CN108866030A

CN108866030A - Triterpenoids synthase TwOSC1 and its encoding gene and application

Info

Publication number: CN108866030A
Application number: CN201810896550.4A
Authority: CN
Inventors: 高伟; 周家伟; 胡添源
Original assignee: Capital Medical University
Current assignee: Capital Medical University
Priority date: 2018-08-08
Filing date: 2018-08-08
Publication date: 2018-11-23
Anticipated expiration: 2038-08-08
Also published as: WO2020029564A1; CN108866030B

Abstract

The present invention relates to a kind of triterpenoids synthase TwOSC1 albumen and its encoding genes, by the cDNA clone of Twosc1 gene to carrier for expression of eukaryon pYES2, building has the recombinant expression carrier of Twosc1 gene, it is transferred to Yeast expression host strain, it can produce to obtain some triterpene compounds, such as suberone, armomadendrin.By mutation research, the result shows that, the amino acid 486 and 502 of Twosc1 gene coding is critical sites, can be improved or reduce the yield of suberone or armomadendrin.Shown by the interference experiment that particle gun mediates, the interference of Twosc1 gene has apparent inhibiting effect for the synthesis of Celastrol in tripterygium wilfordii, pass through further experiment, the overexpression experiment mediated using particle gun shows that the yield of Celastrol in thunder god vine suspending cell can be improved in the overexpression of Twosc1 gene.TwOSC1 albumen and its encoding gene of the present invention can be used for biosynthesis plant triterpene class compound, and cultivate the tripterygium wilfordii of high-quality.

Description

Triterpenoids synthase TwOSC1 and its encoding gene and application

Technical field

The present invention relates to a kind of triterpenoids synthase and its encoding genes and three diterpene synthase and its encoding gene to exist Utilization in triterpene compound biosynthesis belongs to Gene Engineering of Medicinal Plants field.

Background technique

Chinese herb triperygium wilfordii derives from the drying of medicinal plant tripterygium wilfordii (Tripterygium wilfordii.Hook.f.) The xylem of root, be widely used in rheumatoid arthritis and inflammation treatment (Raphaela G M, Mildred W, Roy F, et al.Comparison of Tripterygium wilfordii Hook F Versus Sulfasalazine in the Treatment of Rheumatoid Arthritis:A Randomized Trial[J].Annals of Internal Medicine,2009,151(4):229-240.Tao X L,Lipsky P E.The Chinese anti-inflammatory and immunosuppressive herbal remedy Tripterygium wilfordii Hook F.[J] .Rheumatic Disease Clinics of North America,2000,26(1):29–50.).Ter penoids are Thunder God The main active of rattan, including triptolide (triptolide), triptophenolide (triptophenolide) and tripterygium wilfordii Red pigment (celastrol) etc..It is a kind of very promising mode from the active constituent developing new drug in Chinese medicine, however due to plant Slow growth, along with content of these effective components in plant is few, thus greatly limit its development.Pass through Biosynthesis pathway and its regulatory mechanism of the ter penoids in tripterygium wilfordii are sought and illustrated, the formation for medical material quanlity is facilitated It provides fundamental basis, while to be brought using biotechnology raising target component content or direct production effective component or intermediate Wide application space.

There is anti-inflammatory, antirheumatic using the Celastrol of friedelane type as the triterpene compound of representative in tripterygium wilfordii, resist Tumour, weight-reducing, immunosupress, treatment neurogenic disease isoreactivity (Liu J, Lee J, Salazarhernandez M A, et al.Treatment of Obesity with Celastrol[J].Cell,2015,161(5):999–1011.).Pass through born of the same parents The 2-methyl-D-erythritol-4- of mevalonate pathway (mevalonic acid (MVA) pathway) and plastid of slurry Universal substrate isopentenylpyrophosphate (the Isopentenyl pyrophosphate of phosphate (MEP) approach generation terpene And its isomers Dimethylallyl pyrophosphate (DMAPP) (IPP)).Thus generate monoterpene respectively again (monoterpenes), sequiterpene (sesquiterpenes), the bottom of diterpene (diterpenes) and triterpene (triterpenes) Object geranyl pyrophosphate (Geranyl diphosphate (GPP)), farnesyl pyrophosphate (farnesyl diphosphate And Mang ox base Mang ox base pyrophosphoric acid (geranylgeranyl diphosphate (GGPP)) (FPP)).

Three diterpene synthases (Triterpene synthase), also known as triterpene cyclase (Triterpene cyclase) or 2, 3- squalene oxide cyclase (2,3-oxidosqualene cyclase, OSC), it is considered to be synthesis triterpenes secondary metabolism is whole The key enzyme of product, it can be catalyzed 2,3- oxidosqualene and form triterpene skeleton.The present invention is cloned from thunder god vine suspending cell A Twosc1 gene is obtained, by verifying its biology that there is catalysis 2.3- oxidosqualene to generate beta-amyrin and suberone Function, and β armomadendrin and suberone are respectively oleanane type triterpene (glycyrrhizic acid, ginsenoside etc.) and cork alkane type triterpenoid The mother nucleus structure of (Celastrol, flat modeling rattan element etc.), β armomadendrin and suberone turn by modification enzyme such as P450 gene, glycosyl Moving the isogenic modification of enzyme can be generated the triterpenes that glycyrrhizic acid, ginsenoside and Celastrol etc. have significant pharmacological activity Compound.The gene is the key gene that the triterpenes components obtained in the tripterygium wilfordii synthesize for the first time, is come forth in the present invention Before, there has been no any disclosure or triterpenoids synthase gene and its amino acid sequence mentioned in present patent application were reported Column.

Summary of the invention

The present invention provides a kind of isolated albumen, the albumen participates in the biosynthesis of triterpene compound, especially Participate in the biosynthesis of oleanane type triterpene and friedelane type triterpene compound.

In the present invention, the isolated albumen is a kind of synthesis for participating in triterpenoids class compound, especially Thunder God The key enzyme of rattan red pigment synthesis, is named as triterpenoids synthase (Tripterygium wilfordii herein Triterpene synthase, TwOSC1), the triterpenoids synthase has：

(1)SEQ ID NO：Amino acid sequence shown in 2；Or

(2)SEQ ID NO：Amino acid sequence shown in 2 is substituted, lacks or increases one or more amino acid and function Identical peptide.

In the present invention, TwOSC1 albumen or polypeptide refer to：With three terpene synthase activities (participate in oleanane type triterpene and The biosynthesis of friedelane type triterpene compound) SEQ ID NO：The polypeptide of 2 sequences, certainly further include have with it is natural The SEQ ID NO of TwOSC1 identical function：The variant form of 2 sequences.These variant forms include but is not limited to：Several The missing of (usually 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10) amino acid is inserted into and/or is taken Generation, and it is one or several (usually within 20, within preferably 10, more preferably in C-terminal and/or N-terminal addition Within 5) amino acid.For example, in the art, when being substituted with similar nature or similar amino acid, usually will not Change the function of albumen.For another example, albumen will not generally also be changed by adding one or several amino acid in C-terminal and/or N-terminal The function of matter.TwOSC1 albumen or polypeptide further include the active fragment and reactive derivative of TwOSC1, further include that can operate Ground is connected to the derivative of signal peptide, promoter, ribosome bind site or terminator sequence composition.

TwOSC1 protein variant or polypeptide with substantial similar sequence identity be characterized by having one or Multiple amino acid substitutions, missing or insertion.These changes are preferably smaller in nature, i.e., conserved amino acid substitution (being shown in Table 1) and The folding or active other substitutions of polypeptide are not significantly affected；Small missing, the missing of typically one to about 30 amino acid； Amino or c-terminus extend, such as aminoterminal methionine residues, the small joint peptide or affine of no more than about 20-25 residue Label.Present invention accordingly provides comprising with SEQ ID NO：2 at least 70%, preferably at least have 90%, is more preferable 95%, 96%, the polypeptide of 97%, 98%, 99% or more consistent sequence.

1 conserved amino acid of table substitution

It can determine comprising for maintaining the region of structural intergrity key or the amino acid residue in domain.It can determine at this More or less tolerance changes and keeps the specific residue of the entire tertiary structure of molecule in a little regions.The method of analytical sequence structure Include, but are not limited to the comparison with multiple sequences of homoamino acid or nucleotide identity, secondary structure tendency (propensity), second level member figure (binary patterns), complementary accumulation are (complementary packing) and hidden Polar interaction (Barton, Current Opin.Struct.Biol.5:372-376,1995；With Cordes etc., Current Opin.Struct.Biol.6:3-10,1996).Generally, when designing molecular modification or identification specific fragment, By the activity of the molecule of evaluation modification while determining structure.

