CN108866029B - Triterpenoids synthase TwOSC3 and its encoding gene and application - Google Patents

Abstract

The present invention relates to a kind of triterpenoids synthase TwOSC3 albumen and its encoding genes, by the cDNA clone of Twosc3 gene to carrier for expression of eukaryon pYES2, building has the recombinant expression carrier of Twosc3 gene, is transferred to Yeast expression host strain, can produce to obtain suberone.By mutation research, the result shows that, the amino acid 482 of Twosc3 gene coding is critical sites, can be improved or reduce the yield of suberone or armomadendrin.Shown by the interference experiment that particle gun mediates, the interference of Twosc3 gene has apparent inhibiting effect for the synthesis of Celastrol in tripterygium wilfordii, TwOSC3 albumen and its encoding gene of the present invention can be used for biosynthesis plant triterpene class compound, and cultivate the tripterygium wilfordii of high-quality.

Description

Triterpenoids synthase TwOSC3 and its encoding gene and application

Technical field

The present invention relates to a kind of triterpenoids synthase and its encoding genes and three diterpene synthase and its encoding gene to exist Utilization in triterpene compound biosynthesis belongs to Gene Engineering of Medicinal Plants field.

Background technique

Chinese herb triperygium wilfordii derives from the drying of medicinal plant tripterygium wilfordii (Tripterygium wilfordii.Hook.f.) The xylem of root, be widely used in rheumatoid arthritis and inflammation treatment (Raphaela G M, Mildred W, Roy F, et al.Comparison of Tripterygium wilfordii Hook F Versus Sulfasalazine in the Treatment of Rheumatoid Arthritis:A Randomized Trial[J].Annals of Internal Medicine,2009,151(4):229-240.Tao X L,Lipsky P E.The Chinese anti-inflammatory and immunosuppressive herbal remedy Tripterygium wilfordii Hook F.[J] .Rheumatic Disease Clinics of North America,2000,26(1):29–50.).Ter penoids are Thunder God The main active of rattan, including triptolide (triptolide), triptophenolide (triptophenolide) and tripterygium wilfordii Red pigment (celastrol) etc..It is a kind of very promising mode from the active constituent developing new drug in Chinese medicine, however due to plant Slow growth, along with content of these effective components in plant is few, thus greatly limit its development.Pass through Biosynthesis pathway and its regulatory mechanism of the ter penoids in tripterygium wilfordii are sought and illustrated, the formation for medical material quanlity is facilitated It provides fundamental basis, while to be brought using biotechnology raising target component content or direct production effective component or intermediate Wide application space.

There is anti-inflammatory, antirheumatic using the Celastrol of friedelane type as the triterpene compound of representative in tripterygium wilfordii, resist Tumour, weight-reducing, immunosupress, treatment neurogenic disease isoreactivity (Liu J, Lee J, Salazarhernandez M A, et al.Treatment of Obesity with Celastrol[J].Cell,2015,161(5):999–1011.).Pass through born of the same parents The 2-methyl-D-erythritol-4- of mevalonate pathway (mevalonic acid (MVA) pathway) and plastid of slurry Universal substrate isopentenylpyrophosphate (the Isopentenyl pyrophosphate of phosphate (MEP) approach generation terpene And its isomers Dimethylallyl pyrophosphate (DMAPP) (IPP)).Thus generate monoterpene respectively again (monoterpenes), sequiterpene (sesquiterpenes), the bottom of diterpene (diterpenes) and triterpene (triterpenes) Object geranyl pyrophosphate (Geranyl diphosphate (GPP)), farnesyl pyrophosphate (farnesyl diphosphate And Mang ox base Mang ox base pyrophosphoric acid (geranylgeranyl diphosphate (GGPP)) (FPP)).

Three diterpene synthases (Triterpene synthase), also known as triterpene cyclase (Triterpene cyclase) or 2, 3- squalene oxide cyclase (2,3-oxidosqualene cyclase, OSC), it is considered to be synthesis triterpenes secondary metabolism is whole The key enzyme of product, it can be catalyzed 2,3- oxidosqualene and form triterpene skeleton.The present invention is cloned from thunder god vine suspending cell A Twosc3 gene is obtained, by verifying its biological function that there is catalysis 2.3- oxidosqualene to generate suberone, and it is wooden Bolt ketone is the mother nucleus structure of cork alkane type triterpenoid (Celastrol, flat modeling rattan element etc.), and suberone is by modification enzyme such as P450 etc. The triterpene compound that Celastrol etc. has significant pharmacological activity can be generated in the modification of gene.The gene is for the first time from thunder The key gene of the synthesis of triterpenes components obtained in public rattan, before the present invention comes forth, there has been no any disclosure or reports Triterpenoids synthase gene and its amino acid sequence mentioned in present patent application are crossed in road.

Summary of the invention

The present invention provides a kind of isolated albumen, the albumen participates in the biosynthesis of triterpene compound, especially The biosynthesis of friedelane type triterpene compound.

In the present invention, the isolated albumen is a kind of synthesis for participating in triterpenoids class compound, especially Thunder God The key enzyme of rattan red pigment synthesis, is named as triterpenoids synthase (Tripterygium wilfordii herein Triterpene synthase, TwOSC3), the triterpenoids synthase includes

(1) amino acid sequence shown in SEQ ID NO:2；Or

(2) amino acid sequence shown in SEQ ID NO:2 is substituted, lacks or increases one or more amino acid and function Identical peptide.

In the present invention, TwOSC3 albumen or polypeptide refer to: there are three terpene synthase activities (to participate in friedelane type triterpenes Close object biosynthesis) SEQ ID NO:2 sequence polypeptide, certainly further include have and natural TwOSC3 identical function The variant form of SEQ ID NO:2 sequence.These variant forms include but is not limited to: several (usually 1-50, preferably Ground 1-30, more preferably 1-20, most preferably 1-10) missing, insertion and/or the substitution of amino acid, and C-terminal and/ Or one or several (usually 20 within, be more preferably within 5 within the preferably 10) amino acid of N-terminal addition. For example, in the art, when being substituted with similar nature or similar amino acid, not usually changing the function of albumen.Again For example, the function of protein will not be changed by adding one or several amino acid generally also in C-terminal and/or N-terminal.TwOSC3 egg White or polypeptide further includes the active fragment and reactive derivative of TwOSC3, further includes that can be operatively connected to signal peptide, open The derivative of mover, ribosome bind site or terminator sequence composition.

TwOSC3 protein variant or polypeptide with substantial similar sequence identity be characterized by having one or Multiple amino acid substitutions, missing or insertion.These changes are preferably smaller in nature, i.e., conserved amino acid substitution (being shown in Table 1) and The folding or active other substitutions of polypeptide are not significantly affected；Small missing, the missing of typically one to about 30 amino acid； Amino or c-terminus extend, such as aminoterminal methionine residues, the small joint peptide or affine of no more than about 20-25 residue Label.Present invention accordingly provides comprising with SEQ ID NO:2 at least 70%, preferably at least have 90%, be more preferable 95%, 96%, the polypeptide of 97%, 98%, 99% or more consistent sequence.

1 conserved amino acid of table substitution

It can determine comprising for maintaining the region of structural intergrity key or the amino acid residue in domain.It can determine at this More or less tolerance changes and keeps the specific residue of the entire tertiary structure of molecule in a little regions.The method of analytical sequence structure Include, but are not limited to the comparison with multiple sequences of homoamino acid or nucleotide identity, secondary structure tendency (propensity), second level member figure (binary patterns), complementary accumulation are (complementary packing) and hidden Polar interaction (Barton, Current Opin.Struct.Biol.5:372-376,1995；With Cordes etc., Current Opin.Struct.Biol.6:3-10,1996).Generally, when designing molecular modification or identification specific fragment, By the activity of the molecule of evaluation modification while determining structure.

