CN108841938A - A kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type - Google Patents
A kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type Download PDFInfo
- Publication number
- CN108841938A CN108841938A CN201810639041.3A CN201810639041A CN108841938A CN 108841938 A CN108841938 A CN 108841938A CN 201810639041 A CN201810639041 A CN 201810639041A CN 108841938 A CN108841938 A CN 108841938A
- Authority
- CN
- China
- Prior art keywords
- copper ion
- hcr
- detection
- chain
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type, including：(1) system is cut, (2) sPCR amplification system, (3) HCR system, (4) include the detection architecture of ABTS developing solution.The present invention is by dexterously design primer, template and probe, so that can carry out ultrafast amplification to template in the presence of copper ion, amplified production is reacted by inspiring HCR, so that product forms tetra- serobila of G in control environment.It is further developed the color using the peroxidase activity of tetra- serobila of G, solves the problems, such as that normal PCR product is difficult to Visual retrieval, realize quick, Visual retrieval to copper ion.Moreover, sensor provided by the invention has the characteristics that high special, highly sensitive that testing result is more objective, accurate to copper ion.
Description
Technical field
The present invention relates to biosensor technology fields, specifically, it is super to be related to a kind of general partition of copper ion cutting-type
Fast amplification visible sensor.
Background technique
Copper is a kind of transition elements, and chemical symbol Cu, atomic number 29, atomic weight is 63.546, belongs to group ib.Fine copper is
Soft metal is reddish orange band metallic luster when surface is just cut, and simple substance is in aubergine.Ductility is good, thermal conductivity and conduction
Property it is high, the amount of copper is 100-200 milligrams in normal human, and copper ion is mainly using the catalysis as many enzymes and albumen in human body
Confactor or structure composition, many important metabolic processes in wide participation body affect generation, the knot of blood of human body
The formation of tissue is formed, central nervous system, the metabolism of cholesterol and glucose, cardiac function and immune system etc., human body is only
Need micro copper that can maintain normal vital movement.But copper lacks or copper excessively all can be unfavorable to health generation
It influences.The intake that copper lacks the shortage or its biological antagonist substance that are generally accompanied with other nutrients is excessive, influences cell
The normal function of interior many enzymes, and then influence the metabolic processes of cell.Copper be excessively often as genetic disease or
Due to Heavy-Metal-Contaminated Environments, the food of a large amount of cuprics is eaten by mistake or has sucked caused by the high gas of copper content.Copper (Cu) and
Its compound in the environment caused by pollution mainly due to the exploitation and smelting of copper zinc ore, intermetallic composite coating, machine-building, steel
Production etc. generates, wherein the flue dust for smelting discharge is the main source of atmosphere Cu-W ore deposit.
The detection method of common copper ion mainly have atomic spectroscopy, including atomic absorption spectrum, inductive coupling etc. from
Daughter emission spectrometry and burn light spectroscopic methodology, it is seen that spectrophotometry, Flow Injection Chemiluminescence and Differential Potentiometric Stripping Analysis with Experimental
Deng, but these detection methods require the instrument of valuableness and the operator Jing Guo professional training, sample pre-treatments also compare
It is cumbersome, do not have general applicability.Therefore, develop it is simple and quick, low in cost, can the detection method of accurate quantitative analysis very must
It wants.
Summary of the invention
The object of the present invention is to provide a kind of general ultrafast amplification visible sensors of partition of copper ion cutting-type.
It is a further object of the present invention to provide the methods based on biosensor technology detection copper ion.
In order to achieve the object of the present invention, inventor is according to the specific ribozyme of copper ion, design general partition primer pair its
Ultrafast polymerase chain reaction (super Polymerase Chain Reaction, sPCR) is carried out, product inspires HCR, makes it
In conjunction with rich G sequence in K+Being formed under existence condition has active tetra- serobila of G of peroxidase, constructs a kind of novel base
In the copper ion cutting-type functional nucleic acid colorimetric sensor of partition primer.
In a first aspect, the present invention provides a kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type, including：
(1) system is cut, (2) sPCR amplification system, (3) HCR system, (4) include the detection architecture of ABTS developing solution.
The detection architecture is used for sample to be tested successively via the cutting system, sPCR amplification system and HCR system
Products therefrom carries out color developing detection after being reacted；
Wherein, the cutting system includes substrate chain and enzyme chain：
Substrate chain：5′-AGCTTCTTTCTAATACGG-CTTACC-3′
Enzyme chain：5′-GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3′
Wherein ,-indicate copper ion cleavage site；
The sPCR amplification system includes：Forward direction partition primer, reverse primer, template：
Forward direction partition primer：5 '-AGTCTAGGATTCGGCGTCCCTTAA- interruptions-
TTAAGGGACGCCGAATCCTAGACTTCATCGCACCGTCAAAGGAACC-3′
Reverse primer：5′-CTTACCTTGGGGGGGGGGTT-3′
Template：5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAAACCCCCCCC
CCAAGGTAAGCCCCAATTTCGCCATCTTCC-3′
The HCR system includes 2 probes：
Probe 1：5′-AGGGCGGGTGGGTTAAGGGACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTC
GGGT-3′
Probe 2：5′-GGGTAGTCTAGGATTCGGCGTCCCTTAAGACGCCGAATCCTAGACTACTTTGAGGGCGGG
TGGG-3′。
Wherein, the interruption in the positive partition primer is poly- six ethylene glycol.Other partitions that PCR can be prevented to extend
Structure can also be used for the present invention.