Amino acid sequence can be carried out in TwOSC1 albumen to change at least to destroy to the necessary height of biological activity Level structure.For example, amino acid residue will be changed when TwOSC1 albumen includes one or more spirals so as not to destroy spiral It is other that geometry and conformational change therein will be such that some key functions (such as combination of molecule partner in connection) weakens Molecular chaperones.The effect that amino acid sequence changes can be predicted for example, by computer simulation disclosed above, or be passed through Crystal structure analysis is measured (see such as Lapthorn etc., Nat.Struct.Biol.2:266-268,1995).This field Well known other technologies are compared the folding for changing albumen and standard molecule (such as native protein), for example, can compare Cysteine distribution situation in variant and standard molecule.Mass spectrum and using reduction and alkylated chemical modification be measurement and two Sulfide linkage is relevant or the cysteine residues of not formed these keys provide method (Bean etc., Anal.Biochem.201:216- 266,1992；Gray, Protein Sci.2:1732-1748,1993；With Patterson etc., Anal.Chem.66:3727- 3732,1994).If being generally acknowledged that the molecule of modification and standard molecule have different cysteine distribution situation, roll over It is folded to be affected.Another received well-known process for being used to measure this point is C. D. spectrum (CD).Measure and compare modification The CD spectrum that molecule and standard molecule generate is conventional (Johnson, Proteins 7:205-214,1990).Crystallography is another One analysis fold and structure well-known process, nuclear magnetic resonance (NMR), digestion peptide mapping and epitope mapping be also analysis fold and Known method (Schaanan etc., Science 257 of structural similarity between proteins and peptides:961-964,1992).

In the present invention, the variant forms of triterpenoids synthase protein include：Homologous sequence, conservative variant, etc. Position variant, induced mutants, can hybridize under high or low high stringency conditions natural mutation with triterpenoids synthase gene The encoded albumen of DNA.

Preferably, the isolated protein variant is by SEQ ID NO：One or more in amino acid sequence shown in 2 A amino acid is mutated as follows：

(1) the 486th Leu is sported into Phe, Arg, Pro, Val or Ile；And/or

(2) the 502nd Thr is sported into Ile, Lys, Glu or Pro.

Still a further object of the present invention provides a kind of polynucleotide sequence for encoding the triterpenoids synthase protein.

The polynucleotide sequence is a kind of gene related with triterpenoids class compound synthesis：That is tripterygium wilfordii Triterpene synthase gene (Twosc1 gene), it is one of following nucleotide sequences：

1) SEQ ID No.1 37-2334 nucleotide sequences in sequence table；Or

2) there are one or several bases with the nucleotide sequence of SEQ ID No.1 37-2334 locator qualification in sequence table Mutation, and encode the DNA sequence dna of identical function protein；Or

3) under high stringency conditions with SEQ ID NO：The nucleotide sequence of 1 nucleotide sequence hybridization shown in 37-2334, The stringent condition is：Hybridize in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1% SDS, is used in combination The solution washes film.

The nucleotide sequence that SEQ ID is No.1 37-2334 encodes 765 amino acid residues, 2332-2334's " tga " is terminator codon.

Triterpenoids synthasee code gene of the present invention refers to：Encode the nucleosides with triterpenoids synthase protein Acid sequence, such as SEQ ID NO：37-2334 nucleotide sequences and its degenerate sequence in 1.The degenerate sequence refers to positioned at SEQ ID NO：In 37-2334 nucleotide of encoder block of 1 sequence, there are one or more codons to be encoded the letter of same amino acid And the rear sequence generated replaced codon.Due to the degeneracy of codon, so with SEQ ID NO：37-2334 in 1 Position nucleotide sequence homology can also encode out SEQ ID NO down to about 70% degenerate sequence：Sequence described in 2.Further include Can under moderate stringency conditions, more preferably under high stringent condition with SEQ ID NO：From 37-2334, nucleotide core in 1 The nucleotide sequence of nucleotide sequence hybridization.Further include and SEQ ID NO：From 37-2334, nucleotide nucleotide sequences in 1 Homology at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% nucleotide sequence.Also Including the SEQ ID NO having with the albumen of natural triterpenoids synthase identical function can be encoded：Open reading frame sequence in 1 The variant form of column.These variant forms include but is not limited to several (usually 1-90, preferably 1-60, more preferably Ground 1-20, most preferably 1-10) nucleotide missing, insertion and/or substitution, and it is several (logical in 5 ' and/or 3 ' end additions Often it is within 60, within preferably 30, to be more preferably within 10, be most preferably within 5) nucleotide.

" rigor " of hybridization reaction can determine readily by those of ordinary skill in the art, and generally according to probe Length, wash temperature and salinity calculate by rule of thumb.In general, the longer higher temperature of probes call to be correctly to anneal, and compared with Short probe needs lower temperature.Hybridization is often relied on when complementary strand is present in time-varying in the environment lower than its melting temperature The ability that property DNA anneals again.Probe and can expectation degree of homology between hybridization sequences it is higher, workable relative temperature Also higher.As a result, being inferred to higher relative temperature would tend to keep reaction condition more stringent, and lower temperature is also just less Strictly.About the other details of hybridization reaction rigor and explanation, referring to Ausubel et al.,《Current Protocols in Molecular Biology》, Wiley Interscience Publishers, 1995.

" high stringency conditions " or " high high stringency conditions " can identify as follows as defined herein：(1) strong using low ion Degree and high temperature are washed, such as 0.015M sodium chloride/0.0015M sodium citrate/0.1% lauryl sodium sulfate, and 50 DEG C； (2) denaturant is used in hybrid process, such as formamide, such as 50% (v/v) formamide and 0.1% bovine serum albumin/ 0.1%Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer pH 6.5, sodium chloride containing 750mM, 75mM lemon Sour sodium, 42 DEG C；Or (3) are using 50% formamide, 5x SSC (0.75M NaCl, 0.075M sodium citrate), 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x DenhardtShi solution, the salmon sperm dna (50 μ g/ml) of ultrasonication, 0.1% In 42 DEG C of hybridized overnights in the solution of SDS and 10% dextran glucosides, and in 42 DEG C in 0.2x SSC (sodium chloride/lemon Sour sodium) middle washing 10 minutes, high stringency washing in 10 minutes is then carried out in 55 DEG C in the 0.1x SSC containing EDTA.

A further purpose of the present invention is to provide a kind of expression vector, the expression vector includes to encode thunder of the present invention The polynucleotides of public rattan triterpene synthase protein or its mutant, or the nucleosides that can hybridize with the polynucleotides under high stringency conditions Acid sequence, the expression vector also includes promoter and terminator, wherein the promoter and the polynucleotides are operationally Connection, and the polynucleotides are operably connected with the transcription terminator.

In the present invention, various carriers known in the art can be selected, such as commercially available carrier, including plasmid, clay etc..In life When producing triterpenoids synthase polypeptide of the present invention, the nucleotide sequence of triterpenoids synthase gene can be operably connected In expression regulation sequence, to form triterpenoids synthase expression vectors." the operationally downlink connection " is when finger DNA section When indicate these sections according to certain way arrangement so that they can play a role in phase for purpose expected from it, such as Starting, which is transcribed and moved ahead, in promoter reaches terminator by coding section.Also refer to such a situation：That is linear DNA molecule Certain parts can influence same linear DNA molecule other parts activity, for example, if signal peptide DNA is expressed simultaneously as premise The secretion of polypeptide is participated in, then signal peptide (secretion leader sequence) DNA is exactly to be operably connected to be connected to polypeptid DNA；If opened Mover control sequence transcription, then it is to be operably connected to coded sequence；If ribosome bind site, which is placed in, to be made When its position translated, then it is to be operably coupled to coded sequence.Generally, " being operably connected ", it is adjacent to mean, and Secretion leader sequence is then meaned adjacent in reading frame.

It is a further object of the present invention to provide a kind of host cell, the host cell includes coding of the present invention The polynucleotide molecule of TwOSC1 albumen or its variant, or can be hybridized with the polynucleotide molecule under high stringency conditions Nucleic acid molecule, or the expression vector comprising foregoing description of the present invention.The host cell is selected from：Bacterium, prokaryotic cell are (such as Escherichia coli) fungal cell, yeast cells, insect cell, mammalian cell or plant cell, it is preferable that it is yeast cells Or plant cell.