Amino acid sequence can be carried out in TwOSC3 albumen to change at least to destroy to the necessary height of biological activity Level structure.For example, amino acid residue will be changed when TwOSC3 albumen includes one or more spirals so as not to destroy spiral It is other that geometry and conformational change therein will be such that some key functions (such as combination of molecule partner in connection) weakens Molecular chaperones.The effect that amino acid sequence changes can be predicted for example, by computer simulation disclosed above, or be passed through Crystal structure analysis is measured (see such as Lapthorn etc., Nat.Struct.Biol.2:266-268,1995).This field Well known other technologies are compared the folding for changing albumen and standard molecule (such as native protein), for example, can compare Cysteine distribution situation in variant and standard molecule.Mass spectrum and using reduction and alkylated chemical modification be measurement and two Sulfide linkage is relevant or the cysteine residues of not formed these keys provide method (Bean etc., Anal.Biochem.201:216- 266,1992；Gray, Protein Sci.2:1732-1748,1993；With Patterson etc., Anal.Chem.66:3727- 3732,1994).If being generally acknowledged that the molecule of modification and standard molecule have different cysteine distribution situation, roll over It is folded to be affected.Another received well-known process for being used to measure this point is C. D. spectrum (CD).Measure and compare modification The CD spectrum that molecule and standard molecule generate is conventional (Johnson, Proteins 7:205-214,1990).Crystallography is another One analysis fold and structure well-known process, nuclear magnetic resonance (NMR), digestion peptide mapping and epitope mapping be also analysis fold and The known method (Schaanan etc., Science 257:961-964,1992) of structural similarity between proteins and peptides.

In the present invention, the variant forms of triterpenoids synthase protein include: homologous sequence, conservative variant, etc. Position variant, induced mutants, can hybridize under high or low high stringency conditions natural mutation with triterpenoids synthase gene The encoded albumen of DNA.

Preferably, the isolated protein variant is by one or more in amino acid sequence shown in SEQ ID NO:2 A amino acid is mutated as follows:

482nd Leu is sported into Ile, Ser, Val, Phe, Pro, Arg or Ala.

Still a further object of the present invention provides a kind of polynucleotide sequence for encoding the triterpenoids synthase protein.

The polynucleotide sequence is a kind of gene related with triterpenoids class compound synthesis: i.e. tripterygium wilfordii Triterpene synthase gene (Twosc3 gene), it is one of following nucleotide sequences:

1) SEQ ID No.1 115-2406 nucleotide sequences in sequence table；Or

2) there are one or several bases with the nucleotide sequence of SEQ ID No.1 115-2406 locator qualification in sequence table Mutation, and encode the DNA sequence dna of identical function protein；Or

3) nucleotides sequence under high stringency conditions with nucleotide sequence hybridization shown in SEQ ID NO:1 115-2406 Column, the stringent condition are as follows: hybridize in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1% SDS, And film is washed with the solution.

Wherein the nucleotide sequence " TAG " of 2404-2406 is terminator codon.

Triterpenoids synthasee code gene of the present invention refers to: encoding the nucleosides with triterpenoids synthase protein Acid sequence, such as 115-2406 nucleotide sequences and its degenerate sequence in SEQ ID NO:1.The degenerate sequence refers to positioned at SEQ In 115-2406 nucleotide of encoder block of ID NO:1 sequence, there are one or more codons to be encoded same amino acid The sequence generated after replaced degenerate codon.Due to the degeneracy of codon, so with 115- in SEQ ID NO:1 2406 nucleotide sequence homologies can also encode out sequence described in SEQ ID NO:2 down to about 70% degenerate sequence.Also Including can under moderate stringency conditions, more preferably under high stringent condition in SEQ ID NO:1 from nucleotide 115-2406 The nucleotide sequence of the nucleotide sequence hybridization of position.Further include and the core in SEQ ID NO:1 from 115-2406, nucleotide The homology of nucleotide sequence at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% nucleotide Sequence.It further include that can encode to have to open with the SEQ ID NO:1 of the albumen of natural triterpenoids synthase identical function The variant form of reading frame sequence.These variant forms include but is not limited to several (usually 1-90, preferably 1-60 A, more preferably 1-20, most preferably 1-10) nucleotide missing, insertion and/or substitution, and in 5 ' and/or 3 ' end additions Several (usually 60 within, within preferably 30, be more preferably within 10, be most preferably within 5) nucleotide.

" rigor " of hybridization reaction can determine readily by those of ordinary skill in the art, and generally according to probe Length, wash temperature and salinity calculate by rule of thumb.In general, the longer higher temperature of probes call to be correctly to anneal, and compared with Short probe needs lower temperature.Hybridization is often relied on when complementary strand is present in time-varying in the environment lower than its melting temperature The ability that property DNA anneals again.Probe and can expectation degree of homology between hybridization sequences it is higher, workable relative temperature Also higher.As a result, being inferred to higher relative temperature would tend to keep reaction condition more stringent, and lower temperature is also just less Strictly.About the other details of hybridization reaction rigor and explanation, referring to Ausubel et al., " Current Protocols in Molecular Biology ", Wiley Interscience Publishers, 1995.

" high stringency conditions " or " high high stringency conditions " can identify as follows as defined herein: (1) strong using low ion Degree and high temperature are washed, such as 0.015M sodium chloride/0.0015M sodium citrate/0.1% lauryl sodium sulfate, and 50 DEG C； (2) denaturant is used in hybrid process, such as formamide, such as 50% (v/v) formamide and 0.1% bovine serum albumin/ 0.1%Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer pH 6.5, sodium chloride containing 750mM, 75mM lemon Sour sodium, 42 DEG C；Or (3) are using 50% formamide, 5x SSC (0.75M NaCl, 0.075M sodium citrate), 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x DenhardtShi solution, the salmon sperm dna (50 μ g/ml) of ultrasonication, 0.1% In 42 DEG C of hybridized overnights in the solution of SDS and 10% dextran glucosides, and in 42 DEG C in 0.2x SSC (sodium chloride/lemon Sour sodium) middle washing 10 minutes, high stringency washing in 10 minutes is then carried out in 55 DEG C in the 0.1x SSC containing EDTA.

A further purpose of the present invention is to provide a kind of expression vector, the expression vector includes to encode thunder of the present invention The polynucleotides of public rattan triterpene synthase protein or its variant, or the nucleotide that can hybridize with the polynucleotides under high stringency conditions Sequence, the expression vector also includes promoter and terminator, wherein the promoter operationally connects with the polynucleotides It connects, and the polynucleotides are operably connected with the transcription terminator.

In the present invention, various carriers known in the art can be selected, such as commercially available carrier, including plasmid, clay etc..In life When producing triterpenoids synthase polypeptide of the present invention, the nucleotide sequence of triterpenoids synthase gene can be operably connected In expression regulation sequence, to form triterpenoids synthase expression vectors." the operationally downlink connection " is when finger DNA section When indicate these sections according to certain way arrangement so that they can play a role in phase for purpose expected from it, such as Starting, which is transcribed and moved ahead, in promoter reaches terminator by coding section.Also refer to such a situation: i.e. linear DNA molecule Certain parts can influence same linear DNA molecule other parts activity, for example, if signal peptide DNA is expressed simultaneously as premise The secretion of polypeptide is participated in, then signal peptide (secretion leader sequence) DNA is exactly to be operably connected to be connected to polypeptid DNA；If opened Mover control sequence transcription, then it is to be operably connected to coded sequence；If ribosome bind site, which is placed in, to be made When its position translated, then it is to be operably coupled to coded sequence.Generally, " being operably connected ", it is adjacent to mean, and Secretion leader sequence is then meaned adjacent in reading frame.