The archaeal dna polymerase be Ex Taq archaeal dna polymerase, the buffer be 10 × Ex Taq Buffer, the two with
It is silent winged scientific and technological (Thermo Scientific Life Technologies) that the dNTP is purchased from match.
Detection architecture of the present invention includes：Enzyme activity buffer, hemin solution.
Wherein, the enzyme activity buffer is：100mM Tris,120mM NaCl,10mM MgCl2, 100mM KCl,
pH8.4。
The hemin stoste that the hemin solution is 20mM is with above-mentioned enzyme activity buffer according to 2 μ L：
The mixed hemin dilute solution of the ratio of 1mL.
Application during the present invention also provides sensor as aforementioned in terms of detect copper ion, the detection can behave as qualitative inspection
Survey or quantitative detection.
Second aspect, the present invention provides a kind of method for carrying out qualitative detection to copper ion using sensor as aforementioned, packets
Include following steps：
S1, sample to be tested is added into the cutting system, carries out cleavage reaction；
S2, ultrafast polymerase chain reaction will be carried out in the addition of cleaved products obtained by the S1 sPCR amplification system, obtained
SPCR product；
S3, progress HCR reaction in the HCR system is added in the sPCR product, obtains HCR product；
S4, the HCR product is detected using the detection architecture.
S1 is specific as follows：Substrate chain and enzyme chain are mixed in equimolar ratio, are diluted to 1 μM -2 μM of concentration with buffer,
85 DEG C of -95 DEG C of heating 15min, are then cooled to 25-37 DEG C, obtain ribozyme liquid；It is added into ribozyme liquid described in 35 μ L to test sample
Product solution forms 40 μ L systems, in 36-38 DEG C of incubation 4-6min, 4-6 μ L terminate liquid is then added, obtains cleaved products.
Further, the detection architecture includes enzyme activity buffer and hemin dilute solution, and enzyme activity is buffered
Liquid, hemin dilute solution and HCR product are 8 by volume:1:1 mixes (total volume is 100 μ L), at 35-38 DEG C
Under the conditions of react 20-40min, be added with the isometric ABTS developing solution of aforementioned mixture, mix, 35-38 DEG C is protected from light incubation, meat
Eye is monitored.
The third aspect, the present invention provides a kind of method for carrying out quantitative detection to copper ion using sensor as aforementioned, packets
Include following steps：
SI, production standard curve：
Using the copper ion solution of known concentration, the cutting system with different copper ion concentrations is constructed, sPCR amplification,
The step of HCR reaction and detecting step are with aforementioned qualitative detection is identical；
Using copper ion concentration as abscissa, with OD415Value is ordinate, draws standard curve；
SII, sample to be tested is detected according to aforementioned qualitative checking method, the OD that will be measured415It is bent to be worth substitution standard
The content of copper ion in sample to be tested is calculated in line, realizes the quantitative detection to copper ion.
The present invention provides a kind of method based on biosensor technology detection copper ion, first design copper ion specificity
Ribozyme, including substrate chain and enzyme chain carry out substrate chain with enzyme chain to hybridize the core for being formed and having specific copper ion cleavage activity
Enzyme, existing for the copper ion under the conditions of cleavage reaction occurs, as reverse primer, (i.e. target causes the nucleic acid fragment cut down
Molecule), pcr amplification reaction is carried out to template together with forward direction partition primer, one end of gained PCR product has one section of single-stranded core
Acid sequence；The PCR product is in K+Under existence condition, tetra- serobila of G is formed, is catalyzed H2O2With ABTS develop the color, and then complete to copper from
The quick visualization detection of son；Or
HCR reaction is inspired by PCR product, so that HCR product is in K+Tetra- serobila of G is formed under existence condition, is catalyzed H2O2With
ABTS colour developing, and then complete to detect the quick visualization of copper ion.
In the present invention, developing solution can be substituted with TMB.
The base sequence of the substrate chain and enzyme chain is as follows：
Substrate chain：5′-AGCTTCTTTCTAATACGG-CTTACC-3′
Enzyme chain：5′-GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3′
Wherein ,-indicate copper ion cleavage site；
The 5 ' of the positive partition primer, which are held, has hairpin structure, at least provided with one between two sections of reverse complemental base sequences
Blocker, the blocker can block PCR to extend.
Preferably, there is richness G base sequence on the hairpin structure of the positive partition primer.When the positive partition primer
Hairpin structure on design when having rich G base sequence, then react, can be realized to the rapid visual of copper ion without HCR
Change detection.For example, the positive partition primer is (SEQ ID NO:8)：
5 '-GTGGGTAGGGCGGGTTGG- interruptions-
CCAACCCGCCCTACCCACTCATCGCACCGTCAAAGGAACC-3′
Method above-mentioned, the probe in the reaction system of HCR at least containing a band hairpin structure, the hairpin structure
Base composition and the base sequence of the positive partition primer hairpin structure are essentially identical, and the PCR product is inspired
HCR reaction.
Preferably, 3 ' ends of the substrate chain can increase the alkali of reverse primer Tm value in conjunction with template added with one section
Basic sequence, so that the control of PCR annealing temperature is at 50-60 DEG C.