Especially interesting yeast includes saccharomyces cerevisiae, pichia pastoris yeast and Pichia methanolica.With outer Source DNA transformed saccharomyces cerevisiae cell and such as Kawassaki, United States Patent (USP) are disclosed in from the method for wherein preparation and reorganization polypeptide In US4599311, US4931373, US4870008, US5037743, US4845075 etc..Pass through table determined by selected marker Type, usually drug resistance or the growth ability when lacking specific nutrient (such as leucine) select transformed cells.For making The preferred vector system of brewer yeast such as can be pYES2 expression vector.Appropriate promoters and terminator for yeast include coming From those of glycolytic gene (US4599311, US4615974 and US4977092) and alcohol dehydrogenase.For other yeast, packet Include multiform Hansenula anomala, newborn Kluyveromyces yeasts, Kluyveromyces fragilis, pichia pastoris yeast, Pichia The conversion system of Methanolica, Guilliermondii Pichia pastoris and Candida maltosa are also known in the art.

According to conventional methods in the culture medium containing nutrient and other necessary ingredients of growth for selected host cell Middle culture conversion or transfection host cell.A variety of suitable culture mediums, including known culture medium and complicated culture medium, Be it is known in the art, generally comprise carbon source, nitrogen source, essential amino acid, vitamin and mineral.If desired, culture medium is also Ingredient as such as growth factor or serum can be contained.Growth medium is generally for example, by drug screening or lack can be by Required nutrient that expression vector carries or selected marker that cotransfection is into host cell supplement is selected containing external source addition The cell of DNA.By conventional methods, small triangular flask or fermentor jet are such as shaken, sufficient air is provided to liquid culture.

Triterpenoids synthase polynucleotides full length sequence of the invention or its segment usually can with PCR amplification method, again Group method or artificial synthesized method obtain.For PCR amplification method, can disclosed related nucleotide sequence according to the present invention, especially It is that open reading frame sequence carrys out design primer, and with the commercially available library cDNA or presses conventional method well known by persons skilled in the art The library cDNA is prepared as template, expands and obtains related sequence.When sequence is longer, it is often necessary to which PCR expands twice or repeatedly for progress Increase, then the segment that each time amplifies is stitched together by proper order again.Once obtaining related sequence, so that it may use Recombination method obtains related sequence in large quantity.This is usually to be cloned into carrier, then be transferred to cell, then passes through routine side Method isolated related sequence from the host cell after proliferation.In addition, also mutant can be introduced this hair by chemical synthesis In bright protein sequence.Other than being generated with recombination method, solid phase technique is also can be used in the segment of albumen of the present invention, by directly synthesizing Peptide and produced (Stewart etc., Solid-Phase Pedtide Synthesis, J.Am.Chem.Soc.85:2149- 2154,1963).Synthetic proteins matter can carry out by hand or automatically in vitro.For example, Applied Biosystems can be used 431A type peptide synthesizer (Foster City, CA) be automatically synthesized peptide.Each of chemical synthesis albumen of the present invention can be distinguished Section, is then chemically connected to generate the molecule of overall length.

In the present invention, term " triterpenoids synthase gene " or " Twosc1 gene " are used interchangeably；Term " tripterygium wilfordii Three diterpene synthases ", " three diterpene synthases ", " triterpenoids synthase protein ", " TwOSC1 " or " TwOSC1 albumen " are used interchangeably.Art Language " nucleic acid molecule " or " nucleotide sequence " are used interchangeably.

Term " separation " or " purifying ", polypeptide or protein refers under conditions of its non-natural surroundings, such as from It opens blood or organizes existing polypeptide or protein.In a preferred form, more peptide or proteins of separation are essentially free of other Other more peptide or proteins of more peptide or proteins, especially animal origin or plant origin.Preferably provide high purity form, i.e., it is pure Degree is greater than the polypeptide that 95%, more preferable purity is greater than 99%；" separation " or " purifying " DNA refers to, the DNA or segment from Separated in the sequence of its two sides under native state, or refer to the DNA or segment under native state with nucleic acid Component separate, and separated with cell with its protein.

Triterpenoids synthase protein and triterpenoids synthase gene provided by the invention are for the first time from tripterygium wilfordii gram Grand preparation, directly participate in the biosynthesis of triterpene compound, typically compound such as beta-amyrin and suberone.Due to Beta-amyrin is the mother nucleus structure of oleanane type triterpene class compound, and suberone is friedelane type triterpene compound (thunder Celastrol) front body structure, therefore containing for suberone in plant or beta-amyrin can be improved by technique for gene engineering The content of Celastrol, particle gun in amount or oleanane type or friedelane type triterpene compound such as tripterygium wilfordii plant The Twosc1 gene overexpression of mediation or interference the results show that triterpenoids synthase gene for Celastrol in tripterygium wilfordii Synthesis have apparent facilitation, be transferred to the gene containing Twosc1 over-express vector or interference carrier suspension cell comparison turn Enter unloaded suspension cell Twosc1 gene expression amount and significantly rises (overexpression) or decline (interference), corresponding trypterygine Cellulose content significantly improves (overexpression) or decline (interference).Twosc1 gene can be used for improving tripterygium wilfordii using transgenic technology In the research and industrialization of lycopene content, it is used especially for the quality-improving of Chinese herb triperygium wilfordii, it is deficient for alleviating tripterygium wilfordii medicine source Weary problem has preferable facilitation, can be used for tripterygium wilfordii breeding.

In one embodiment of the invention, triterpenoids synthase or triterpenoids synthase of the present invention are provided Utilization of the gene in synthesis triterpene compound, the triterpene compound such as can be suberone, beta-amyrin, Thunder God Rattan red pigment etc..

In one embodiment of the invention, provide a kind of by using triterpenoids synthase of the present invention or thunder Public rattan triterpene synthase gene adjusts and the method for production plant triterpene class compound, the triterpene compound such as suberone, β- Armomadendrin or Celastrol.Include with the method that TwOSCl albumen or Twosc1 gene obtain plant triterpene constituents：(1) The culture of thunder god vine suspending cell；(2) thunder god vine suspending cell RNA is extracted；(3) thunder god vine suspending cell transcript profile is sequenced；(4) Twoscl full length gene cDNA is obtained；(5) plasmid and strain construction；(6) recombinant；(7) engineering bacterium expression product extracts And separation.

Detailed description of the invention

The tissue expression of Fig. 1 Twosc1 gene (three biology of each sample repeat, and three technologies repeat).

Fig. 2 Twosc1 gene tunning GC-MS result figure (standard items peak 1 is cupreol, and 2 be beta-amyrin, 3 It is suberone for lupeol, 4).

(standard items peak 1 is cupreol to 486 mutation result product GC-MS detection figures of Fig. 3 TwOSC1 albumen, and 2 be β-perfume Tree element, 3 be lupeol, and 4 be suberone).

(standard items peak 1 is cupreol to 502 mutation result product GC-MS detection figures of Fig. 4 TwOSC1 albumen, and 2 be β-perfume Tree element, 3 be lupeol, and 4 be suberone).

The product assay measurement result of Fig. 5 Twosc1 and its mutant.

(CK is to be transferred to unloaded suspension to the content of the interference of Fig. 6 thunder god vine suspending cell Twosc1 gene and Celastrol Cell, Ri are to be transferred to the thunder god vine suspending cell with Twosc1 gene interference carrier).

(CK is to be transferred to unloaded hang to the content of Fig. 7 thunder god vine suspending cell Twosc1 gene overexpression and Celastrol Floating cell, Oe is to be transferred to the thunder god vine suspending cell with Twosc1 gene overexpression carrier).

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Quantitative test in following embodiments, is respectively provided with three repeated experiments, and results are averaged.

Tripterygium wilfordii (Tripterygium wilfordii Hook.f.) suspension cell in following embodiments is in document " thunder The full-length clone and expression analysis Chinese medicine of public rattan 4- (5 '-cytidine diphosphate (CDP)) -2-C- methyl D-erythrite kinase gene Magazine, 2015,40 (21):It is disclosed in 4165-4170 ", the public can be real from Capital University of Medical Sciences's molecule crude drug and natural resources of Chinese medicinal materials Test room acquisition.

PEASY-Blunt Simple Cloning Kit and Fast Mutagenesis System in following embodiments It is the product of Beijing Quanshijin Biotechnology Co., Ltd；

Phusion High-Fidelity PCR Master Mix with HF Buffer and various endonucleases are equal Purchased from New England Biolabs company；

SMARTerTM RACE cDNAAmplification Kit is the product of Takara company；

FastQuant RT Kit kit, the small extraction reagent kit of rapid plasmid are purchased from Tiangeng biochemical technology Co., Ltd.

Beta-amyrin (β-Amyrin) is Mei Lun biotech firm product, and batch number M0505AS, No. CAS is 559-70- 6；

Suberone (Friedelin) is the product of Mei Lun biotech firm, and batch number M0308AS, No. CAS is 559- 74-0；

Lupeol (Lupeol) is Aladdin (aladding) Products, batch number #JI409077, article No. L114079-10mg, No. CAS is 545-47-1；

Cupreol (β-sitosterol) is Aladdin (aladding) Products, batch number #D1605025, Article No. S111183-20mg, No. CAS is 83-46-5.