It is a further object of the present invention to provide a kind of host cell, the host cell includes coding of the present invention The polynucleotide molecule of TwOSC3 albumen or its variant, or can be hybridized with the polynucleotide molecule under high stringency conditions Nucleic acid molecule, or the expression vector comprising foregoing description of the present invention.The host cell is selected from: bacterium, prokaryotic cell are (such as Escherichia coli) fungal cell, yeast cells, insect cell, mammalian cell or plant cell, it is preferable that it is yeast cells Or plant cell.

Especially interesting yeast includes saccharomyces cerevisiae, pichia pastoris yeast and Pichia methanolica.With outer Source DNA transformed saccharomyces cerevisiae cell and such as Kawassaki, United States Patent (USP) are disclosed in from the method for wherein preparation and reorganization polypeptide In US4599311, US4931373, US4870008, US5037743, US4845075 etc..Pass through table determined by selected marker Type, usually drug resistance or the growth ability when lacking specific nutrient (such as leucine) select transformed cells.For making The preferred vector system of brewer yeast such as can be pYES2 expression vector.Appropriate promoters and terminator for yeast include coming From those of glycolytic gene (US4599311, US4615974 and US4977092) and alcohol dehydrogenase.For other yeast, packet Include multiform Hansenula anomala, newborn Kluyveromyces yeasts, Kluyveromyces fragilis, pichia pastoris yeast, Pichia The conversion system of Methanolica, Guilliermondii Pichia pastoris and Candida maltosa are also known in the art.

According to conventional methods in the culture medium containing nutrient and other necessary ingredients of growth for selected host cell Middle culture conversion or transfection host cell.A variety of suitable culture mediums, including known culture medium and complicated culture medium, Be it is known in the art, generally comprise carbon source, nitrogen source, essential amino acid, vitamin and mineral.If desired, culture medium is also Ingredient as such as growth factor or serum can be contained.Growth medium is generally for example, by drug screening or lack can be by Required nutrient that expression vector carries or selected marker that cotransfection is into host cell supplement is selected containing external source addition The cell of DNA.By conventional methods, small triangular flask or fermentor jet are such as shaken, sufficient air is provided to liquid culture.

Triterpenoids synthase polynucleotides full length sequence of the invention or its segment usually can with PCR amplification method, again Group method or artificial synthesized method obtain.For PCR amplification method, can disclosed related nucleotide sequence according to the present invention, especially It is that open reading frame sequence carrys out design primer, and with the commercially available library cDNA or presses conventional method well known by persons skilled in the art The library cDNA is prepared as template, expands and obtains related sequence.When sequence is longer, it is often necessary to which PCR expands twice or repeatedly for progress Increase, then the segment that each time amplifies is stitched together by proper order again.Once obtaining related sequence, so that it may use Recombination method obtains related sequence in large quantity.This is usually to be cloned into carrier, then be transferred to cell, then passes through routine side Method isolated related sequence from the host cell after proliferation.In addition, also mutant can be introduced this hair by chemical synthesis In bright protein sequence.Other than being generated with recombination method, solid phase technique is also can be used in the segment of albumen of the present invention, by directly synthesizing Peptide and produced (Stewart etc., Solid-Phase Pedtide Synthesis, J.Am.Chem.Soc.85:2149- 2154,1963).Synthetic proteins matter can carry out by hand or automatically in vitro.For example, Applied Biosystems can be used 431A type peptide synthesizer (Foster City, CA) be automatically synthesized peptide.Each of chemical synthesis albumen of the present invention can be distinguished Section, is then chemically connected to generate the molecule of overall length.

In the present invention, term " triterpenoids synthase gene " or " Twosc3 gene " are used interchangeably；Term " tripterygium wilfordii Three diterpene synthases ", " three diterpene synthases ", " triterpenoids synthase protein ", " TwOSC3 " or " TwOSC3 albumen " are used interchangeably.Art Language " nucleic acid molecule " or " nucleotide sequence " are used interchangeably.

Term " separation " or " purifying ", polypeptide or protein refers under conditions of its non-natural surroundings, such as from It opens blood or organizes existing polypeptide or protein.In a preferred form, more peptide or proteins of separation are essentially free of other Other more peptide or proteins of more peptide or proteins, especially animal origin or plant origin.Preferably provide high purity form, i.e., it is pure Degree is greater than the polypeptide that 95%, more preferable purity is greater than 99%；" separation " or " purifying " DNA refers to, the DNA or segment from Separated in the sequence of its two sides under native state, or refer to the DNA or segment under native state with nucleic acid Component separate, and separated with cell with its protein.

Triterpenoids synthase protein and triterpenoids synthase gene provided by the invention are for the first time from tripterygium wilfordii gram Grand preparation, directly participate in the biosynthesis of triterpene compound, typically compound such as suberone.Since suberone is wood The front body structure of bolt alkane type triterpenoid class compound (Celastrol), therefore can be improved in plant by technique for gene engineering The content of Celastrol in the content or friedelane type triterpene compound of suberone such as tripterygium wilfordii plant, particle gun are situated between The Twosc3 gene interference led the results show that triterpenoids synthase gene conjunction of the interference for Celastrol in tripterygium wilfordii At there is apparent inhibiting effect, the suspension cell comparison for being transferred to the interference carrier of the gene containing Twosc3 is transferred to unloaded suspension cell Twosc3 gene expression amount is remarkably decreased (interference), and corresponding trypterygine cellulose content is remarkably decreased (interference), prompts its right Celastrol synthesis plays a significant role.Twosc3 gene can be used for improving trypterygine cellulose content using transgenic technology Research and industrialization in, be used especially for the quality-improving of Chinese herb triperygium wilfordii, for alleviate tripterygium wilfordii medicine source scarcity problem have Preferable facilitation can be used for tripterygium wilfordii breeding.

In one embodiment of the invention, triterpenoids synthase or triterpenoids synthase of the present invention are provided Utilization of the gene in synthesis triterpene compound, the triterpene compound, such as can be suberone, Celastrol.

In one embodiment of the invention, provide a kind of by using triterpenoids synthase of the present invention or thunder Public rattan triterpene synthase gene adjusts and the method for production plant triterpene class compound, the triterpene compound such as suberone or thunder Celastrol.It include: (1) thunder god vine suspending with the method that TwOSC3 albumen or Twosc3 gene obtain plant triterpene constituents The culture of cell；(2) thunder god vine suspending cell RNA is extracted；(3) thunder god vine suspending cell transcript profile is sequenced；(4) Twosc3 gene Full-length cDNA obtains；(5) plasmid and strain construction；(6) recombinant；(7) engineering bacterium expression product is extracted and is separated.

Detailed description of the invention

The tissue expression of Fig. 1 Twosc3 gene (three biology of each sample repeat, and three technologies repeat)

Fig. 2 Twosc3 gene tunning GC-MS result figure (standard items peak 1 is cupreol, and 2 be beta-amyrin, 3 It is suberone for lupeol, 4)

482 mutation result product GC-MS detection figures of Fig. 3 TwOSC3 albumen (1 is beta-amyrin, and 2 be suberone)

The product assay measurement result of Fig. 4 Twosc3 and its mutant

(CK is to be transferred to unloaded suspension to the content of the interference of Fig. 5 thunder god vine suspending cell Twosc3 gene and Celastrol Cell, Ri are to be transferred to the thunder god vine suspending cell with Twosc3 gene interference carrier)

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Quantitative test in following embodiments, is respectively provided with three repeated experiments, and results are averaged.