Preferably, the blocker is poly- six ethylene glycol.
Method above-mentioned, substrate chain used in copper ion detection, enzyme chain, positive partition primer, reverse primer, template and
Following (the SEQ ID NO of the base sequence of 2 probes:1-7)：
Substrate chain：5′-AGCTTCTTTCTAATACGG-CTTACCTTGGGGGGTT-3′
Enzyme chain：5′-AAAAAAAAGGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3′
Forward direction partition primer：Poly- six ethylene glycol-of 5 '-AGTCTAGGATTCGGCGTCCCTTAA-
TTAAGGGACGCCGAATCCTAGACTTCATCGCACCGTCAAAGGAACC-3′
Reverse primer：5′-CTTACCTTGGGGGGGGGGTT-3′
Template：5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAAACCCCCCCC
CCAAGGTAAGCCCCAATTTCGCCATCTTCC-3′
Probe 1：5′-AGGGCGGGTGGGTTAAGGGACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTC
GGGT-3′
Probe 2：5′-GGGTAGTCTAGGATTCGGCGTCCCTTAAGACGCCGAATCCTAGACTACTTTGAGGGCGGG
TGGG-3′
Wherein ,-indicate copper ion cleavage site；Base is to distinguish substrate chain and enzyme chain length at enzyme chain underscore.
The present invention also provides detection kit matched with the above method, the kit includes at least following component：Bottom
Object chain, enzyme chain, positive partition primer, template, probe 1 and probe 2 etc..
The detection and analysis principle of kit of the present invention：Substrate chain hybridize formation with specific copper with enzyme chain first
The ribozyme of ion cleavage activity, existing for the copper ion under the conditions of cleavage reaction occurs, the nucleic acid fragment cut down can be with
Template, which combines, carries out PCR extension, since the partition effect of primer hinders the extension of polymerase, so that PCR product is with rush
The particular sequence of HCR is sent out, HCR product (contains K under suitable buffer condition in buffer+) tetra- serobila of G is formed, it is catalyzed H2O2
It develops the color with ABTS, and then completes to detect the quick visualization of copper ion.
The specific detection method is as follows：
1) building of ribozyme：Substrate chain and enzyme chain are mixed in equimolar ratio, are diluted to 1 μM of -2 μ of concentration with buffer
Then M, 85-95 DEG C of heating 15min are slowly dropped to 25-37 DEG C (about time-consuming 45min) to get ribozyme liquid；
2) cleavage reaction：Testing sample solution is added into the above-mentioned ribozyme liquid of 35 μ L, 40 μ L systems are formed, in 36-38 DEG C
It is incubated for 4-6min, 4-6 μ L terminate liquid is then added, obtains cleaved products；
3) hypervelocity PCR reaction：It prepares slow by forward direction partition primer, cleaved products, template, archaeal dna polymerase, dNTP, reaction
Fliud flushing and ddH2The PCR reaction system of O composition, is arranged following response procedures：90-95 DEG C of 2s, 55-60 DEG C of 3s, 30-40 are followed
Ring carries out PCR reaction, obtains PCR product；
4) HCR reacts：The HCR reaction system being made of probe 1, probe 2, PCR product and self assembly buffer is constructed, in
37 DEG C of reaction 30-60min, obtain HCR product；
5) chromogenic reaction：80 μ L enzyme activity buffers, 10 μ L hemin solution are mixed with 10 μ L HCR products, in
100 μ L ABTS developing solutions are added in 37 DEG C of reaction 30min, mix, and 37 DEG C are protected from light incubation 5-10min, before developing solution is added
Afterwards the variation of solution colour come judge in sample to be tested whether the height containing copper ion and copper ion concentration.Naked eyes can be passed through
The variation of solution colour is directly observed, or is changed using the OD value of microplate reader measurement solution.
Wherein, the formula of the step 1) buffer is：250mM HEPES buffer solution (pH=7.0), 2.5M NaCl,
500mM ascorbic acid and 2.5M KCl (matching while using).
The formula of the step 2) terminate liquid is：0.2M EDTA, 2M NaCl, 0.5M Tris.
The formula of step 4) the self assembly buffer is：8mM Na2HPO4,2.5mM NaH2PO4,0.15M NaCl,
2mM MgCl2,pH 7.4。
The formula of step 5) the enzyme activity buffer is：100mM Tris,120mM NaCl,10mM MgCl2、100mM
KCl, pH8.4.
The preparation method of step 5) the hemin solution is：The chlorine siderosis for being 20mM with DMSO compound concentration
Red pigment stoste, 2 μ L hemin stostes are mixed with enzyme activity buffer described in 1mL to get.
Preferably, PCR reaction system is as follows in step 3)：
The construction method of HCR reaction system is as follows in step 4)：
1. probe 1, probe 2 are dissolved to 100 μM with water respectively, in 90-95 DEG C of heating 5min, it is then slowly dropped to room temperature
It is spare；
2. PCR product is added in the mixed liquor of final concentration of 2 μM -3 μM of probe 1 and probe 2, and it is slow that self assembly is added
Fliud flushing is to 50 μ L of total volume.