The clone of embodiment 1, tripterygium wilfordii Twosc1 full length cDNA sequence

1. the acquisition of the first chain of thunder god vine suspending cell Total RNAs extraction and cDNA

Using modified CTAB method (CTAB Buffer:2%CTAB (W/V)；100mmol·L^-1Tris-HCl(pH 8.0)； 25mmol·L^-1EDTA；2.0mol·L^-1NaCl；0.5g·L^-1Spermidine) extract thunder god vine suspending cell total serum IgE.To obtain The total serum IgE obtained is template, utilizes 5 '-CDS in SMARTerTM RACE cDNA Amplification Kit kit Primer carries out reverse transcription respectively and obtains 5 '-RACE-Ready cDNA.

2. design of primers

Screen to obtain full length gene sequence fragment according to tripterygium wilfordii transcript profile data notes, design Twosc1-F and Twosc1-R primer, primer sequence are as follows：

Twosc1-F：CAACAAAAATACATACATATCACCC(SEQ ID NO：3)

Twosc1-R：AGCAAGCAAAATAGTTCTTACCT(SEQ ID NO：4)

3.PCR amplification

The 5 '-RACE-Ready cDNA obtained using step 1 are carried out as template using Twosc1-F and Twosc1-R primer PCR amplification obtains pcr amplification product.

PCR response procedures：98 DEG C of initial denaturation 30s；98 DEG C of 10s, 60 DEG C of 15s, 72 DEG C of 2min, 35 circulations；72 DEG C are prolonged Stretch 5min.

Amplified production recycles (method is as follows) through Gene JET Gel Extraction Kit glue.

Gene JET Gel Extraction Kit glue recycling step：

(1) 6 × loading buffer of PCR product and 9 μ L is taken to be pre-mixed, with low electricity on 1.5% Ago-Gel Press (about 5Vcm-1) electrophoresis 30-60min；

(2) cut the gel containing DNA fragmentation with scalpel or slasher, film is placed on the 1.5mL that weighs in advance from Heart pipe is simultaneously weighed.The weight of recording film.

(3) add 1:Into film, (by weight, such as every 100 milligrams of Ago-Gels add amount the Binding Buffer of 1 amount 100 microlitres of Binding Buffer)；

(4) gel mixture 10min is incubated under conditions of 50-60 DEG C, is during which mixed by inversion 2-3 times, and glue is promoted to melt, Guarantee that glue all dissolves, gel mixture is quickly vortexed mixing once before upper prop；

(5) most 800 μ L gel lysates are shifted to gene recovery purifying column, 13000g is centrifuged 1min, discards efflux, Then column is put back into identical collecting pipe；

(6) 700 μ LWash Buffer (being diluted with ethyl alcohol) are added and arrive Gene JET purification column.13000g is centrifuged 1min, Efflux is discarded, column is then put back into identical collecting pipe；

(7) centrifugation sky GeneJET purification column 13000g is centrifuged 1min, completely removes remaining Wash Buffer；

(8) Gene JET purification column is transferred to a clean 1.5mL centrifuge tube, adds 30-50 μ L ddH2O (can be 60 DEG C Preheating) in purification column film, 13000g is centrifuged 1min；

(9) it loses Gene JET purification column and stores the DNA of purifying at -20 DEG C.

3. carrier connects

The recovery product of 4 μ L is taken, the B-Zero in 1 μ L pEASY-Blunt Simple Cloning Kit reagent is added Premixed liquid after mixing, 25 DEG C in PCR instrument, connects 15min.

4. connection product converts

(1) above-mentioned connection product is all added in the Trans1-T1 competent cell of 50 μ L, 30min is placed in ice；

After (2) 42 DEG C of heat shock 1min, then place 2min in ice；

(3) addition 1mL LB culture medium, 37 DEG C, 180rpm shaken cultivation 1h；

(4) it draws 200 μ L bacterium solutions to be coated on LB+Amp solid medium, 37 DEG C of culture 14h observe bacterium colony growing state.

5, bacterium solution PCR verifies positive bacterium colony

In super-clean bench, with the single bacterium colony in the sterilized white pipette tips picking plate of 10 μ L, it is placed in LB+Amp culture medium In, 37 DEG C, after 250rpm constant-temperature shaking culture about 1-2h, 1 μ L bacterium solution is taken to carry out bacterium solution PCR, testing goal segment whether with load On body effectively connects.

PCR reaction system：

PCR reaction condition：

PCR product is observed in gel imager after the detection of 1% agarose gel electrophoresis.2200bp or so to occur The bacterium solution of target fragment band send sequencing company to be sequenced；

Sequencing result shows：The sequence of pcr amplification product is as shown in sequence 1, by unnamed gene shown in sequence 1 Twosc1, wherein 37-2334 are open reading frame (ORF) from 5 ' end, encode the egg being made of 765 amino acid residues White matter, the albumen are named as TwOSC1, and the amino acid sequence of the albumen is sequence 2.

Embodiment 2, Twosc1 gene organization expression analysis

1. the processing of experimental material

Tripterygium root, stem, leaf, flower are picked up from five different plants of Yongan City, Fujian Province state-owned forest farms.It is clear that sample fetches laboratory It washes, minus 80 refrigerator is stored in after liquid nitrogen flash freezer.

2. extraction and the Real-time quantitative PCR of total serum IgE

The root for being stored in minus 80 refrigerator, stem, leaf, flower are crushed under liquid nitrogen environment, total serum IgE is extracted with modified CTAB method, uses FastQuant RT Kit kit (Tiangeng) reverse transcription is at cDNA, using tripterygium wilfordii EF1 α gene as internal reference.Using ABI Prism 7300Sequence Detection System (Applied Biosystems, USA) and KAPA SYBR FAST Universal 2X qPCR Master Mix (Kapa Biosystems, USA) kit carries out Real-time quantitative PCR. Real time fluorescent quantitative reaction system：2 × Fast qPCR Master Mix 10uL, positive anti-primer (10mmolL-1) are each 0.4uL, cDNA1uL, 50 × Rox High 0.4uL, PCR-grade water 7.8uL.Reaction condition is：95 DEG C of 3min, 95 DEG C 3s, 60 DEG C of 30s, 45 circulations：65~95 DEG C are done solubility curve analysis.After reaction to fluorescent value amplification curve and melting Curve is analyzed.Biology repeats 3, and technology is repeated 3 times, using 2^-△△CT method analyzes result.Primer sequence is as follows：

Twosc1-F:5'-GGTTACCCCCAACAGGAAATC-3'(SEQ ID NO：5)

Twosc1-R:5'-TGGATGGTAACGGAACACGC-3'(SEQ ID NO：6)

EF1α-F:5'-CCAAGGGTGAAAGCAAGGAGAGC-3'(SEQ ID NO：7)

EF1α-R:5'-CACTGGTGGTTTTGAGGCTGGTATCT-3'(SEQ ID NO：8)

As a result as shown in Figure 1.After the homogenization of EF1 α reference gene, Twosc1 gene relative expression levels are highest be Ye Zhong, followed by stem, followed by flower, Twosc1 gene relative expression quantity are minimum in root.Prompt Twosc1 is mainly responsible for Thunder God Suberone synthesis in cane leaves, is then transported to the biosynthesis that Celastrol is carried out in root, this and mechanism reported in the literature It is consistent.

Embodiment 3, the research of tripterygium wilfordii Twosc1 biological function

1. construction of eukaryotic expression vector

Using the carrier pEASY-Blunt-Twosc1 plasmid containing tripterygium wilfordii Twosc1 full length gene cDNA as template, with containing Restriction enzyme site primer (mark horizontal line is restriction enzyme site), carries out PCR amplification gene coding region.Archaeal dna polymerase uses high-fidelity DNA Polymerase (Phusion High-Fidelity PCR Master Mix).PCR parameter is 98 DEG C of 30s, 1 circulation；98 DEG C of 10s, 60 DEG C of 10s, 72 DEG C of 2min 30s, 35 circulations；72℃5min；4 DEG C of maintenances.Amplified production is through Gene JET Gel Extraction Kit glue recycles (method is as follows).

Twosc1-F:CGGGGTACCATGTGGAAGCTCAAAGTT(SEQ ID NO：9)

Twosc1-R:ATTTGCGGCCGCTCAATAGCCTTTGGATG(SEQ ID NO：10)

Gene JET Gel Extraction Kit glue recycling step (with glue recycling step in embodiment 1)：

PCR product after recovered carries out double digestion with restriction enzyme, is oriented using NEB company's T 4DNA ligase It is connected into (method is as follows) in the expression vector pYES2 through identical double digestion.