Tripterygium wilfordii (Tripterygium wilfordii Hook.f.) suspension cell in following embodiments is in document " thunder The full-length clone and expression analysis Chinese medicine of public rattan 4- (5 '-cytidine diphosphate (CDP)) -2-C- methyl D-erythrite kinase gene Magazine, 2015,40 (21): being disclosed in 4165-4170 ", and the public can be real from Capital University of Medical Sciences's molecule crude drug and natural resources of Chinese medicinal materials Test room acquisition.

PEASY-Blunt Simple Cloning Kit and Fast Mutagenesis System in following embodiments It is the product of Beijing Quanshijin Biotechnology Co., Ltd；

Phusion High-Fidelity PCR Master Mix with HF Buffer and various endonucleases are equal Purchased from New England Biolabs company；

SMARTerTM RACE cDNA Amplification Kit is the product of Takara company；

FastQuant RT Kit kit, the small extraction reagent kit of rapid plasmid are purchased from Tiangeng biochemical technology Co., Ltd.

Beta-amyrin (β-Amyrin) is Mei Lun biotech firm product, and batch number M0505AS, No. CAS is 559-70- 6；

Suberone (Friedelin) is the product of Mei Lun biotech firm, and batch number M0308AS, No. CAS is 559- 74-0；

Lupeol (Lupeol) is Aladdin (aladding) Products, batch number #JI409077, article No. L114079-10mg, No. CAS is 545-47-1；

Cupreol (β-sitosterol) is Aladdin (aladding) Products, batch number #D1605025, Article No. S111183-20mg, No. CAS is 83-46-5.

The clone of embodiment 1, tripterygium wilfordii Twosc3 full length cDNA sequence

1. the acquisition of the first chain of thunder god vine suspending cell Total RNAs extraction and cDNA

Using modified CTAB method (CTAB Buffer:2%CTAB (W/V)；100mmol·L^-1Tris-HCl(pH 8.0)； 25mmol·L^-1EDTA；2.0mol·L^-1NaCl；0.5g·L^-1Spermidine) extract thunder god vine suspending cell total serum IgE.To obtain The total serum IgE obtained is template, utilizes 5 '-CDS in SMARTerTM RACE cDNA Amplification Kit kit Primer carries out reverse transcription respectively and obtains 5 '-RACE-Ready cDNA.

2. design of primers

Screen to obtain full length gene sequence fragment according to tripterygium wilfordii transcript profile data notes, design Twosc3-F and Twosc3-R primer, primer sequence are as follows:

Twosc3-F:AAACACAAGAGATTGATATAAGC (SEQ ID NO:3)

Twosc3-R:TTCGATTTAGCGGACACT (SEQ ID NO:4)

3.PCR amplification

The 5 '-RACE-Ready cDNA obtained using step 1 are carried out as template using Twosc3-F and Twosc3-R primer PCR amplification obtains pcr amplification product.

PCR response procedures: 98 DEG C of initial denaturation 30s；98 DEG C of 10s, 60 DEG C of 15s, 72 DEG C of 2min, 35 circulations；72 DEG C of extensions 5min。

Amplified production recycles (method is as follows) through Gene JET Gel Extraction Kit glue.

Gene JET Gel Extraction Kit glue recycling step:

(1) 6 × loading buffer of PCR product and 9 μ L is taken to be pre-mixed, with low electricity on 1.5% Ago-Gel Press (about 5Vcm-1) electrophoresis 30-60min；

(2) cut the gel containing DNA fragmentation with scalpel or slasher, film is placed on the 1.5mL that weighs in advance from Heart pipe is simultaneously weighed.The weight of recording film.

(3) plus the Binding Buffer of 1:1 amount (is measured by weight, such as every 100 milligrams of Ago-Gels add into film 100 microlitres of Binding Buffer)；

(4) gel mixture 10min is incubated under conditions of 50-60 DEG C, is during which mixed by inversion 2-3 times, and glue is promoted to melt, Guarantee that glue all dissolves, gel mixture is quickly vortexed mixing once before upper prop；

(5) most 800 μ L gel lysates are shifted to gene recovery purifying column, 13000g is centrifuged 1min, discards efflux, Then column is put back into identical collecting pipe；

(6) 700 μ LWash Buffer (being diluted with ethyl alcohol) are added and arrive Gene JET purification column.13000g is centrifuged 1min, Efflux is discarded, column is then put back into identical collecting pipe；

(7) centrifugation sky GeneJET purification column 13000g is centrifuged 1min, completely removes remaining Wash Buffer；

(8) Gene JET purification column is transferred to a clean 1.5mL centrifuge tube, adds 30-50 μ L ddH2O (can be 60 DEG C Preheating) in purification column film, 13000g is centrifuged 1min；

(9) it loses Gene JET purification column and stores the DNA of purifying at -20 DEG C.

3. carrier connects

The recovery product of 4 μ L is taken, the B-Zero being added in 1 μ LpEASY-Blunt Simple Cloning Kit reagent is pre- Mixed liquid after mixing, 25 DEG C in PCR instrument, connects 15min.

4. connection product converts

(1) above-mentioned connection product is all added in the Trans1-T1 competent cell of 50 μ L, 30min is placed in ice；

After (2) 42 DEG C of heat shock 1min, then place 2min in ice；

(3) addition 1mLLB culture medium, 37 DEG C, 180rpm shaken cultivation 1h；

(4) it draws 200 μ L bacterium solutions to be coated on LB+Amp solid medium, 37 DEG C of culture 14h observe bacterium colony growing state.

5, bacterium solution PCR verifies positive bacterium colony

In super-clean bench, with the single bacterium colony in the sterilized white pipette tips picking plate of 10 μ L, it is placed in LB+Amp culture medium In, 37 DEG C, after 250rpm constant-temperature shaking culture about 1-2h, 1 μ L bacterium solution is taken to carry out bacterium solution PCR, testing goal segment whether with load On body effectively connects.

PCR reaction system:

PCR reaction condition:

PCR product is observed in gel imager after the detection of 1% agarose gel electrophoresis.2200bp or so to occur The bacterium solution of target fragment band send sequencing company to be sequenced；

Sequencing result shows: the sequence of pcr amplification product is as shown in sequence 1, by unnamed gene shown in sequence 1 Twosc3, wherein 115-2406 are open reading frame (ORF) from 5 ' end, encode the egg being made of 763 amino acid residues White matter (wherein the nucleotide sequence " TAG " of 2404-2406 is terminator codon), which is named as TwOSC3, the albumen Amino acid sequence is sequence 2.

Embodiment 2, Twosc3 gene organization expression analysis

1. the processing of experimental material

Tripterygium root, stem, leaf, flower are picked up from five different plants of Yongan City, Fujian Province state-owned forest farms.It is clear that sample fetches laboratory It washes, minus 80 refrigerator is stored in after liquid nitrogen flash freezer.