A series of copper ion standard solution for preparing concentration, is detected according to the method described above.Step 5) utilizes microplate reader
Measure solution O D415Value changes the standard curve that drafting develops the color according to solution colour to judge the situation that develops the color：Y=0.0088x+
0.011, R2=0.9993, so that the quantitative detection to copper ion can be realized.
The copper ion detection limit of this method is 10-100nM.
By above-mentioned technical proposal, the present invention at least has following advantages and beneficial effect：
The present invention by establishing a kind of partition rapid amplifying copper ion cutting-type functional nucleic acid colorimetric sensor, for copper from
The quick visualization detection of son.According to the specific ribozyme of copper ion, its ultrafast polymerase chain of progress of design partition primer pair
Reaction, in conjunction with rich G sequence in K+Being formed under existence condition has active tetra- serobila of G of peroxidase, constructs a kind of new
The copper cutting-type functional nucleic acid colorimetric sensor based on general partition primer of type, and provide a kind of quick, visual copper from
Sub- new detecting method.Greatly shorten the detection time of sample, detection limit reaches nM grades, and the present invention successfully solves PCR production
The visualization problem of object, to the scene that solves, detection has important practical significance real-time, quickly.
(1) this method constructed partition primer for the first time, carries out ultrafast amplification to template, by time-consuming 3 hours or so tradition
PCR process is reduced to 10 minutes, significantly reduces the used time of PCR reaction.
(2) the partition effect of primer hinders the extension of polymerase, obtains single strand nucleotide sequence.It is anti-HCR can be inspired
It answers, so that product (contains K under appropriate conditions in buffer+) formed with active tetra- serobila of G of peroxidase.
(3) color change occurs for PCR product or HCR product and ABTS, solves normal PCR product and is difficult to visualization inspection
The problem of survey.
(4) this method can realize the high-volume of copper ion, quickly detection.
Detailed description of the invention
Fig. 1 is that copper ion ribozyme prepares and cuts the result of verifying in the embodiment of the present invention 1；Wherein, swimming lane 1：Ribozyme-
Ca；Swimming lane 2-4：Cutting system.
Fig. 2 is the surface structure of hypervelocity PCR instrument in the embodiment of the present invention 1.
Fig. 3 is the glue figure of hypervelocity pcr amplification product in the embodiment of the present invention 1；Wherein, 1：DNA Marker2000；Swimming lane
2-3：Copper ion hypervelocity PCR product.
Fig. 4 is the standard song for drawing colour developing in the embodiment of the present invention 1 according to various concentration copper ion and solution colour variation
Line.
Fig. 5 is that the specificity of detection method in the embodiment of the present invention 2 investigates result.
Fig. 6 is the optimum results in HCR reaction time in the embodiment of the present invention 4；Wherein, M：DNA Marker2000；1：2μM
Hairpin 1；2：2μM Hairpin 2；3：2 μM of Hairpin 1+2 μM Hairpin 2+PCR product 10min；4：2μM
Hairpin 1+2 μM Hairpin 2+PCR product 20min；5：2 μM of Hairpin 1+2 μM Hairpin 2+PCR products
30min；6：2 μM of Hairpin 1+2 μM Hairpin 2+PCR product 40min；7：2μM Hairpin 1+2μM Hairpin
2+PCR product 50min.
Fig. 7 is the optimum results of hairpin probe sequence in HCR reaction in the embodiment of the present invention 5；Wherein, 1-4 corresponds to group
3,1：hairpin5；2：hairpin6；3-4：Hairpin5+hairpin6+ inspires son；5-8 corresponds to group 2,1：hairpin3；
2：hairpin4；7-8：Hairpin3+hairpin4+ inspires son；9-12 corresponds to group 1,1：hairpin1；2：hairpin2；
11-12：Hairpin1+hairpin2+ inspires son.
Fig. 8 is the hypervelocity PCR amplification result of cleaved products in the embodiment of the present invention 6；Wherein, 1：DNA Marker2000,
2：Feminine gender, 3-5：Experimental group.
Fig. 9 is the standard song for drawing colour developing in the embodiment of the present invention 6 according to various concentration copper ion and solution colour variation
Line.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
Used in the conventional means that are well known to those skilled in the art of technological means, raw materials used is commercial goods.
In the present invention, the formula of ABTS developing solution is：1mL DNAzyme substrate buffer solution, citric acid 0.933g, distilled water
100mL, 5 μ L ABTS substrate solutions, 1 μ L 30%H2O2。
DNAzyme substrate buffer solution：The as citrate buffer of pH 3.6, is formulated and is：Na2HPO4.12H2O
1.843g citric acid 0.933g, distilled water 100mL.
ABTS substrate solution：Take 20mg 2,2 '-connection bis- (3- ethyl benzo thiazole phenanthroline -6- sulfonic acid) the diammonium salt powders of nitrogen (purchase
From Sigma company) be dissolved in 1mL DMSO to get.
The foundation of the ultrafast amplification visible sensor of the general partition of 1 copper ion cutting-type of embodiment
1, experimental material
SYBR Gold nucleic acid dye, nucleic acid molecular weight standard ultra-low range DNA ladder, dNTP, Ex
Taq DNA polymerase, 10 × Taq buffer, hemin, copper chloride, ascorbic acid, 2,2- join (the 3- second of nitrogen-two
Base-benzothiazole -6- sulfonic acid) diamine salts (ABTS), H2O2, 4- hydroxyethyl piperazineethanesulfonic acid (HEPES), MES, LiCl, Tris,
Potassium chloride, sodium chloride, magnesium chloride, disodium ethylene diamine tetraacetate, sulfuric acid, tetramethyl benzidine, urea are purchased from the silent winged science and technology of match
(Thermo Scientific Life Technologies).Experimental water is all from Milli-Q pure water system.