Double enzyme digestion reaction system (50 μ L system)

Agarose gel electrophoresis after 37 DEG C of reaction 2h, Gene JET Gel Extraction Kit glue recycle target fragment Method is same as above.

Connection reaction (20 μ L system)

* DNA and carrier molar ratio are about 3:1—10:1

25 DEG C of connection 1h, connection product is inverted, (specific steps in embodiment 1 the same as connecting for positive colony preliminary screening Practice midwifery the conversion and single colonie bacterium solution PCR verifying of object), sample presentation sequencing identification obtains being sequenced nucleotide sequence and recombinates without mutation Plasmid pYES2-Twosc1.

2. yeast ferments

The preparation of competent yeast

By at ATCC buy lactosterol synthase defect yeast (4021900^TM) draw and containing Geneticin On the YPD solid medium of 0.2mg/mL, 30 DEG C dark culture two days.Picking single colonie 30 DEG C in 20mL YPD culture medium, 250rpm is cultivated to OD600 up to 0.8-1.0, uses Frozen-EZ Yeast Transformation II^TMKit prepares ferment After female competent cell, the expression vector pYES2-Twosc1 of building is converted.Specific step is as follows：

(1) bacterium solution is centrifuged 4min in refrigerated centrifuge 500g, abandons supernatant.

(2) 10mL EZ 1solution washing thalline is added, 500g is centrifuged 4min, abandons supernatant.

(3) 1mL EZ 2solution is added and thallus is resuspended, every 50uL bacterium solution is dispensed into 1.5mL EP pipe, gradient cooling After be stored in minus 80 DEG C of refrigerators or be directly used in carrier conversion.

(4) it takes the plasmid (less than 5uL) of 0.2-1ug that 50uL competent yeast cells are added, adds 500uL EZ 3solution is mixed completely.

(5) 30 DEG C of incubation 45min.Period is flicked or mediation 2-3 times with finger.

(6) 50uL-150uL Incubating Solution is taken to be coated on Sc-ura yeast screening assay culture medium, 30 DEG C of dark culture 2d.

Fermentation process

For the saccharomycete of zero load conversion as control, picking single bacterium falls within 30 DEG C of 5mL Sc-ura fluid nutrient medium, 250rpm Overnight incubation is verified for bacterium solution PCR.Bacterium containing purpose band is saved as into glycerol stock, and takes 20uL bacterium solution new in 20mL 30 DEG C of Sc-ura fluid nutrient medium, 250rpm cultivates 2d, be changed to Sc-ura induced medium (containing galactolipin), 30 DEG C, 220rpm Fiber differentiation 12h, then with 30 DEG C of the 0.1M potassium phosphate of 20mL (containing glucose, PH7.0), 220rpm cultivates 1d.

3. product GC-MS is detected

Bacterium solution centrifugation after fermentation, takes thallus that 10mL20%KOH/50%EtOH solution ultrasonic extraction 10min is added, respectively Three times with 10mL n-hexane extraction, after extract liquor merges, nitrogen, which is blown, flings to solvent, and 100uL anhydrous pyridine and 100uL trifluoro second is added 65 DEG C of derivatization 60min of amide (containing trimethyl silane).Nitrogen is blown volatilize solvent after, 800uL chloroform redissolve, filter membrane, GC-MS inspection It surveys.GC-MS condition：Sample volume 1uL, 50 DEG C of holdings 1min, 50 DEG C of min^-1Rise to 260 DEG C；1℃·min^-1272 DEG C are risen to, Keep 4min.250 DEG C of injector temperature, 230 DEG C of ion source temperature, electron energy 70ev, 10-550m/z range is carried out to sample Scanning.GC-MS instrument is Agilent Technologies company Agilent 7890B gas chromatograph, chromatography Column is DB-5ms (15m × 250um × 0.1um).

As a result see Fig. 2.Compared with being transferred to unloaded control group yeast extract, it is transferred to the yeast extract of Twosc1 gene In be detected simultaneously by suberone and beta-amyrin, illustrate that the albumen of Twosc1 gene expression can be catalyzed 2,3- oxidosqualene and be formed Beta-amyrin and suberone, wherein suberone is the principal product of Twosc1.

4. rite-directed mutagenesis

In addition to mutational site, two primer lengths about 25-30bp, 5 ' end overlay regions include 15-20bp, 3 ' end extension areas Include at least 10bp；Mutational site is located on two primers, is located at forward mutation assay primer overlay region downstream, close to overlapping Area, rite-directed mutagenesis primer is designed according to the above principle in the end of inverse transition primer 5 ', ' DCTAE ' functional domain upstream second Twosc1CTC (L) is mutated into GTC (V) by (486) at amino acid, ATC (I), TTC (F), CGC (R), CAC (H), CCC (P)； At the 502nd amino acids of Twosc1, amino acid T (ACA) is mutated into I (ATA), K (AAA), E (GAA), P (CCA).Fixed point Mutant primer sequence：

Reaction system

After above-mentioned system mixes, in PCR instrument, initial denaturation 94 DEG C of 5min, 94 DEG C of 20s, 55 DEG C of 20s, 72 DEG C of 3min 30s, 25 circulations, 72 DEG C of extension 10min.1uL DMT enzymic digestion product, 37 DEG C of reaction 1h are added after reaction.4uL digestion is taken to produce 50uL DMT competent cell is added in object, mixes, ice bath 30min, 42 DEG C of water-bath 45s, ice bath 2min, and the LB training of 500uL is added Base is supported, 200rpm, 37 DEG C of culture 1h are coated on 37 DEG C of cultures on LB+AMP culture dish.Positive colony is sent be sequenced successfully after, extract Plasmid.

The mutant plasmid of extraction is transferred in competent yeast cells (in example 3 prepared by step 2), is trained in Sc-ura yeast Base culture is supported, subsequent picking single colonie is fermented and induced, and extracts product, (step is the same as embodiment 3 for GC-MS testing result In 2 and 3).

As a result as shown in Figures 3 and 4.The 486th leucine (L) is mutated respectively on the amino acid sequence of Twosc1 coding At phenylalanine (F), histidine (H), arginine (R), proline (P), product disappears afterwards, illustrates the loss of activity of enzyme；And 486 contents for being mutated into valine (V), isoleucine (I) product 2 (beta-amyrin) afterwards respectively are risen, (the wood of product 4 Bolt ketone) content declined.The 502nd on the amino acid sequence of Twosc1 coding threonine (T) is mutated into respectively different After leucine (I), lysine (K), glutamic acid (E) and proline (P), the variation of product 2 is smaller, and 4 yield of product is varied.Into Product assay is had the mutant strain of variation and Twosc1 wild-type strain to carry out fermenting respectively quantitatively by one step, fermentation step And product extracts detection method and is same as above.Three repetitions of each bacterial strain, product measurement result are shown in Fig. 5.As a result visible T502E, T502I and T502K comparison wild-type strain suberone content is risen, T502P and L486I suberone content is declined, The decline of L486V suberone content is maximum.The changes of contents of 502 site mutation bacterium beta-amyrins is little, L486I and L486V bacterial strain Beta-amyrin content is obviously improved.

Embodiment 4, tripterygium wilfordii Twosc1 gene interfere the influence synthesized to Celastrol

1. thunder god vine suspending cell prepares

Prepare MS solid medium：Murashige&Skoog with Vitamins (Caisson Labs company) 4.43g/L, sucrose (AOBOX company) 30g/L, 2,4-D 1.0mg/L, KT 0.1mg/L adjust PH to 5.8-6.0 after adding water, add Agarose (Oxoid company) 6-8g, pours into 35mm cell culture when temperature drops to 60 DEG C or less after 20min high pressure sterilization by 121 DEG C Solidification in ware (each culture dish 3mL culture medium).

Will the suspension cell of subculture be transferred in the 35mm Tissue Culture Dish that culture medium is added that (each culture dish 0.2g suspends Cell), 25 DEG C, dark culture 6-9d is used for via Particle Bombardment Transformation.

2.gateway technology constructs Twosc1 interference carrier

The building of BP entry vector

Design primer is as follows：

Interfere primer Twosc1-F:CACCCAAGCACTTGTAGCTAGTAATTTAA(SEQ ID NO：31)

Twosc1-R:AATCTCCATCCATTCTCCTG(SEQ ID NO：32)

Using the carrier pEASY-Blunt-Twosc1 plasmid containing tripterygium wilfordii Twosc1 full length gene cDNA as template, with containing Restriction enzyme site primer (mark horizontal line is restriction enzyme site), carries out PCR amplification gene coding region.Archaeal dna polymerase uses high-fidelity DNA Polymerase (Phusion High-Fidelity PCR Master Mix).PCR parameter is 98 DEG C of 30s, 1 circulation；98 DEG C of 10s, 60 DEG C of 10s, 72 DEG C of 2min 30s, 35 circulations；72℃5min；4 DEG C of maintenances.Amplified production is through Gene JET Gel The recycling of Extraction Kit glue.