2. extraction and the Real-time quantitative PCR of total serum IgE

The root for being stored in minus 80 refrigerator, stem, leaf, flower are crushed under liquid nitrogen environment, total serum IgE is extracted with modified CTAB method, uses FastQuant RT Kit kit (Tiangeng) reverse transcription is at cDNA, using tripterygium wilfordii EF1 α gene as internal reference.Using ABI Prism 7300Sequence Detection System (Applied Biosystems, USA) and KAPA SYBR FAST Universal 2X qPCR Master Mix (Kapa Biosystems, USA) kit carries out Real-time quantitative PCR. Real time fluorescent quantitative reaction system: 2 × Fast qPCR Master Mix 10uL, positive anti-primer (10mmolL-1) are each 0.4uL, cDNA1uL, 50 × Rox High 0.4uL, PCR-grade water 7.8uL.Reaction condition are as follows: 95 DEG C of 3min, 95 DEG C 3s, 60 DEG C of 30s, 45 circulations: 65~95 DEG C are done solubility curve analysis.After reaction to fluorescent value amplification curve and melting Curve is analyzed.Biology repeats 3, and technology is repeated 3 times, using 2^-△△CT method analyzes result.Primer sequence is as follows:

Twosc3-F:5 '-AGTATCCTGATGGCTCGTGG-3 ' (SEQ ID NO:5)

Twosc3-R:5 '-CCCATCCACCATCATCACTC-3 ' (SEQ ID NO:6)

EF1 α-F:5 '-CCAAGGGTGAAAGCAAGGAGAGC-3 ' (SEQ ID NO:7)

EF1 α-R:5 '-CACTGGTGGTTTTGAGGCTGGTATCT-3 ' (SEQ ID NO:8)

As a result as shown in Figure 1.After the homogenization of EF1 α reference gene, Twosc3 gene relative expression levels are highest be In root, followed by stem, followed by flower, Twosc3 gene relative expression quantity are minimum in leaf.Prompt Twosc3 is mainly responsible in root The synthesis of suberone, this is consistent with the main Germ distribution of Celastrol.

Embodiment 3, the research of tripterygium wilfordii Twosc3 biological function

1. construction of eukaryotic expression vector

Using the carrier pEASY-Blunt-Twosc3 plasmid containing tripterygium wilfordii Twosc3 full length gene cDNA as template, with containing Restriction enzyme site primer (mark horizontal line is restriction enzyme site), carries out PCR amplification gene coding region.Archaeal dna polymerase uses high-fidelity DNA Polymerase (Phusion High-Fidelity PCR Master Mix).PCR parameter is 98 DEG C of 30s, 1 circulation；98 DEG C of 10s, 60 DEG C of 10s, 72 DEG C of 2min 30s, 35 circulations；72℃5min；4 DEG C of maintenances.Amplified production is through Gene JET Gel Extraction Kit glue recycles (method is as follows).

Twosc3-F:CGGGGTACCATGTGGAAGATAAAGATAGCTGA (SEQ ID NO:9)

Twosc3-R:CGCGGATCCCTATTTAATTTCCTTTGAAGGC (SEQ ID NO:10)

Gene JET Gel Extraction Kit glue recycling step (with glue recycling step in embodiment 1):

PCR product after recovered carries out double digestion with restriction enzyme, is oriented using 4 DNA ligase of NEB company's T It is connected into (method is as follows) in the expression vector pYES2 through identical double digestion.

Double enzyme digestion reaction system (50 μ L system)

Agarose gel electrophoresis after 37 DEG C of reaction 2h, Gene JET Gel Extraction Kit glue recycle target fragment Method is same as above.

Connection reaction (20 μ L system)

* DNA and carrier molar ratio are about 3:1-10:1

25 DEG C of connection 1h, connection product is inverted, (specific steps in embodiment 1 the same as connecting for positive colony preliminary screening Practice midwifery the conversion and single colonie bacterium solution PCR verifying of object), sample presentation sequencing identification obtains being sequenced nucleotide sequence and recombinates without mutation Plasmid pYES2-Twosc3.

2. yeast ferments

The preparation of competent yeast

By at ATCC buy lactosterol synthase defect yeast (4021900^TM) draw and containing Geneticin On the YPD solid medium of 0.2mg/mL, 30 DEG C dark culture two days.Picking single colonie 30 DEG C in 20mL YPD culture medium, 250rpm is cultivated to OD600 up to 0.8-1.0, is prepared using Frozen-EZ Yeast Transformation IITM kit After competent yeast cells, the expression vector pYES2-Twosc3 of building is converted.Specific step is as follows:

(1) bacterium solution is centrifuged 4min in refrigerated centrifuge 500g, abandons supernatant.

(2) 10mL EZ 1solution washing thalline is added, 500g is centrifuged 4min, abandons supernatant.

(3) 1mL EZ 2solution is added and thallus is resuspended, every 50uL bacterium solution is dispensed into 1.5mL EP pipe, gradient cooling After be stored in minus 80 DEG C of refrigerators or be directly used in carrier conversion.

(4) it takes the plasmid (less than 5uL) of 0.2-1ug that 50uL competent yeast cells are added, adds 500uL EZ 3solution is mixed completely.

(5) 30 DEG C of incubation 45min.Period is flicked or mediation 2-3 times with finger.

(6) 50uL-150uL Incubating Solution is taken to be coated on Sc-ura yeast screening assay culture medium, 30 DEG C of dark culture 2d.

Fermentation process

For the saccharomycete of zero load conversion as control, picking single bacterium falls within 30 DEG C of 5mL Sc-ura fluid nutrient medium, 250rpm Overnight incubation is verified for bacterium solution PCR.Bacterium containing purpose band is saved as into glycerol stock, and takes 20uL bacterium solution new in 20mL 30 DEG C of Sc-ura fluid nutrient medium, 250rpm cultivates 2d, be changed to Sc-ura induced medium (containing galactolipin), 30 DEG C, 220rpm Fiber differentiation 12h, then with 30 DEG C of the 0.1M potassium phosphate of 20mL (containing glucose, PH7.0), 220rpm cultivates 1d.

3. product GC-MS is detected

Bacterium solution centrifugation after fermentation, takes thallus that 10mL 20%KOH/50%EtOH solution ultrasonic extraction 10min is added, uses Three times, after extract liquor merges, nitrogen is blown flings to solvent to 10mL n-hexane extraction, and 100uL anhydrous pyridine and 100uL trifluoroacetyl is added 65 DEG C of derivatization 60min of amine (containing trimethyl silane).Nitrogen is blown volatilize solvent after, 800uL chloroform redissolve, filter membrane, GC-MS inspection It surveys.GC-MS condition: sample volume 1uL, 50 DEG C of holdings 1min, 50 DEG C of min^-1Rise to 260 DEG C；1℃·min^-1272 DEG C are risen to, Keep 4min.250 DEG C of injector temperature, 230 DEG C of ion source temperature, electron energy 70ev, 10-550m/z range is carried out to sample Scanning.GC-MS instrument is Agilent Technologies company Agilent 7890B gas chromatograph, chromatography Column is DB-5ms (15m × 250um × 0.1um).

As a result see Fig. 2.Compared with being transferred to unloaded control group yeast extract, it is transferred to the yeast extract of Twosc3 gene In detect suberone, illustrate the albumen of Twosc3 gene expression can be catalyzed 2,3- oxidosqualene formed suberone.

4. rite-directed mutagenesis

In addition to mutational site, two primer lengths about 25-30bp, 5 ' end overlay regions include 15-20bp, 3 ' end extension areas Include at least 10bp；Mutational site is located on two primers, is located at forward mutation assay primer overlay region downstream, close to overlapping Area, rite-directed mutagenesis primer is designed according to the above principle in the end of inverse transition primer 5 ', ' DCTAE ' functional domain upstream second Twosc3CTT (L) is mutated into GTT (V) by (482) at amino acid, ATT (I), TCT (S), TTT (F), GCT (A), CCT (P) With CGT (R).Rite-directed mutagenesis primer sequence:

Reaction system

After above-mentioned system mixes, in PCR instrument, initial denaturation 94 DEG C of 5min, 94 DEG C of 20s, 55 DEG C of 20s, 72 DEG C of 3min 30s, 25 circulations, 72 DEG C of extension 10min.1uL DMT enzymic digestion product, 37 DEG C of reaction 1h are added after reaction.4uL digestion is taken to produce 50uL DMT competent cell is added in object, mixes, ice bath 30min, 42 DEG C of water-bath 45s, ice bath 2min, and the LB training of 500uL is added Base is supported, 200rpm, 37 DEG C of culture 1h are coated on 37 DEG C of cultures on LB+AMP culture dish.Positive colony is sent be sequenced successfully after, extract Plasmid.