Following (the SEQ ID NO of sequence design:1-7)：
Note：Ribozyme cuts target product and amplification 3 ' terminal sequence of template is complementary；Underscore is to distinguish enzyme chain and substrate
The size of chain；
Overstriking base sequence added by ribozyme substrate chain end is to increase the Tm value in conjunction with template；Cleavage site is used
"-" indicates；
Ribozyme substrate chain-Cu and ribozyme enzyme chain-Cu collectively constitutes the specific ribozyme (ribozyme-Cu) of copper ion.
2, the building of ribozyme and the verifying of cleavage reaction system
By 4 μ L ribozyme substrate chain-Cu (10 μM of mother liquors) and 4 μ L ribozyme enzyme chain-Cu (10 μM of mother liquors) buffer (250mM
HEPES buffer solution (pH=7.0), 2.5M NaCl, 500mM ascorbic acid and 2.5M KCl, matching while using) it is diluted to 40 μ L, 95
DEG C heating 15min, be then slowly dropped to 37 DEG C, about time-consuming 45min.
It is added 5 μ L copper chloride solutions (1 μM of mother liquor), forms 40 μ L systems, be incubated for 5 minutes at 37 DEG C, in 40 μ L systems
5 μ L terminate liquids of middle addition (concentration is 0.2M EDTA, 2M NaCl, 0.5M Tris), 4 DEG C of preservations after mixing.With 20% denaturation
Polyacrylamide gel electrophoresis verifying, obtain copper ion ribozyme cutting after small fragment, it was demonstrated that the preparation of copper ion ribozyme with cut
It is cut into function (Fig. 1).
3, exceed the speed limit PCR device build and the foundation and verifying of the PCR reaction system that exceeds the speed limit
The primary structure for the PCR device that exceeds the speed limit is as shown in Fig. 2, its specific structure, connection type and working principle, worked
Journey includes：The temperature change for the PCR device that exceeds the speed limit is come via one 95 DEG C of high temperature water bath and one 58 DEG C of medium temperature water-bath
It realizes.The sample room PCR is used as using the capillary (20 μ L, 04 929 292 001, Roche) of Light Cycler model.It is logical
The mode of rapid centrifugation is crossed, sample can gather each capillary one end respectively；The capillary quilt of sample is had after the completion of centrifugation
It is fixed on a dedicated plastic stent.
Copper ion hypervelocity PCR system is as follows：
In actually detected, cleaved products refer in above-mentioned cleavage reaction system, replace standard specimen with sample to be tested.
10 μ L reaction systems are prepared on ice, are immediately placed in hypervelocity PCR reaction unit and are carried out temperature control.Exceed the speed limit PCR
Response procedures：95 DEG C of 2s, 58 DEG C of 3s, 36 circulations, amount to 3min.
Hypervelocity PCR reaction process is completed, is imitated using the amplification that 2% agarose gel electrophoresis verifies hypervelocity PCR reaction system
Fruit, reaction condition：120V 0.5h, camera system：Molecular Imager Gel Doc XR(Bio-Rad).
The experimental results showed that template can be made to be expanded (Fig. 3) in a short time in the presence of cleaved products.
4, PCR product self assembly
Hairpin probe Hairpin 1, Hairpin 2 is dissolved to 100 μM with ultrapure water respectively, in 95 DEG C of heating 5min, so
After be slowly dropped to room temperature, it is spare；Hypervelocity PCR reaction is completed according to hypervelocity PCR reaction system and response procedures, the PCR that will exceed the speed limit is anti-
It answers product to be added in 2 mixed liquor of final concentration of 2 μM of Hairpin 1 and Hairpin, and self assembly buffer (8mM is added
Na2HPO4,2.5mM NaH2PO4,0.15M NaCl,2mM MgCl2, pH 7.4) so that the total volume of each reaction system is 50
μ l, carries out HCR reaction by 37 DEG C, 30min.
5, the foundation and verifying for the module that develops the color
80 μ L enzyme activity buffer (100mM Tris, 120mM NaCl, 10mM MgCl2, 100mM KCl, pH8.4), 10 μ L
Hemin solution and 10 μ L HCR products, 37 DEG C of reaction 30min after mixing make HCR product combination hemin
Being formed has active tetra- stranded structure of G of peroxidase, and 100 μ L ABTS developing solutions are added, and mixes, 37 DEG C are protected from light incubation
10min, microplate reader measure OD415。
The preparation method of the hemin solution is：The hemin for being 20mM with DMSO compound concentration is former
Liquid, 2 μ L hemin stostes are mixed with enzyme activity buffer described in 1mL to get.
6, copper ion hypersensitive, visual quickly detection
According to above-mentioned optimization system, it is separately added into the 10 of the various concentration, Cu of 20,50,80,100nM2+Cleaved products into
The ultrafast PCR of row, carries out self assembly for PCR, develops the color under suitable buffer condition, and the mark of colour developing is drawn according to color change
Directrix curve (Fig. 4).