BP reaction system

Competent escherichia coli cell Trans1-T1 (Beijing Quan Shi King Company) is transferred to after 22 DEG C of reaction 2h to train in LB+Kan Support the culture of 37 DEG C of base, positive colony is sent be sequenced successfully after, the small extraction reagent kit extraction plasmid of rapid plasmid.

LR reaction system

* pK7 is interference carrier

25 DEG C of reaction 3-4h, are added 1uL Proteinase K, and 37 DEG C of incubation 10min are transformed into Trans1-T1 and cultivate in LB+Spe 37 DEG C of base culture, positive colony is sent be sequenced successfully after, mentioned with the big extraction reagent kit of Plasmid Maxi Kit (Omega company) plasmid Take plasmid (plasmid concentration requirement>1ug/uL).

3. Biolistic mediated transformation

Experiment equipment requires sterile：According to equipment property difference or combine using autoclave sterilization, ultraviolet irradiation degerming It is sterilized with 70% ethyl alcohol.

Each plasmid does 5 biology and repeats, that is, makes a call to 5 disk cells, every 2 rifle of disk, totally 10 rifle.PK7 empty carrier will be converted Suspension cell is used as control.By 20ug plasmid, 5000ug bronze, the CaCl of 100uL 2.5M₂, the spermidine of 40uL 0.1M is mixed It closes, shakes 2-3min, about 2s is centrifuged after static 1min, abandon supernatant；70% ethyl alcohol of 140uL is added, supernatant is abandoned in centrifugation after flicking； 140uL100% ethyl alcohol is added, supernatant is abandoned in centrifugation after flicking；100uL100% ethyl alcohol is added, after flicking, shakes 2-3s in low speed, It is placed in ice.

Carrier film after disinfection is placed in iron support, the carrier bronze premixed liquid of the above-mentioned preparation of 10uL is added in each iron support, Iron support is stopped net, can split film and thunder god vine suspending cell is individually positioned in the phase of particle gun equipment by particle gun working specification It answers on position, carries out via Particle Bombardment Transformation carrier.Every disk cell makes two rifles.

4. screening and culturing and gene expression analysis

By the complete cell of via Particle Bombardment Transformation, 25 DEG C, dark culture 2d, being transferred to MS screening and culturing medium is MS+Kan culture medium, is resisted Raw element final concentration Kan is 100mg/ml.After the completion of 20d screening, by the cell subculture after screening in the culture medium of new MS+Kan In continue to cultivate 20d, be transferred in the fluid nutrient medium of MS+Kan, 25 DEG C, after 120rpm cultivated for 3 generations, take a part of thin later For extracting RNA after born of the same parents' liquid nitrogen flash freezer, after remaining cell vacuum freeze drying, 0.2g methanol 1ml ultrasound 2h is taken to extract product, UPLC analyzes product result.

Cell after liquid nitrogen flash freezer crushes under liquid nitrogen environment, is extracted with RNA extracts kit (Promega company) total RNA, with FastQuant RT Kit kit (Tiangeng) reverse transcription at cDNA, using tripterygium wilfordii EF1 α gene as internal reference.Using ABI Prism 7300Sequence Detection System (Applied Biosystems, USA) and KAPA SYBR It is quantitative that FAST Universal 2X qPCR Master Mix (Kapa Biosystems, USA) kit carries out Real-time PCR.Real time fluorescent quantitative reaction system：2 × Fast qPCR Master Mix 10uL, positive anti-primer (10mmolL-1) are each 0.4uL, cDNA1uL, 50 × Rox High 0.4uL, PCR-grade water 7.8uL.Reaction condition is：95 DEG C of 3min, 95 DEG C 3s, 60 DEG C of 30s, 45 circulations：65~95 DEG C are done solubility curve analysis.After reaction to fluorescent value amplification curve and melting Curve is analyzed.Biology repeats 5, and technology is repeated 3 times, using 2^-△△CT method analyzes result.

As a result see Fig. 6.The suspension cell comparison for being transferred to the interference carrier of the segment containing Twosc1 is transferred to unloaded suspension cell Twosc1 gene expression amount is remarkably decreased, and (52.40 μ g/g have dropped than zero load for corresponding trypterygine cellulose content significant decrease 73%).The interference of Twosc1 can lower the synthesis of Celastrol as the result is shown, show that the generation with Celastrol is significant It is related.

The influence that embodiment 5, tripterygium wilfordii Twosc1 gene overexpression synthesize Celastrol

1. thunder god vine suspending cell prepares

2.gateway technology constructs Twosc1 over-express vector

The building of BP entry vector

Design primer is as follows：

It is overexpressed primer Twosc1-F:CACCATGTGGAAGCTCAAAGTT

Twosc1-R:TCAATAGCCTTTGGATG

BP reaction system

Competent escherichia coli cell Trans-T1 (Beijing Quan Shi King Company) is transferred to after 22 DEG C of reaction 2h to train in LB+Kan Support the culture of 37 DEG C of base, positive colony is sent be sequenced successfully after, the small extraction reagent kit extraction plasmid of rapid plasmid.

LR reaction system

* pH7 is over-express vector

25 DEG C of reaction 3-4h, are added 1uL Proteinase K, and 37 DEG C of incubation 10min are transformed into Trans-T1 and cultivate in LB+Spe 37 DEG C of base culture, positive colony is sent be sequenced successfully after, mentioned with the big extraction reagent kit of Plasmid Maxi Kit (Omega company) plasmid Take plasmid (plasmid concentration requirement>1ug/uL).

3. Biolistic mediated transformation

Each plasmid does 5 biology and repeats, that is, makes a call to 5 disk cells, every 2 rifle of disk, totally 10 rifle.PH7 empty carrier will be converted Suspension cell is used as control.By 20ug plasmid, 5000ug bronze, the CaCl of 100uL 2.5M₂, the spermidine of 40uL 0.1M is mixed It closes, shakes 2-3min, about 2s is centrifuged after static 1min, abandon supernatant；70% ethyl alcohol of 140uL is added, supernatant is abandoned in centrifugation after flicking； 140uL100% ethyl alcohol is added, supernatant is abandoned in centrifugation after flicking；100uL100% ethyl alcohol is added, after flicking, shakes 2-3s in low speed, It is placed in ice.

4. screening and culturing and gene expression analysis

By the complete cell of via Particle Bombardment Transformation, 25 DEG C, dark culture 2d, it is transferred to MS screening and culturing medium MS+Hyg, antibiotic is dense eventually Degree is Hyg 2.5mg/ml.After the completion of 20d screening, the cell subculture after screening is continued to train in the culture medium of new MS+Hyg 20d is supported, is transferred in the fluid nutrient medium of MS+Hyg later, 25 DEG C, after 120rpm cultivated for 3 generations, takes a part of cell liquid nitrogen speed For extracting RNA after jelly, after remaining cell vacuum freeze drying, 0.2g methanol 1ml ultrasound 2h is taken to extract product, UPLC analysis produces Object result.

Cell after liquid nitrogen flash freezer crushes under liquid nitrogen environment, is extracted with RNA extracts kit (Promega company) total RNA, with FastQuant RT Kit kit (Tiangeng) reverse transcription at cDNA, using tripterygium wilfordii EF1 α gene as internal reference.Using ABI Prism 7300Sequence Detection System (Applied Biosystems, USA) and KAPASYBR It is quantitative that FAST Universal 2X qPCR Master Mix (Kapa Biosystems, USA) kit carries out Real-time PCR.Real time fluorescent quantitative reaction system：2 × Fast qPCR Master Mix 10uL, positive anti-primer (10mmolL-1) are each 0.4uL, cDNA1uL, 50 × Rox High 0.4uL, PCR-grade water 7.8uL.Reaction condition is：95 DEG C of 3min, 95 DEG C 3s, 60 DEG C of 30s, 45 circulations：65~95 DEG C are done solubility curve analysis.After reaction to fluorescent value amplification curve and melting Curve is analyzed.Biology repeats 5, and technology is repeated 3 times, using 2^-△△CT method analyzes result.

