantly enhanced activity compared to wild-type TxIE, and is a novel polypeptide capable of acting efficiently and specifically on α 6 nAChRs.

Example 6: nuclear Magnetic Resonance (NMR) three-dimensional space structure analysis of alpha-conotoxin TxIE and mutant thereof

The structures of TxIE (SEQ ID NO: 1) and its 3 mutants (SEQ ID NO: 2-4) in which position 15 was substituted were analyzed by NMR. Specific methods refer to Shen, y.; bax, A.protein backbone and side chain drive compressed from NMR chemical shift using aromatic neural networks.J.biomol.Nmr.2013,56, 227-; adams, p.d.; clore, g.m.; DeLano, w.l.; gross, p.; gross-Kunstleve, r.w.; jiang, j.s.; kuszewski, j.; nilges, m.; pannu, n.s.; read, r.j.; rice, l.m.; simonson, t.; warren, G.L.Crystallgraphics & NMR System: A new software suite for a cellular structure determination. acta Crystalloger, Sect.D.Biol.Crystalloger.1998, 54, 905-.

In aqueous solution, all 4 peptides had good folded conformations, although a small number of isomers (less than 20%) were observed for the overall structure due to one or more cis-trans isomerisations of the three proline residues. The backbone protons of each main isomer achieve full resonance, except for the N-terminal amide proton. Changes in the secondary chemical shifts of α H for TxIE and its 3 mutants were very similar. This indicates that the change in the main structure due to the substitution of methionine is negligible. The sequence of the centrally located short alpha-helical portion is represented by the negative histogram of the secondary structure of the individual amino acid residues, alpha H chemical shift, at values less than-0.1 ppm (FIG. 9A).

The three-dimensional solution structure of TxIE was calculated from 111 distance-constrained values derived from NOESY spectra at temperature 288K. From the 17 dihedral structures generated by chemical shifts of TALOS-N and the temperature coefficient, 20 spatial structures with the lowest energy were calculated (fig. 9B). The three-dimensional structure of TxIE (SEQ ID NO: 1) is shown in FIG. 9C, where there are 2 α -helical secondary structures, and two distinct pairs of disulfide bonds and their linkages. Table 5 shows the data relating to the NMR structure and its energy calculation, with RMSD

The main configuration of the three prolines is trans conformation, based on NOE effect and carbon 13 chemical shift analysis between H.alpha.i-1-H.delta.Pi protons for the three prolines and their preceding amino acid residues. As can be seen in FIGS. 9A and 9C, Pro-6 and Lys-11 form a longer α -helix structure and contain two helical loops; the N-terminus of TxIE, from Cys-2 to Ser-4, has a "3, 10-type" short alpha-helix.

TABLE 5 data analysis of the structure of TxIE (SEQ ID NO: 1)

^aAll statistics are given as mean±SD.

^bAccording to MolProbity

Example 7: phase of alpha-conotoxin TxIE (SEQ ID NO: 1) with alpha 3 beta 2, alpha 3 beta4, alpha6beta 2 and alpha6beta 4nAChRs Interaction molecule docking analysis

Reference is made to Sali, a.; blundell, T.L.compatible protein modification by diagnostic interface of specific stresses.J.mol.biol.1993, 234,779-815. and Dutertre, S.; ulens, c.; buttner, R.; fish, a.; van Elk, r.; kendel, y.; hopping, g.; alewood, p.f.; schroeder, c.; nicke, a.; smit, a.b.; sixma, t.k.; lewis, R.J. AChBP-targeted alpha-keto toxin binding orientations with nAChR subtype selection. EMBO J.2007,26,3858-3867. through homologous modeling, an interactive molecular docking model of TxIE with the alpha/beta interface binding sites of 4nAChRs subtypes (alpha 3 beta 2, alpha 3 beta4, alpha6beta 2 and alpha6beta 4) was constructed and perfected using 100ns molecular dynamics simulation. RMSD was used to evaluate the stability of molecular docking mimic structures at 20Within-60 ns, RMSD size fluctuations of TxIE in combination with α 3 and α 6 nAChRs remained

Within the range, the Molprobity score for the four molecular docking models was between 1.44 and 1.68 (Molprobity score)<2.0 indicates a high quality structure).

The interaction of TxIE with the 4 subtypes described above, all occurred in the pocket of the α/β interface binding site, with a similar pattern of 4 ligand-receptor binding interactions (fig. 10A-10H). These molecular docking models are similar to the crystal structure of the complex generated by the mutual combination of alpha-conotoxin and AChBP. The positive binding sites of the constructed molecular docking model were overall negatively charged, but a potential difference was seen outside the binding sites. TxIE blocks α 6 β 2 and α 6 β 4nAChRs, but has no significant activity on α 3 β 2 and α 3 β 4 nAChRs. This suggests that the binding sites for receptors containing the α 3 subunit, including α 3 β 2 and α 3 β 4nAChRs, are incompatible with TxIE due to steric exclusion or strong electrostatic repulsion. In contrast, the 154 th amino acid of the two subunits α 3 and α 6 are different and are occupied by the α 3 negatively charged lys (k) and α 6 negatively charged glu (e) residues, respectively. The different charge at position 154, which helps to change the outer electrostatic potential of the binding site, also affects the electrostatic potential in the vicinity of the charged side chain group of TxIE and Lys (K) -11. Thus, electrostatic repulsion between Lys-11 of TxIE and amino acid 154 of the alpha 3 subunit of the receptor is critical for distinguishing between the alpha 3-containing and alpha6-containing subtypes of nAChRs. The molecular docking model can also explain the reason that the activity of the first amino acid Gly (G1) in TxIE is reduced after being substituted by glutamic acid Glu. G1 is the N-terminal residue of TxIE, located in a negatively charged environment in molecular models (fig. 10A-10H). Thus, the reduced activity of mutant Peptide 5-7(SEQ ID NOs: 5-7) observed by the present inventors is presumably due to the repulsion of negative charges from each other after G1 is substituted with Glu, which is a negative charge.