The mutant plasmid of extraction is transferred in competent yeast cells (in example 3 prepared by step 2), is trained in Sc-ura yeast Base culture is supported, subsequent picking single colonie is fermented and induced, and extracts product, (step is the same as embodiment 3 for GC-MS testing result In 2 and 3).

As a result as shown in Figure 3.The 482nd leucine (L) is mutated into respectively on the amino acid sequence of Twosc3 coding Product disappears afterwards for alanine (A), phenylalanine (F), arginine (R) and proline (P), illustrates the loss of activity of enzyme；And 482 Position is mutated into valine (V), serine (S) respectively, and product becomes 2 (beta-amyrins) afterwards, and product 4 (suberone) disappears, wherein will After the 482nd leucine (L) is mutated into isoleucine (I) on the amino acid sequence of Twosc3 coding, while generating 2 He of product Product 4, and the content of product 4 is promoted.Further there are the mutant strain of variation and Twosc3 wild product assay Type bacterial strain carries out fermenting respectively quantitatively, and fermentation step and product extract detection method and be same as above.Three repetitions of each bacterial strain, product Measurement result is shown in Fig. 4.

Embodiment 4, tripterygium wilfordii Twosc3 gene interfere the influence synthesized to Celastrol

1. thunder god vine suspending cell prepares

Prepare MS solid medium: Murashige&Skoog with Vitamins (Caisson Labs company) 4.43g/L, sucrose (AOBOX company) 30g/L, 2,4-D 1.0mg/L, KT 0.1mg/L adjust PH to 5.8-6.0 after adding water, add Agarose (Oxoid company) 6-8g, pours into 35mm cell culture when temperature drops to 60 DEG C or less after 20min high pressure sterilization by 121 DEG C Solidification in ware (each culture dish 3ml culture medium).

Will the suspension cell of subculture be transferred in the 35mm Tissue Culture Dish that culture medium is added that (each culture dish 0.2g suspends Cell), 25 DEG C, dark culture 6-9d is used for via Particle Bombardment Transformation.

2.gateway technology constructs Twosc3 interference carrier

The building of BP entry vector

Design primer is as follows:

Interfere primer Twosc3-F:CACCGCACTGCTGAAGCATTAAAGT (SEQ ID NO:25)

Twosc3-R:CATACCACGAGCCATCAGG (SEQ ID NO:26)

Using the carrier pEASY-Blunt-Twosc3 plasmid containing tripterygium wilfordii Twosc3 full length gene cDNA as template, with containing Restriction enzyme site primer (mark horizontal line is restriction enzyme site), carries out PCR amplification gene coding region.Archaeal dna polymerase uses high-fidelity DNA Polymerase (Phusion High-Fidelity PCR Master Mix).PCR parameter is 98 DEG C of 30s, 1 circulation；98 DEG C of 10s, 60 DEG C of 10s, 72 DEG C of 2min 30s, 35 circulations；72℃5min；4 DEG C of maintenances.Amplified production is through Gene JET Gel The recycling of Extraction Kit glue.

BP reaction system

Competent escherichia coli cell Trans1-T1 (Beijing Quan Shi King Company) is transferred to after 22 DEG C of reaction 2h to train in LB+Kan Support the culture of 37 DEG C of base, positive colony is sent be sequenced successfully after, the small extraction reagent kit extraction plasmid of rapid plasmid.

LR reaction system

* pK7 is interference carrier

25 DEG C of reaction 3-4h, are added 1uL Proteinase K, and 37 DEG C of incubation 10min are transformed into Trans-T1 and cultivate in LB+Spe 37 DEG C of base culture, positive colony is sent be sequenced successfully after, mentioned with the big extraction reagent kit of Plasmid Maxi Kit (Omega company) plasmid Take plasmid (plasmid concentration requirement > 1ug/uL).

3. Biolistic mediated transformation

Experiment equipment requires sterile: according to equipment property difference or combining using autoclave sterilization, ultraviolet irradiation degerming It is sterilized with 70% ethyl alcohol.

Each plasmid does 5 biology and repeats, that is, makes a call to 5 disk cells, every 2 rifle of disk, totally 10 rifle.PK7 empty carrier will be converted Suspension cell is used as control.By 20ug plasmid, 5000ug bronze, the CaCl of 100uL 2.5M₂, the spermidine of 40uL 0.1M is mixed It closes, shakes 2-3min, about 2s is centrifuged after static 1min, abandon supernatant；70% ethyl alcohol of 140uL is added, supernatant is abandoned in centrifugation after flicking； 140uL100% ethyl alcohol is added, supernatant is abandoned in centrifugation after flicking；100uL100% ethyl alcohol is added, after flicking, shakes 2-3s in low speed, It is placed in ice.

Carrier film after disinfection is placed in iron support, the carrier bronze premixed liquid of the above-mentioned preparation of 10uL is added in each iron support, Iron support is stopped net, can split film and thunder god vine suspending cell is individually positioned in the phase of particle gun equipment by particle gun working specification It answers on position, carries out via Particle Bombardment Transformation carrier.Every disk cell makes two rifles.

4. screening and culturing and gene expression analysis

By the complete cell of via Particle Bombardment Transformation, 25 DEG C, dark culture 2d, being transferred to MS screening and culturing medium is MS+Kan culture medium, is resisted Raw element final concentration Kan is 100mg/ml.After the completion of 20d screening, by the cell subculture after screening in the culture medium of new MS+Kan In continue to cultivate 20d, be transferred in the fluid nutrient medium of MS+Kan, 25 DEG C, after 120rpm cultivated for 3 generations, take a part of thin later For extracting RNA after born of the same parents' liquid nitrogen flash freezer, after remaining cell vacuum freeze drying, 0.2g methanol 1ml ultrasound 2h is taken to extract product, UPLC analyzes product result.

Cell after liquid nitrogen flash freezer crushes under liquid nitrogen environment, is extracted with RNA extracts kit (Promega company) total RNA, with FastQuant RT Kit kit (Tiangeng) reverse transcription at cDNA, using tripterygium wilfordii EF1 α gene as internal reference.Using ABI Prism 7300Sequence Detection System (Applied Biosystems, USA) and KAPA SYBR It is quantitative that FAST Universal 2X qPCR Master Mix (Kapa Biosystems, USA) kit carries out Real-time PCR.Real time fluorescent quantitative reaction system: 2 × Fast qPCR Master Mix 10uL, positive anti-primer (10mmolL-1) are each 0.4uL, cDNA1uL, 50 × Rox High 0.4uL, PCR-grade water 7.8uL.Reaction condition are as follows: 95 DEG C of 3min, 95 DEG C 3s, 60 DEG C of 30s, 45 circulations: 65~95 DEG C are done solubility curve analysis.After reaction to fluorescent value amplification curve and melting Curve is analyzed.Biology repeats 5, and technology is repeated 3 times, using 2^-△△CT method analyzes result.

As a result see Fig. 5.The suspension cell comparison for being transferred to the interference carrier of the segment containing Twosc3 is transferred to unloaded suspension cell Twosc3 gene expression amount is remarkably decreased, and (11.73ug/g has dropped than zero load for corresponding trypterygine cellulose content significant decrease 77%).The interference of Twosc3 can lower the synthesis of Celastrol as the result is shown, show that the generation with Celastrol is significant It is related.

Above description is not limitation of the present invention, and the present invention is also not limited to the example above.The art it is common Within the essential scope of the present invention, the variations, modifications, additions or substitutions made also should belong to protection of the invention to technical staff Range, protection scope of the present invention are subject to claims.