As a result see Fig. 7.The suspension cell comparison for being transferred to the carrier of gene overexpression containing Twosc1 is transferred to unloaded suspension cell Twosc1 gene expression amount significantly rises, and corresponding trypterygine cellulose content is also obviously improved that (175 μ g/g are unloaded 5.4 Times).Being overexpressed Twosc1 gene as the result is shown can be improved the yield of Celastrol, show Twosc1 and Celastrol It generates significantly correlated.

Above description is not limitation of the present invention, and the present invention is also not limited to the example above.The art it is common Within the essential scope of the present invention, the variations, modifications, additions or substitutions made also should belong to protection of the invention to technical staff Range, protection scope of the present invention are subject to claims.

Sequence table

<110>The Capital University of Medical Sciences

<120>Triterpenoids synthase TwOSC1 and its encoding gene and application

<141> 2018-08-08

<160> 32

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2708

<212> DNA

<213>Artificial sequence ()

<400> 1

caacaaaaat acatacatat cacccaaaaa attaatatgt ggaagctcaa agttgctgag 60

cgtggaaatg caccctattc tgaatacttg tacactacaa atgatttctc cggtcgacaa 120

acatgggagt tcgaccccaa cgccggaacc cctcaagagc tcgccaaggt ggaggaggct 180

cgtcgcaagt tcaccgagga tcgccacacc gtcaagcccg cctccgacct cctttggatg 240

atgcagttta tgagggagaa aaatttcaag caaacaattc ctccggtgag acttggagag 300

gaagaacaag ttacatatga agatctgacg accgctctaa cgagaacgac caacttcttc 360

acagctttac aggccagcga cggtcactgg ccggcggaga acggtggcgt ctcgtttttc 420

cttccaccat ttatcttttc cctctacatc actgggcatc tcaattcgat catcactccg 480

gaatatcgaa aagaaatcct acgtttcata tacaatcatc aaaatgaaga tggaggttgg 540

ggaatacaca tagaagggca cagcacaatg tttggtacag catttagcta tgtttgcttg 600

agaatacttg gaatagaagt tgatggaggt aaagacaatg cttgtgctag agcaagaaaa 660

tggatccttg atcatggtgg catcacctac atgccttctt ggggaaaaac ttggctttcg 720

attcttggtg tatatgactg gtacggttgc aacccaatgc ccccagagtt ttggctcctt 780

ccttcttatc ttcctattca tccagcaaaa atttggtgct attgccggat ggtttacatg 840

ccaatgtcat acttatatgg gaaaagattt gttggtccaa tcacacctct cattctacag 900

ttgagagaag aactccacac acaacctttc catgaaatcc aatggagaca gacgcgccac 960

cgatgtgcaa aggaggatct ctactaccca catagtctaa tccaagactt tatttgggac 1020

agtctttacg tggcctctga accactccta actcgctggc ctttaaacaa gatcagagag 1080

aaggctctgg caaaagcaat ggaacacatt cactacgaag acgaaaacag tcgatacata 1140

acaatcggat gtgttgagaa ggcattgtgt atgttatgtt gttgggttga ggatccgaac 1200

agcgattact tcaagaagca tcttgcaaga atcccagatt acttgtgggt tgcagaggat 1260

ggaatgaaag tgcaaagctt tggtagccaa ttgtgggatg ctacatttgg ttttcaagca 1320

cttgtagcta gtaatttaac agaggatgag gtcggtccag ccctcgccaa ggcctatgat 1380

ttcatcaaga aatctcaagt taaggacaat ccctccggcg attttgaaag catgcatcga 1440

cacatctcga agggatcgtg gactttctcc gatcaagacc atggttggca actctctgat 1500

tgcactgctg aagctttgaa gtgttgcctt ctagcagcaa caatgcctca agaagtagtt 1560

ggtgagaaaa tgaaacctga atgggtgtat gaggccatta atatcattct ttcactacag 1620

agcaaaagtg gaggtttggc aggttgggaa ccggtgagag caggagaatg gatggagatt 1680

ctcaatccga tggaattcct cgagaacatt gtgatcgaac acacctacgt ggagtgcacc 1740

ggatcatcga tcattgcatt cgtttcgctg aagaagttat atccagggca caggacaaaa 1800

gacattgaca atttcattag aaatgccata aggtatcttg aagatgtgca atacccggat 1860

ggttcctggt acgggaactg ggggatttgc ttcatctata gtacaatgtt tgcgctggga 1920

ggactagcag cgaccggtag gacttacgac aactgccagg ccgtgcgtag aggcgtggat 1980

tttatactaa agaatcagag tgatgatggt ggatggggag aaagctacct ctcttgccca 2040

agaaaggtgt acacacctct tgatgggagg agatctaatg tggtgcaaac tgcttgggct 2100

atgttgggtc tactttatgc tggccaggct gagagagatc ctactcctct tcaccgcggg 2160

gcgaaagtat tgatcaatta ccaaatggaa gatggtggtt acccccaaca ggaaatcact 2220

ggagttttca agatgaattg catgttacac tatccgatct accggaatgc ttttccgata 2280

tgggcgctcg gagaatacag gaagcgtgtt ccgttaccat ccaaaggcta ttgaaatcca 2340

gaatccctga agaaagtgaa tgcagaagag caaagttcat tgcatataca ttctataaca 2400

atattgaaaa taatgtattg catgatgacg caacattcaa agagtctaaa acgcctctga 2460

taaattatag ctcctaaaag aaggaacaag aatgagagta aatctcgttt gataattttt 2520

atttcatact ttcgaaataa tactagctgg cttatatata tagccttcac tctagcaaga 2580

tgctactagt taggaaatca aatacttgaa ggaattcata tgtaattata gtaccctaat 2640

tacaaagcta tttttttatt ggaaagaact attctgctaa ttaataggta agaactattt 2700

tgcttgct 2708

<210> 2

<211> 765

<212> PRT

<213>Artificial sequence ()