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate. Various modifications and substitutions of those details may be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

SEQUENCE LISTING

<110> Guangxi university

<120> alpha-conotoxin peptide TxIE, and pharmaceutical composition and use thereof

<130> IDC200092

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> TxIE

<400> 1

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Met Cys

1 5 10 15

<210> 2

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [M15A]TxIE

<400> 2

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Ala Cys

1 5 10 15

<210> 3

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [M15I]TxIE

<400> 3

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Ile Cys

1 5 10 15

<210> 4

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [M15L]TxIE

<400> 4

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Leu Cys

1 5 10 15

<210> 5

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [G1E,M15A]TxIE

<400> 5

Glu Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Ala Cys

1 5 10 15

<210> 6

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [G1E,M15I]TxIE

<400> 6

Glu Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Ile Cys

1 5 10 15

<210> 7

<211> 16

<212> PRT

<213> Artificial Sequence

<220>

<223> [G1E,M15L]TxIE

<400> 7

Glu Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Leu Cys

1 5 10 15

<210> 8

<211> 43

<212> PRT

<213> Artificial Sequence

<220>

<223> TxIE conotoxin propeptide

<400> 8

Val Val Leu Gly Pro Ala Ser Asp Gly Arg Lys Ala Ala Val Ser Asp

1 5 10 15

Leu Ile Thr Leu Thr Ile Lys Gly Cys Cys Ser Asn Pro Pro Cys Ile

20 25 30

Ala Lys Asn Pro His Met Cys Gly Gly Arg Arg

35 40

<210> 9

<211> 17

<212> PRT

<213> Artificial Sequence

<220>

<223> mutant

<400> 9

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Met Cys

1 5 10 15

Gly

<210> 10

<211> 18

<212> PRT

<213> Artificial Sequence

<220>

<223> mutant

<400> 10

Gly Cys Cys Ser Asn Pro Pro Cys Ile Ala Lys Asn Pro His Met Cys

1 5 10 15

Gly Gly

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 11

gtggttctgg gtccagca 18

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 12

gtcgtggttc agagggtc 18

<210> 13

<211> 132

<212> DNA

<213> Artificial Sequence

<220>

<223> TxIE precursor gene

<400> 13

gtggttctgg gtccagcatc tgatggcagg aaagctgcag tgtctgacct gatcactctg 60

accatcaagg gatgctgttc taatcctccc tgtatcgcga agaatccaca catgtgtggt 120

ggaagacgct ga 132

Claims

1. An isolated polypeptide, which is a polypeptide with an amino acid sequence shown as SEQ ID NO. 1 or a mutant thereof;

wherein the amino acid sequence of the mutant is that the 1 st glycine in the sequence shown by SEQ ID NO. 1 is replaced by glutamic acid or aspartic acid; and/or the methionine at position 15 in the sequence shown in SEQ ID NO. 1 is replaced by alanine, leucine or isoleucine;

2. The polypeptide of claim 1, wherein the amino acid sequence is one or two additional glycines to the C-terminal of any one of SEQ ID NOs: 1-7.

3. The polypeptide of any one of claims 1-2, wherein:

preferably, the carboxy terminus of the polypeptide is amidated.

4. An isolated fusion protein comprising at least one polypeptide of any one of claims 1-3.

5. An isolated polynucleotide encoding the polypeptide of any one of claims 1to 3.

6. A nucleic acid construct comprising the polynucleotide of claim 5; preferably, the nucleic acid construct is a recombinant vector; preferably, the nucleic acid construct is a recombinant expression vector.

7. A transformed cell comprising the polynucleotide of claim 5, or the nucleic acid construct of claim 6.

8. A pharmaceutical composition comprising at least one polypeptide according to any one of claims 1to 3; optionally, it further comprises one or more pharmaceutically acceptable excipients.

9. Use of a polypeptide according to any one of claims 1to3 for the manufacture of a medicament for blocking α 6 acetylcholine receptors; preferably, the α 6 acetylcholine receptor is an α 6/α 3 β 2 β 3 acetylcholine receptor or an α 6/α 3 β 4 acetylcholine receptor.

10. Use of a polypeptide according to any one of claims 1to3 for the preparation of a medicament for the treatment and/or prevention of neurological diseases, or for the preparation of an analgesic, smoking cessation or detoxification medicament;

11. A method of blocking α 6 acetylcholine receptors or modulating α 6 acetylcholine levels in vivo or in vitro comprising the step of administering to a subject or applying to a cell an effective amount of the polypeptide of any of claims 1to 3; preferably, the α 6 acetylcholine receptor is an α 6/α 3 β 2 β 3 acetylcholine receptor or an α 6/α 3 β 4 acetylcholine receptor.