Cu2+Detection range is 10-100nM (can realize quantitative detection within this range), and minimum detectability is 2.6nM.
The specificity of 2 sensor of embodiment is investigated
According to the biosensor that embodiment 1 constructs, respectively by 10nM Cu2+, 10 μM of Mg2+、Cd2+、Ca2+、Zn2+、Cr3 +、Pb2+、Fe2+It is added in system and is detected, the results showed that, the Cu established2+Biosensor has preferable specificity
(Fig. 5).
The experiment of 3 mark-on of embodiment
High purity water is taken to be detected with the biosensor that embodiment 1 constructs, Cu2+Without detection, mark-on experiment is carried out to it,
The multiple acquired results of METHOD FOR CONTINUOUS DETERMINATION are shown in Table 1.
1 Cu of table2+Recovery testu result
The optimization in embodiment 4HCR reaction time
According to the biosensor that embodiment 1 constructs, probe 1, probe 2 are dissolved to 100 μM with water respectively, added in 95 DEG C
Then it is spare to be slowly dropped to room temperature by hot 5min；PCR product is added in the mixed liquor of final concentration of 2 μM of probe 1 and probe 2,
And self assembly buffer is added to 50 μ L of total volume.The HCR reaction time be respectively 10min, 20min, 30min, 40min,
50min.As a result see Fig. 6, enough long double-strands can be formed as seen from Figure 6, in 30min, it is thus determined that the reaction time
For 30min.
The optimization of hairpin probe sequence in embodiment 5HCR reaction
According to the biosensor that embodiment 1 constructs, following hairpin probe combination experiment group (table 2) is designed.It is used to inspire
The base sequence of son is as follows：5′-AGTCTAGGATTCGGCGTCCCTTAA -3′.
Table 2
As a result see Fig. 7, as seen from Figure 7, the effect that experimental group 1 inspires HCR is best, therefore the present invention is selected hair clip
Probe combinations Hairpin 1+Hairpin 2 inspires sequence as HCR.
Method of the embodiment 6 based on biosensor technology detection copper ion
1, experimental material
SYBR Gold nucleic acid dye, nucleic acid molecular weight standard ultra-low range DNA ladder, dNTP, Ex
Taq archaeal dna polymerase, 10 × Taq buffer, hemin, copper chloride, ascorbic acid, 2,2- join (the 3- ethyl-of nitrogen-two
Benzothiazole -6- sulfonic acid) diamine salts (ABTS), H2O2, 4- hydroxyethyl piperazineethanesulfonic acid (HEPES), MES, LiCl, Tris, chlorination
Potassium, sodium chloride, magnesium chloride, disodium ethylene diamine tetraacetate, sulfuric acid, tetramethyl benzidine, urea are purchased from the silent winged science and technology of match
(Thermo Scientific Life Technologies).Experimental water is all from Milli-Q pure water system.
Sequence design is as follows：
Note：Ribozyme cuts target product and amplification 3 ' terminal sequence of template is complementary；
Overstriking base sequence added by ribozyme substrate chain end is to increase the Tm value in conjunction with template；Cleavage site is used
"-" indicates；
Ribozyme substrate chain-Cu and ribozyme enzyme chain-Cu collectively constitutes the specific ribozyme (ribozyme-Cu) of copper ion.
2, the building of ribozyme and the verifying of cleavage reaction system
By 4 μ L ribozyme substrate chain-Cu (10 μM of mother liquors) and 4 μ L ribozyme enzyme chain-Cu (10 μM of mother liquors) buffer (250mM
HEPES buffer solution (pH=7.0), 2.5M NaCl, 500mM ascorbic acid and 2.5M KCl) it is diluted to 40 μ L, 95 DEG C of heating
Then 15min is slowly dropped to 37 DEG C, about time-consuming 45min.
It is added 5 μ L copper chloride solutions (1 μM of mother liquor), the sodium ascorbate of 50mM, forms 40 μ L systems, be incubated at 37 DEG C
5 minutes, 5 μ L terminate liquids (concentration is 0.2M EDTA, 2M NaCl, 0.5M Tris) is added in 40 μ L systems, 4 take the photograph after mixing
Family name's degree saves.It is verified with 20% denaturing polyacrylamide gel electrophoresis, the small fragment after obtaining the cutting of copper ion ribozyme, it was demonstrated that
The preparation of copper ion ribozyme and cut successfully (Fig. 1).
3, copper ion hypervelocity PCR system is as follows：
In actually detected, cleaved products refer in above-mentioned cleavage reaction system, replace standard specimen with sample to be tested.
10 μ L reaction systems are prepared on ice, are immediately placed in hypervelocity PCR reaction unit and are carried out temperature control.Exceed the speed limit PCR
Response procedures：95 DEG C of 2s, 58 DEG C of 3s, 36 circulations, amount to 3min.
Hypervelocity PCR reaction process is completed, is imitated using the amplification that 2% agarose gel electrophoresis verifies hypervelocity PCR reaction system
Fruit, reaction condition：120V 0.5h, camera system：Molecular Imager Gel Doc XR(Bio-Rad).
The experimental results showed that template can be made to be expanded (Fig. 8) in a short time in the presence of cleaved products.