<400> 2

Met Trp Lys Leu Lys Val Ala Glu Arg Gly Asn Ala Pro Tyr Ser Glu

1 5 10 15

Tyr Leu Tyr Thr Thr Asn Asp Phe Ser Gly Arg Gln Thr Trp Glu Phe

20 25 30

Asp Pro Asn Ala Gly Thr Pro Gln Glu Leu Ala Lys Val Glu Glu Ala

35 40 45

Arg Arg Lys Phe Thr Glu Asp Arg His Thr Val Lys Pro Ala Ser Asp

50 55 60

Leu Leu Trp Met Met Gln Phe Met Arg Glu Lys Asn Phe Lys Gln Thr

65 70 75 80

Ile Pro Pro Val Arg Leu Gly Glu Glu Glu Gln Val Thr Tyr Glu Asp

85 90 95

Leu Thr Thr Ala Leu Thr Arg Thr Thr Asn Phe Phe Thr Ala Leu Gln

100 105 110

Ala Ser Asp Gly His Trp Pro Ala Glu Asn Gly Gly Val Ser Phe Phe

115 120 125

Leu Pro Pro Phe Ile Phe Ser Leu Tyr Ile Thr Gly His Leu Asn Ser

130 135 140

Ile Ile Thr Pro Glu Tyr Arg Lys Glu Ile Leu Arg Phe Ile Tyr Asn

145 150 155 160

His Gln Asn Glu Asp Gly Gly Trp Gly Ile His Ile Glu Gly His Ser

165 170 175

Thr Met Phe Gly Thr Ala Phe Ser Tyr Val Cys Leu Arg Ile Leu Gly

180 185 190

Ile Glu Val Asp Gly Gly Lys Asp Asn Ala Cys Ala Arg Ala Arg Lys

195 200 205

Trp Ile Leu Asp His Gly Gly Ile Thr Tyr Met Pro Ser Trp Gly Lys

210 215 220

Thr Trp Leu Ser Ile Leu Gly Val Tyr Asp Trp Tyr Gly Cys Asn Pro

225 230 235 240

Met Pro Pro Glu Phe Trp Leu Leu Pro Ser Tyr Leu Pro Ile His Pro

245 250 255

Ala Lys Ile Trp Cys Tyr Cys Arg Met Val Tyr Met Pro Met Ser Tyr

260 265 270

Leu Tyr Gly Lys Arg Phe Val Gly Pro Ile Thr Pro Leu Ile Leu Gln

275 280 285

Leu Arg Glu Glu Leu His Thr Gln Pro Phe His Glu Ile Gln Trp Arg

290 295 300

Gln Thr Arg His Arg Cys Ala Lys Glu Asp Leu Tyr Tyr Pro His Ser

305 310 315 320

Leu Ile Gln Asp Phe Ile Trp Asp Ser Leu Tyr Val Ala Ser Glu Pro

325 330 335

Leu Leu Thr Arg Trp Pro Leu Asn Lys Ile Arg Glu Lys Ala Leu Ala

340 345 350

Lys Ala Met Glu His Ile His Tyr Glu Asp Glu Asn Ser Arg Tyr Ile

355 360 365

Thr Ile Gly Cys Val Glu Lys Ala Leu Cys Met Leu Cys Cys Trp Val

370 375 380

Glu Asp Pro Asn Ser Asp Tyr Phe Lys Lys His Leu Ala Arg Ile Pro

385 390 395 400

Asp Tyr Leu Trp Val Ala Glu Asp Gly Met Lys Val Gln Ser Phe Gly

405 410 415

Ser Gln Leu Trp Asp Ala Thr Phe Gly Phe Gln Ala Leu Val Ala Ser

420 425 430

Asn Leu Thr Glu Asp Glu Val Gly Pro Ala Leu Ala Lys Ala Tyr Asp

435 440 445

Phe Ile Lys Lys Ser Gln Val Lys Asp Asn Pro Ser Gly Asp Phe Glu

450 455 460

Ser Met His Arg His Ile Ser Lys Gly Ser Trp Thr Phe Ser Asp Gln

465 470 475 480

Asp His Gly Trp Gln Leu Ser Asp Cys Thr Ala Glu Ala Leu Lys Cys

485 490 495

Cys Leu Leu Ala Ala Thr Met Pro Gln Glu Val Val Gly Glu Lys Met

500 505 510

Lys Pro Glu Trp Val Tyr Glu Ala Ile Asn Ile Ile Leu Ser Leu Gln

515 520 525

Ser Lys Ser Gly Gly Leu Ala Gly Trp Glu Pro Val Arg Ala Gly Glu

530 535 540

Trp Met Glu Ile Leu Asn Pro Met Glu Phe Leu Glu Asn Ile Val Ile

545 550 555 560

Glu His Thr Tyr Val Glu Cys Thr Gly Ser Ser Ile Ile Ala Phe Val

565 570 575

Ser Leu Lys Lys Leu Tyr Pro Gly His Arg Thr Lys Asp Ile Asp Asn

580 585 590

Phe Ile Arg Asn Ala Ile Arg Tyr Leu Glu Asp Val Gln Tyr Pro Asp

595 600 605

Gly Ser Trp Tyr Gly Asn Trp Gly Ile Cys Phe Ile Tyr Ser Thr Met

610 615 620

Phe Ala Leu Gly Gly Leu Ala Ala Thr Gly Arg Thr Tyr Asp Asn Cys

625 630 635 640

Gln Ala Val Arg Arg Gly Val Asp Phe Ile Leu Lys Asn Gln Ser Asp

645 650 655

Asp Gly Gly Trp Gly Glu Ser Tyr Leu Ser Cys Pro Arg Lys Val Tyr

660 665 670

Thr Pro Leu Asp Gly Arg Arg Ser Asn Val Val Gln Thr Ala Trp Ala

675 680 685

Met Leu Gly Leu Leu Tyr Ala Gly Gln Ala Glu Arg Asp Pro Thr Pro

690 695 700

Leu His Arg Gly Ala Lys Val Leu Ile Asn Tyr Gln Met Glu Asp Gly

705 710 715 720

Gly Tyr Pro Gln Gln Glu Ile Thr Gly Val Phe Lys Met Asn Cys Met

725 730 735

Leu His Tyr Pro Ile Tyr Arg Asn Ala Phe Pro Ile Trp Ala Leu Gly

740 745 750

Glu Tyr Arg Lys Arg Val Pro Leu Pro Ser Lys Gly Tyr

755 760 765

<210> 3

<211> 25

<212> DNA

<213>Artificial sequence ()

<400> 3

caacaaaaat acatacatat caccc 25

<210> 4

<211> 23

<212> DNA

<213>Artificial sequence ()

<400> 4

agcaagcaaa atagttctta cct 23

<210> 5

<211> 21

<212> DNA

<213>Artificial sequence ()

<400> 5

ggttaccccc aacaggaaat c 21

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 6

tggatggtaa cggaacacgc 20

<210> 7

<211> 23

<212> DNA

<213>Artificial sequence ()

<400> 7

ccaagggtga aagcaaggag agc 23

<210> 8

<211> 26

<212> DNA

<213>Artificial sequence ()

<400> 8

cactggtggt tttgaggctg gtatct 26

<210> 9

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 9

cggggtacca tgtggaagct caaagtt 27

<210> 10

<211> 29

<212> DNA

<213>Artificial sequence ()

<400> 10

atttgcggcc gctcaatagc ctttggatg 29

<210> 11

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 11

agaccatggt tggcaagtct ctgattg 27

<210> 12

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 12

cttgccaacc atggtcttga tcggaga 27

<210> 13

<211> 26

<212> DNA

<213>Artificial sequence ()

<400> 13

agaccatggt tggcaaatct ctgatt 26

<210> 14

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 14

tttgccaacc atggtcttga tcggaga 27

<210> 15

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 15

agaccatggt tggcaattct ctgattg 27

<210> 16

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 16

attgccaacc atggtcttga tcggaga 27

<210> 17

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 17

agaccatggt tggcaacgct ctgattgc 28

<210> 18

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 18

cgttgccaac catggtcttg atcggaga 28

<210> 19

<211> 28

<212> DNA

<213>Artificial sequence a ()

<400> 19

agaccatggt tggcaacact ctgattgc 28

<210> 20

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 20

tgttgccaac catggtcttg atcggaga 28

<210> 21

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 21

agaccatggt tggcaaccct ctgattgc 28

<210> 22

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 22

ggttgccaac catggtcttg atcggaga 28

<210> 23

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 23

tgccttctag cagcaataat gcctcaag 28

<210> 24

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 24

attgctgcta gaaggcaaca cttcaaag 28

<210> 25

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 25

tgccttctag cagcaaaaat gcctcaag 28

<210> 26

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 26

tttgctgcta gaaggcaaca cttcaaag 28

<210> 27

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 27

tgccttctag cagcagaaat gcctcaag 28

<210> 28

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 28

tctgctgcta gaaggcaaca cttcaaag 28

<210> 29

<211> 28

<212> DNA

<213>Artificial sequence ()

<400> 29

tgccttctag cagcaccaat gcctcaag 28

<210> 30

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 30

gtgctgctag aaggcaacac ttcaaag 27

<210> 31

<211> 29

<212> DNA

<213>Artificial sequence ()

<400> 31

cacccaagca cttgtagcta gtaatttaa 29

<210> 32

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 32

aatctccatc cattctcctg 20

Claims

1. isolated albumen, the albumen are

(1)SEQ ID NO：Amino acid sequence shown in 2；Or

(2)SEQ ID NO：Amino acid sequence shown in 2 is substituted, lacks or increases one or more amino acid and function is identical Polypeptide.

2. albumen according to claim 1, wherein the albumen is by SEQ ID NO：One in amino acid sequence shown in 2 A or multiple amino acid are mutated：

(1) the 486th Leu is sported into Phe, Arg, Pro, Val or Ile；And/or

(2) the 502nd Thr is sported into Ile, Lys, Glu or Pro.

3. encoding the polynucleotides of albumen as claimed in claim 1 or 2.

4. polynucleotides according to claim 3, the polynucleotides are at least one of following：

(1)SEQ ID NO：1 nucleic acid molecule shown in 37-2334；Or

(2)SEQ ID NO：1 nucleic acid molecule shown in 37-2334 is substituted, lacks or increases one or more nucleosides Acid and the nucleotide sequence for expressing identical function albumen；Or

(3) under high stringency conditions with SEQ ID NO：The nucleotide sequence of 1 hybridization of nucleic acid molecule shown in 37-2334, institute Stating high stringency conditions is：Hybridize in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1% SDS.

5. expression vector, it includes polynucleotides shown in promoter, claim 3 or 4 and transcription terminators, wherein the starting It is sub to be operably connected with the polynucleotides, and the polynucleotides are operably connected with the transcription terminator.

6. recombinant host cell, it includes express to carry described in the polynucleotide molecule of claim 3 or 4 or claim 5 Body, the cell are selected from：Bacterium, yeast cells, fungal cell, insect cell, mammalian cell and plant cell.

7. cell described in claim 6, wherein the plant cell is tripterygium wilfordii cell.

8. albumen as claimed in claim 1 or 2 or the polynucleotide molecule of claim 3 or 4 are adjusting and are producing plant triterpene Utilization in class compound.

9. utilization according to any one of claims 8, wherein the triterpene compound is suberone, beta-amyrin or Celastrol.

10. albumen as claimed in claim 1 or 2 or the polynucleotide molecule of claim 3 or 4 are in tripterygium wilfordii plant breeding Utilization.