Sequence table

<110>Capital University of Medical Sciences

<120>triterpenoids synthase TwOSC3 and its encoding gene and application

<130>in background technique

<141> 2018-08-08

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2475

<212> DNA

<213> Abracris flavolineata

<400> 1

aaacacaaga gattgatata agctctcttg tcttagttcc tcatcatatc atcaagttct 60

tggaggcttc aacctctcat ccttgatagg cttcctctct ggagtgaaga aatcatgtgg 120

aagataaaga tagctgaacg tgggaactgc ccctactccg agtacttgta cactacaaat 180

gactttgttg gtaggcagat atgggagttt gaccctaatg caggcacccc tgaagagctc 240

gctgaggtcg aagaggctcg caagaaattc accgagaacc gccatgaagt caagcctgct 300

tccgacctac tttggatgca gcagtttctg aggcagaaga acttcaagca aacaattcct 360

ccgttgagaa ttggggagaa agaacaagtt acatatgaag atgtcacaac tgctttgaag 420

agagcttcct ctttcttgtc agccttgcaa gccagtgatg gtcactggcc agcagaaaat 480

gctggagtct tgtttttcct tcctccattt atcttttgcc tatacatcac tggacatctc 540

aattcgatta tcacttcgga acatcgtaaa gaaatcctac gtttcatata caaccaccag 600

aatgaagatg ggggttgggg aatacacata gagggacaca gctcaatgtt taccacaaca 660

ttcagctatg tgtgcatgag aatacttgga gtaggaccag atgaaagtgc ttgtgctaga 720

gcaagaaagt ggattcttga tcatggtggc atcacttaca tggcttcctg gggaaagacc 780

tggctttcga tacttggtat atttgattgg tatggatgca acccaatgcc cccagagttc 840

tggattcttc cttcttatct ccctatacat ccagcgaaaa tgtggtgcta ttgccggatg 900

gtttacatgc caatgtcata tctatatggg aaaagatttg ttggtcctat cacacctctc 960

attttacaat tgagagagga gctccacact cagccctacc atgaaattca atggagacaa 1020

atgcgccatc gatgcggaaa ggaggatcta tactatcccc acagtctaat ccagaatttc 1080

ctctgggacg gtctttatgt ggcttctgaa cctcttttga ctcgctggcc ttttagcaag 1140

ataagagaga aggctcttga aaaagcaatg gaacacattc actacgaaga cgaaaatagt 1200

cgatacatca ccattggctg tgttgaaaag gcattgtgta tgctttgttg ctgggttgaa 1260

gaccccaatg gagactattt caagaagcat cttgcaagga taccagatta cttatgggtt 1320

gcagaggatg gtatgaaagt ggtgagtttt ggcagccaac tgtgggatgc tacctttggc 1380

tttcaagctc tggttgctag caatctaaca aatgaagtcg ctccaactct cgtcaaagca 1440

tacgacttcg taaagaaatg ccaggtccgg aataatccct ctggtgactt tgagaaaatg 1500

tttcgccaca tttcaaaagg atcatggact ttctccgatc aagatcatgg atggcaactt 1560

tctgattgca ctgctgaagc attaaagtgt tgcttgctag cagcaaccat gcccgaagaa 1620

cttgttggag agaaattaga tcctcaatgg atatttgagt ctgtaaacat catactttcc 1680

ctccaagagc ctaaaaccgg cggtttagct ggctgggaac cagtaagagc tggacaatgg 1740

atggagatgc tcaaccctat ggagtttctc gagaatattg tgattgaaca tacatatgtc 1800

gagtgtactg gatcttccat cattgctttc attacactca agaagttatt cccaggtcat 1860

aggaccaaag acattgacaa tttcattgta aacggtataa gatatctcga ggacgtgcag 1920

tatcctgatg gctcgtggta tggaaactgg ggtatttgct tcatctatag taccatgttt 1980

gcacttggag ggctagcagc agctggtagg acttacgaaa attgtcccgc tgtgcgcaga 2040

ggtgttgatt ttctacttat taatcagagt gatgatggtg gatggggaga aagctatctt 2100

tcttccccaa gaaagatata tacacctctt gaaggaagaa gatcaaatgt ggtacaaact 2160

gcatgggcta tgctagggct gctctatgct ggccaggttg agagagatcc aactcctctt 2220

caccgcggtg cgaagatact aatcaattac caaatggaag agggaggtta cccccagcag 2280

gaaatcactg gagttttcaa aatgaattgc atgttacact atccaatata taggaatgcc 2340

ttcccaatat gggcgctcgg agagtatcga aatcgtgtta agttgccttc aaaggaaatt 2400

aaatagcaat gaaactaaat tccgtgtaaa aagacgtgaa tgagaataat gtacacaagt 2460

gtccgctaaa tcgaa 2475

<210> 2

<211> 763

<212> PRT

<213> Abracris flavolineata

<400> 2

Met Trp Lys Ile Lys Ile Ala Glu Arg Gly Asn Cys Pro Tyr Ser Glu

1 5 10 15

Tyr Leu Tyr Thr Thr Asn Asp Phe Val Gly Arg Gln Ile Trp Glu Phe

20 25 30

Asp Pro Asn Ala Gly Thr Pro Glu Glu Leu Ala Glu Val Glu Glu Ala

35 40 45

Arg Lys Lys Phe Thr Glu Asn Arg His Glu Val Lys Pro Ala Ser Asp

50 55 60

Leu Leu Trp Met Gln Gln Phe Leu Arg Gln Lys Asn Phe Lys Gln Thr

65 70 75 80

Ile Pro Pro Leu Arg Ile Gly Glu Lys Glu Gln Val Thr Tyr Glu Asp

85 90 95

Val Thr Thr Ala Leu Lys Arg Ala Ser Ser Phe Leu Ser Ala Leu Gln

100 105 110

Ala Ser Asp Gly His Trp Pro Ala Glu Asn Ala Gly Val Leu Phe Phe

115 120 125

Leu Pro Pro Phe Ile Phe Cys Leu Tyr Ile Thr Gly His Leu Asn Ser

130 135 140

Ile Ile Thr Ser Glu His Arg Lys Glu Ile Leu Arg Phe Ile Tyr Asn

145 150 155 160

His Gln Asn Glu Asp Gly Gly Trp Gly Ile His Ile Glu Gly His Ser

165 170 175

Ser Met Phe Thr Thr Thr Phe Ser Tyr Val Cys Met Arg Ile Leu Gly

180 185 190

Val Gly Pro Asp Glu Ser Ala Cys Ala Arg Ala Arg Lys Trp Ile Leu

195 200 205

Asp His Gly Gly Ile Thr Tyr Met Ala Ser Trp Gly Lys Thr Trp Leu

210 215 220

Ser Ile Leu Gly Ile Phe Asp Trp Tyr Gly Cys Asn Pro Met Pro Pro

225 230 235 240

Glu Phe Trp Ile Leu Pro Ser Tyr Leu Pro Ile His Pro Ala Lys Met

245 250 255

Trp Cys Tyr Cys Arg Met Val Tyr Met Pro Met Ser Tyr Leu Tyr Gly

260 265 270

Lys Arg Phe Val Gly Pro Ile Thr Pro Leu Ile Leu Gln Leu Arg Glu

275 280 285

Glu Leu His Thr Gln Pro Tyr His Glu Ile Gln Trp Arg Gln Met Arg

290 295 300

His Arg Cys Gly Lys Glu Asp Leu Tyr Tyr Pro His Ser Leu Ile Gln

305 310 315 320

Asn Phe Leu Trp Asp Gly Leu Tyr Val Ala Ser Glu Pro Leu Leu Thr

325 330 335

Arg Trp Pro Phe Ser Lys Ile Arg Glu Lys Ala Leu Glu Lys Ala Met

340 345 350

Glu His Ile His Tyr Glu Asp Glu Asn Ser Arg Tyr Ile Thr Ile Gly

355 360 365

Cys Val Glu Lys Ala Leu Cys Met Leu Cys Cys Trp Val Glu Asp Pro

370 375 380

Asn Gly Asp Tyr Phe Lys Lys His Leu Ala Arg Ile Pro Asp Tyr Leu

385 390 395 400

Trp Val Ala Glu Asp Gly Met Lys Val Val Ser Phe Gly Ser Gln Leu

405 410 415

Trp Asp Ala Thr Phe Gly Phe Gln Ala Leu Val Ala Ser Asn Leu Thr

420 425 430