4, the foundation and verifying for the module that develops the color
80 μ L enzyme activity buffer (100mM Tris, 120mM NaCl, 10mM MgCl2, 100mM KCl, pH8.4), 10 μ L
Hemin solution and 10 μ L PCR products, 37 DEG C of reaction 30min, make PCR product combination hemin after mixing
Being formed has active tetra- stranded structure of G of peroxidase, and the H of 100 μ L ABTS developing solutions and 1ul 30% is added2O2, mix
Even, 37 DEG C are protected from light incubation 10min, and microplate reader measures OD415。
The preparation method of the hemin solution is：The hemin for being 20mM with DMSO compound concentration is former
Liquid, 2 μ L hemin stostes are mixed with enzyme activity buffer described in 1mL to get.
6, copper ion hypersensitive, visual quickly detection
According to above-mentioned optimization system, it is separately added into the 100 of the various concentration, Cu of 200,500,800,1000nM2+Cutting
Product carries out ultrafast PCR, and PCR is carried out self assembly, develops the color under suitable buffer condition, is drawn according to color change aobvious
The standard curve (Fig. 9) of color.
Cu2+Detection range is 0.1 μM -1 μM (can realize quantitative detection within this range), and minimum detectability is 54nM.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be modified or is improved, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>China Agricultural University
<120>A kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type
<130> KHP181111565.9
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 34
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
agcttctttc taatacggct taccttgggg ggtt 34
<210> 2
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
aaaaaaaagg taagcctggg cctctttctt tttaagaaag aac 43
<210> 3
<211> 70
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
agtctaggat tcggcgtccc ttaattaagg gacgccgaat cctagacttc atcgcaccgt 60
caaaggaacc 70
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
cttaccttgg ggggggggtt 20
<210> 5
<211> 91
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
tcatcgcacc gtcaaaggaa cctcagtatc agtgctatac gtcgatcagt aaaccccccc 60
cccaaggtaa gccccaattt cgccatcttc c 91
<210> 6
<211> 64
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
agggcgggtg ggttaaggga cgccgaatcc tagactcaaa gtagtctagg attcggcgtc 60
gggt 64
<210> 7
<211> 64
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
gggtagtcta ggattcggcg tcccttaaga cgccgaatcc tagactactt tgagggcggg 60
tggg 64
<210> 8
<211> 58
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
gtgggtaggg cgggttggcc aacccgccct acccactcat cgcaccgtca aaggaacc 58
Claims (10)
1. a kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type, which is characterized in that including：(1) cutting body
System, (2) sPCR amplification system, (3) HCR system, (4) include the detection architecture of ABTS developing solution；
The detection architecture is used to successively carry out sample to be tested via the cutting system, sPCR amplification system and HCR system
Products therefrom carries out color developing detection after reaction；
Wherein, the cutting system includes substrate chain and enzyme chain：
Substrate chain：5′-AGCTTCTTTCTAATACGG-CTTACC-3′
Enzyme chain：5′-GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3′
Wherein ,-indicate copper ion cleavage site；
The sPCR amplification system includes：Forward direction partition primer, reverse primer, template：
Forward direction partition primer：5 '-AGTCTAGGATTCGGCGTCCCTTAA- interruptions-
TTAAGGGACGCCGAATCCTAGACTTCATCGCACCGTCAAAGGAACC-3′
Reverse primer：5′-CTTACCTTGGGGGGGGGGTT-3′
Template：5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAAACCCCCCCCCCAA
GGTAAGCCCCAATTTCGCCATCTTCC-3′
The HCR system includes 2 probes：
Probe 1：5′-AGGGCGGGTGGGTTAAGGGACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTCGGGT
-3′
Probe 2：5′-GGGTAGTCTAGGATTCGGCGTCCCTTAAGACGCCGAATCCTAGACTACTTTGAGGGCGGGTGGG
-3′。
2. sensor according to claim 1, which is characterized in that the interruption in the positive partition primer is poly- six second
Glycol.
3. sensor according to claim 1 or 2, which is characterized in that the detection architecture includes：Enzyme activity buffer and chlorine
Protoferriheme solution.
4. any one of the claim 1-3 sensor in terms of detect copper ion in application.
5. application according to claim 4, which is characterized in that described to be detected as qualitative detection or quantitative detection.
6. the method for carrying out qualitative detection to copper ion using any one of the claim 1-3 sensor, which is characterized in that packet
Include following steps：
S1, sample to be tested is added into the cutting system, carries out cleavage reaction；
S2, ultrafast polymerase chain reaction will be carried out in the addition of cleaved products obtained by the S1 sPCR amplification system, obtains sPCR production
Object；
S3, progress HCR reaction in the HCR system is added in the sPCR product, obtains HCR product；
S4, the HCR product is detected using the detection architecture.
7. according to the method described in claim 6, it is characterized in that, S1 is specific as follows：Substrate chain and enzyme chain are pressed into equimolar ratio
Example mixing, is diluted to 1 μM -2 μM of concentration with buffer, then 85 DEG C of -95 DEG C of heating 15min are cooled to 25-37 DEG C, obtain core
Enzyme solution；Testing sample solution is added into ribozyme liquid described in 35 μ L, forms 40 μ L systems, in 36-38 DEG C of incubation 4-6min, then
4-6 μ L terminate liquid is added, obtains cleaved products.