Asn Glu Val Ala Pro Thr Leu Val Lys Ala Tyr Asp Phe Val Lys Lys

435 440 445

Cys Gln Val Arg Asn Asn Pro Ser Gly Asp Phe Glu Lys Met Phe Arg

450 455 460

His Ile Ser Lys Gly Ser Trp Thr Phe Ser Asp Gln Asp His Gly Trp

465 470 475 480

Gln Leu Ser Asp Cys Thr Ala Glu Ala Leu Lys Cys Cys Leu Leu Ala

485 490 495

Ala Thr Met Pro Glu Glu Leu Val Gly Glu Lys Leu Asp Pro Gln Trp

500 505 510

Ile Phe Glu Ser Val Asn Ile Ile Leu Ser Leu Gln Glu Pro Lys Thr

515 520 525

Gly Gly Leu Ala Gly Trp Glu Pro Val Arg Ala Gly Gln Trp Met Glu

530 535 540

Met Leu Asn Pro Met Glu Phe Leu Glu Asn Ile Val Ile Glu His Thr

545 550 555 560

Tyr Val Glu Cys Thr Gly Ser Ser Ile Ile Ala Phe Ile Thr Leu Lys

565 570 575

Lys Leu Phe Pro Gly His Arg Thr Lys Asp Ile Asp Asn Phe Ile Val

580 585 590

Asn Gly Ile Arg Tyr Leu Glu Asp Val Gln Tyr Pro Asp Gly Ser Trp

595 600 605

Tyr Gly Asn Trp Gly Ile Cys Phe Ile Tyr Ser Thr Met Phe Ala Leu

610 615 620

Gly Gly Leu Ala Ala Ala Gly Arg Thr Tyr Glu Asn Cys Pro Ala Val

625 630 635 640

Arg Arg Gly Val Asp Phe Leu Leu Ile Asn Gln Ser Asp Asp Gly Gly

645 650 655

Trp Gly Glu Ser Tyr Leu Ser Ser Pro Arg Lys Ile Tyr Thr Pro Leu

660 665 670

Glu Gly Arg Arg Ser Asn Val Val Gln Thr Ala Trp Ala Met Leu Gly

675 680 685

Leu Leu Tyr Ala Gly Gln Val Glu Arg Asp Pro Thr Pro Leu His Arg

690 695 700

Gly Ala Lys Ile Leu Ile Asn Tyr Gln Met Glu Glu Gly Gly Tyr Pro

705 710 715 720

Gln Gln Glu Ile Thr Gly Val Phe Lys Met Asn Cys Met Leu His Tyr

725 730 735

Pro Ile Tyr Arg Asn Ala Phe Pro Ile Trp Ala Leu Gly Glu Tyr Arg

740 745 750

Asn Arg Val Lys Leu Pro Ser Lys Glu Ile Lys

755 760

<210> 3

<211> 23

<212> DNA

<213> Abracris flavolineata

<400> 3

aaacacaaga gattgatata agc 23

<210> 4

<211> 18

<212> DNA

<213> Abracris flavolineata

<400> 4

ttcgatttag cggacact 18

<210> 5

<211> 20

<212> DNA

<213> Abracris flavolineata

<400> 5

agtatcctga tggctcgtgg 20

<210> 6

<211> 20

<212> DNA

<213> Abracris flavolineata

<400> 6

cccatccacc atcatcactc 20

<210> 7

<211> 23

<212> DNA

<213> Abracris flavolineata

<400> 7

ccaagggtga aagcaaggag agc 23

<210> 8

<211> 26

<212> DNA

<213> Abracris flavolineata

<400> 8

cactggtggt tttgaggctg gtatct 26

<210> 9

<211> 32

<212> DNA

<213> Abracris flavolineata

<400> 9

cggggtacca tgtggaagat aaagatagct ga 32

<210> 10

<211> 31

<212> DNA

<213> Abracris flavolineata

<400> 10

cgcggatccc tatttaattt cctttgaagg c 31

<210> 11

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 11

caagatcatg gatggcaaat ttctgattgc 30

<210> 12

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 12

tttgccatcc atgatcttga tcggagaaag 30

<210> 13

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 13

caagatcatg gatggcaagt ttctgattgc 30

<210> 14

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 14

cttgccatcc atgatcttga tcggagaaag 30

<210> 15

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 15

caagatcatg gatggcaatt ttctgattgc 30

<210> 16

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 16

attgccatcc atgatcttga tcggagaaag 30

<210> 17

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 17

caagatcatg gatggcaacc ttctgattgc 30

<210> 18

<211> 31

<212> DNA

<213> Abracris flavolineata

<400> 18

ggttgccatc catgatcttg atcggagaaa g 31

<210> 19

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 19

caagatcatg gatggcaacg ttctgattgc 30

<210> 20

<211> 31

<212> DNA

<213> Abracris flavolineata

<400> 20

cgttgccatc catgatcttg atcggagaaa g 31

<210> 21

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 21

caagatcatg gatggcaagc ttctgattgc 30

<210> 22

<211> 31

<212> DNA

<213> Abracris flavolineata

<400> 22

gcttgccatc catgatcttg atcggagaaa g 31

<210> 23

<211> 30

<212> DNA

<213> Abracris flavolineata

<400> 23

caagatcatg gatggcaatc ttctgattgc 30

<210> 24

<211> 31

<212> DNA

<213> Abracris flavolineata

<400> 24

gattgccatc catgatcttg atcggagaaa g 31

<210> 25

<211> 25

<212> DNA

<213> Abracris flavolineata

<400> 25

caccgcactg ctgaagcatt aaagt 25

<210> 26

<211> 19

<212> DNA

<213> Abracris flavolineata

<400> 26

cataccacga gccatcagg 19

Claims (8)

1. isolated albumen, the albumen are

(1) amino acid sequence shown in SEQ ID NO:2；Or

(2) peptide after the 482nd Leu of amino acid sequence shown in SEQ ID NO:2 is mutated, it is described to sport 482 Leu Sport Ile, Ser or Val.

2. encoding the polynucleotides of albumen described in claim 1.

3. polynucleotides according to claim 2, the polynucleotides are core shown in SEQ ID NO:1 115-2406 Thuja acid molecule.

4. expression vector, it includes polynucleotides described in promoter, Claims 2 or 3 and transcription terminators, wherein the starting It is sub to be operably connected with the polynucleotides, and the polynucleotides are operably connected with the transcription terminator.

5. recombinant host cell, it includes expression vector described in polynucleotides described in Claims 2 or 3 or claim 4, institutes It states cell to be selected from: bacterium or yeast cells.

6. polynucleotides described in albumen or Claims 2 or 3 described in claim 1 are adjusting and are producing plant triterpene class chemical combination Application in object.

7. application as claimed in claim 6, wherein the triterpene compound is suberone, beta-amyrin or Celastrol.

8. application of the polynucleotides described in albumen or Claims 2 or 3 described in claim 1 in tripterygium wilfordii plant breeding.