8. according to the method described in claim 6, it is characterized in that, the detection architecture includes enzyme activity buffer and chlorine siderosis
Enzyme activity buffer, hemin dilute solution and HCR product are 8 by red pigment dilute solution by volume:1:1 mixes,
20-40min, addition and the isometric ABTS developing solution of aforementioned mixture are reacted under the conditions of 35-38 DEG C, are mixed, 35-38 DEG C is protected from light
It is incubated for, is visually monitored.
9. the method for carrying out quantitative detection to copper ion using any one of the claim 1-3 sensor, which is characterized in that packet
Include following steps：
SI, production standard curve：
Using the copper ion solution of known concentration, the cutting system with different copper ion concentrations is constructed, sPCR amplification, HCR are anti-
Should and detecting step it is identical as the step in claim 6；
Using copper ion concentration as abscissa, with OD415Value is ordinate, draws standard curve；
SII, sample to be tested is detected according to the method for claim 6, the OD that will be measured415Value substitutes into standard curve,
The content of copper ion in sample to be tested is calculated, realizes the quantitative detection to copper ion.
10. according to the method described in claim 9, it is characterized in that, the concentration ranges of the difference copper ion concentration are 10-
100nM。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810639041.3A CN108841938B (en) | 2018-06-20 | 2018-06-20 | Copper ion cutting type universal partition ultrafast amplification visual sensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810639041.3A CN108841938B (en) | 2018-06-20 | 2018-06-20 | Copper ion cutting type universal partition ultrafast amplification visual sensor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108841938A true CN108841938A (en) | 2018-11-20 |
| CN108841938B CN108841938B (en) | 2020-10-02 |
Family
ID=64202634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810639041.3A Active CN108841938B (en) | 2018-06-20 | 2018-06-20 | Copper ion cutting type universal partition ultrafast amplification visual sensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108841938B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107976436A (en) * | 2017-10-27 | 2018-05-01 | 中国农业大学 | A kind of nucleic acid sensor of resistance to high salt of copper and its application |
-
2018
- 2018-06-20 CN CN201810639041.3A patent/CN108841938B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107976436A (en) * | 2017-10-27 | 2018-05-01 | 中国农业大学 | A kind of nucleic acid sensor of resistance to high salt of copper and its application |
Non-Patent Citations (1)
| Title |
|---|
| JINGJING TIAN, ET AL.: "Visual Single Cell Detection of Dual-Pathogens based on Multiplex Super PCR (MS-PCR) and Asymmetric Tailing HCR (AT-HCR)", 《SENSORS AND ACTUATORS B》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108841938B (en) | 2020-10-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107271668A (en) | The method and kit of a kind of multi signal detection mycotoxin | |
| CN107190063A (en) | A kind of method of pathogenic bacteria in isothermal rapid amplifying detection food | |
| CN106370638A (en) | Colorimetric and fluorescent double-signal biosensor for detecting Hg<2+>, and detection method of biosensor | |
| CN108949931A (en) | A kind of general ultrafast amplification visible sensor of partition of zinc ion cutting-type | |
| Xiang et al. | Highly sensitive fluorescence quantitative detection of specific DNA sequences with molecular beacons and nucleic acid dye SYBR Green I | |
| CN107254550A (en) | A kind of spr sensor of detection HIV related genes and its preparation and application | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| CN109161583A (en) | The method for the cycle index augmentation detection alkaline phosphatase that primer dephosphorylation causes | |
| CN108949932A (en) | It is general to separate ultrafast amplification copper, calcium cutting-type functional nucleic acid visible detection method | |
| CN108841937A (en) | It is general to separate ultrafast amplification magnesium, zinc cutting-type functional nucleic acid visible detection method | |
| CN108949934A (en) | A kind of general ultrafast amplification visible sensor of partition of chromium ion cutting-type | |
| Li et al. | An autonomous synthetic DNA machine for ultrasensitive detection of Salmonella typhimurium based on bidirectional primers exchange reaction cascades | |
| CN105838790B (en) | A kind of silver nanoclusters sensor and preparation method thereof and the application in detection viral gene | |
| CN108949917B (en) | Mercury ion mismatch type general partition ultrafast amplification colorimetric sensor | |
| CN108841938A (en) | A kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type | |
| CN106755379B (en) | Dimer mutation fluorescent primer quantitative PCR method for synchronously quantifying and genotyping 4 aspergillus | |
| CN108949936A (en) | A kind of general ultrafast amplification visible sensor of partition of magnesium ion cutting-type | |
| Zhang et al. | A CRISPR/Cas12a-assisted array for Helicobacter pylori DNA analysis in saliva | |
| CN108841935A (en) | A kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type | |
| CN107893120A (en) | The detection method and application of the primer sets of detection motion gene SNP and its application and product and detection motion gene SNP | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN109022561B (en) | Universal partition ultrafast amplification mercury and copper mismatch type functional nucleic acid colorimetric sensor | |
| CN103472236A (en) | Method for detecting DNA (deoxyribonucleic acid) binding protein | |
| CN108929896B (en) | Copper ion mismatch type universal partition ultrafast amplification colorimetric sensor | |
| CN108949918A (en) | It is general to separate ultrafast amplification magnesium, sodium cutting-type functional nucleic acid visible detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |