CN108841935A - A kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type - Google Patents
A kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type Download PDFInfo
- Publication number
- CN108841935A CN108841935A CN201810634838.4A CN201810634838A CN108841935A CN 108841935 A CN108841935 A CN 108841935A CN 201810634838 A CN201810634838 A CN 201810634838A CN 108841935 A CN108841935 A CN 108841935A
- Authority
- CN
- China
- Prior art keywords
- sodium ion
- hcr
- detection
- solution
- chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type, including:(1) system is cut, (2) sPCR amplification system, (3) HCR system, (4) include the detection architecture of ABTS developing solution.The present invention is by dexterously design primer, template and probe, so that can carry out ultrafast amplification to template in the presence of sodium ion, amplified production is reacted by inspiring HCR, so that product forms tetra- serobila of G in control environment.It is further developed the color using the peroxidase activity of tetra- serobila of G, solves the problems, such as that normal PCR product is difficult to Visual retrieval, realize quick, Visual retrieval to sodium ion.Moreover, sensor provided by the invention has the characteristics that high special, highly sensitive that testing result is more objective, accurate to sodium ion.
Description
Technical field
The present invention relates to biosensor technology fields, specifically, it is super to be related to a kind of general partition of sodium ion cutting-type
Fast amplification visible sensor.
Background technique
Sodium is a kind of metallic element, and chemical symbol is Na, and atomic number is 11, and atomic weight is 22.9898, belongs to group ia,
It is the representative of alkali metal element, it is soft, it can be reacted with water and generate sodium hydroxide, release hydrogen, chemical property is more active.Sodium
Element is widely distributed in land and ocean in a salt form, sodium be also in human muscular tissue and nerve fiber it is important at
/ mono-.The intake of sodium mainly passes through food salt intake in human body, and having lacked it will distaste for food, and also feel weak nothing
Power;If but long-term intake is excessive, is easy to unhealthful, induces an illness, such as increase the protein content in urine, draws
It plays adrenal gland and brain tissue discharges one kind and makes the increased factor of cell excitability, lead to arterial contraction, blood pressure increases.Blood pressure increases
It is that about 62% apoplexy and 49% Etiological of coronary heart disease are high the main reason for leading to cardiovascular disease
Blood pressure.
Currently, both at home and abroad detection sodium ions content method it is very much, as the chromatography of ions, flame atomic emission pectrometry,
NITRATE BY FLAME ATOMIC receives the method etc. that method, Flow Injection Technique and ion selective electrode combine.Using these methods measurement sodium from
The research achievement of sub- content also has a corresponding report, but it is cumbersome, time-consuming, and the personnel of profession is needed to operate.
Therefore, develop it is simple and quick, low in cost, can accurate quantitative analysis detection method it is very necessary.
Summary of the invention
The object of the present invention is to provide a kind of general ultrafast amplification visible sensors of partition of sodium ion cutting-type.
In order to achieve the object of the present invention, inventor is according to the specific ribozyme of sodium ion, design general partition primer pair its
Ultrafast polymerase chain reaction (super Polymerase Chain Reaction, sPCR) is carried out, in conjunction with rich G sequence in K+
Being formed under existence condition has active tetra- serobila of G of peroxidase, constructs a kind of novel sodium based on partition primer
Ion cutting-type functional nucleic acid colorimetric sensor.
In a first aspect, the present invention provides a kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type, including:
(1) system is cut, (2) sPCR amplification system, (3) HCR system, (4) include the detection architecture of ABTS developing solution.
The detection architecture is used for sample to be tested successively via the cutting system, sPCR amplification system and HCR system
Products therefrom carries out color developing detection after being reacted;
Wherein, the cutting system includes substrate chain and enzyme chain:
Substrate chain:5′-CTCTATCTATrA-GGAAGTACCGCCGC-3′
Enzyme chain:5′-GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTAGATAGAG
-3′
Wherein, rA indicates ribonucleic acid;Indicate sodium ion cleavage site;
The sPCR amplification system includes:Forward direction partition primer, reverse primer, template:
Forward direction partition primer:5 '-AGACGAAGCACTGGTTGAAACTCC- blocker-
GGAGTTTCAACCAGTGCTTCGTCTTCATCGCACCGTCAAAGGAACC-3′
Reverse primer:5′-GGAAGTACCGCCGCGGAGGGA-3′
Template:5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAGCCCCGAATT
TCGCCATCTTCCTCCCTCCGCGGCGGTACTTCC-3′
The HCR system includes 2 probes:
Probe 1:5′-AGGGCGGGTGGGTGGAGTTTCAACCAGTGCTTCGTCTCCCCAGACGAAGCACTGGTTGAT
GGGT-3′
Probe 2:5′-TGGGTAGACGAAGCACTGGTTGAAACTCCTCAACCAGTGCTTCGTCTGGGGTGGGTAGGG
CGGG-3′。
Wherein, the interruption in the positive partition primer is poly- six ethylene glycol.
The archaeal dna polymerase be Ex Taq archaeal dna polymerase, the buffer be 10 × Ex Taq Buffer, the two with
It is silent winged scientific and technological (Thermo Scientific Life Technologies) that the dNTP is purchased from match.
Detection architecture of the present invention includes:Enzyme activity buffer, hemin solution.
Wherein, the enzyme activity buffer is:100mM Tris,120mM NaCl,10mM MgCl2, 100mM KCl,
pH8.4。
The hemin stoste that the hemin solution is 20mM is with above-mentioned enzyme activity buffer according to 2 μ L:
The mixed hemin dilute solution of the ratio of 1mL.
Application during the present invention also provides sensor as aforementioned in terms of detect sodium ion, the detection can behave as qualitative inspection
Survey or quantitative detection.
Second aspect, the present invention provides a kind of method for carrying out qualitative detection to sodium ion using sensor as aforementioned, packets
Include following steps:
S1, sample to be tested is added into the cutting system, carries out cleavage reaction;
S2, ultrafast polymerase chain reaction will be carried out in the addition of cleaved products obtained by the S1 sPCR amplification system, obtained
SPCR product;
S3, progress HCR reaction in the HCR system is added in the sPCR product, obtains HCR product;
S4, the HCR product is detected using the detection architecture.
S1 is specific as follows:Substrate chain and enzyme chain are mixed in equimolar ratio, are diluted to 1 μM -2 μM of concentration with buffer,
85 DEG C of -95 DEG C of heating 15min, are then cooled to 25-37 DEG C, obtain ribozyme liquid;It is added into ribozyme liquid described in 35 μ L to test sample
Product solution forms 40 μ L systems, in 36-38 DEG C of incubation 4-6min, 4-6 μ L terminate liquid is then added, obtains cleaved products.
Further, the detection architecture includes enzyme activity buffer and hemin dilute solution, and enzyme activity is buffered
Liquid, hemin dilute solution and HCR product are 8 by volume:1:1 mixes (total volume is 100 μ L), at 35-38 DEG C
Under the conditions of react 20-40min, be added with the isometric ABTS developing solution of aforementioned mixture, mix, 35-38 DEG C is protected from light incubation, meat
Eye is monitored.
The third aspect, the present invention provides a kind of method for carrying out quantitative detection to sodium ion using sensor as aforementioned, packets
Include following steps:
SI, production standard curve:
Using the sodium ion solution of known concentration, the cutting system with different Na ion concentrations is constructed, sPCR amplification,
The step of HCR reaction and detecting step are with aforementioned qualitative detection is identical;
Using Na ion concentration as abscissa, using OD415 value as ordinate, standard curve is drawn;
SII, sample to be tested is detected according to aforementioned qualitative checking method, it is bent that the OD415 value measured is substituted into standard
The content of sodium ion in sample to be tested is calculated in line, realizes the quantitative detection to sodium ion.
The present invention provides a kind of method based on biosensor technology detection sodium ion, first design sodium ion specificity
Ribozyme, including substrate chain and enzyme chain carry out substrate chain with enzyme chain to hybridize the core for being formed and having specific sodium ion cleavage activity
Enzyme, existing for the sodium ion under the conditions of cleavage reaction occurs, as reverse primer, (i.e. target causes the nucleic acid fragment cut down
Molecule), pcr amplification reaction is carried out to template together with forward direction partition primer, one end of gained PCR product has one section of single-stranded core
Acid sequence;The PCR product is in K+Under existence condition, tetra- serobila of G is formed, is catalyzed H2O2With ABTS develop the color, and then complete to sodium from
The quick visualization detection of son;Or
HCR reaction is inspired by PCR product, so that HCR product is in K+Tetra- serobila of G is formed under existence condition, is catalyzed H2O2With
ABTS colour developing, and then complete to detect the quick visualization of sodium ion.
In the present invention, developing solution can be substituted with TMB.
The base sequence of the substrate chain and enzyme chain is as follows:
Substrate chain:5′-CTCTATCTATrA-GGAAGTACCGCCGC-3′
Enzyme chain:5′-GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTAGATAGAG
-3′
Wherein, rA indicates ribonucleic acid;Indicate sodium ion cleavage site;
The 5 ' of the positive partition primer, which are held, has hairpin structure, at least provided with one between two sections of reverse complemental base sequences
Blocker, the blocker can block PCR to extend.
Preferably, there is richness G base sequence on the hairpin structure of the positive partition primer.When the positive partition primer
Hairpin structure on design when having rich G base sequence, then react, can be realized to the rapid visual of sodium ion without HCR
Change detection.Such as, the positive partition primer is:
5 '-GTGGGTAGGGCGGGTTGG- blocker-CCAACCCGCCCTACCCAC
TCATCGCACCGTCAAAGGAACC-3′
Method above-mentioned, the probe in the reaction system of HCR at least containing a band hairpin structure, the hairpin structure
Base composition and the base sequence of the positive partition primer hairpin structure are essentially identical, and the PCR product is inspired
HCR reaction.
Preferably, 3 ' ends of the substrate chain can increase the alkali of reverse primer Tm value in conjunction with template added with one section
Basic sequence, so that the control of PCR annealing temperature is at 50-60 DEG C.
Preferably, the blocker is poly- six ethylene glycol.
Method above-mentioned, substrate chain used in sodium ion detection, enzyme chain, positive partition primer, reverse primer, template and
Following (the SEQ ID NO of the base sequence of 2 probes:1-7):
Substrate chain:5′-CTCTATCTATrA-GGAAGTACCGCCGCGGAGGGA-3′
Enzyme chain:5′-GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTAGATAGAG
-3′
Forward direction partition primer:Poly- six ethylene glycol-of 5 '-AGACGAAGCACTGGTTGAAACTCC-
GGAGTTTCAACCAGTGCTTCGTCTTCATCGCACCGTCAAAGGAACC-3′
Reverse primer:5′-GGAAGTACCGCCGCGGAGGGA-3′
Template:5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAGCCCCGAATT
TCGCCATCTTCCTCCCTCCGCGGCGGTACTTCC-3′
Probe 1:5′-AGGGCGGGTGGGTGGAGTTTCAACCAGTGCTTCGTCTCCCCAGACGAAGCACTGGTTGAT
GGGT-3′
Probe 2:5′-TGGGTAGACGAAGCACTGGTTGAAACTCCTCAACCAGTGCTTCGTCTGGGGTGGGTAGGG
CGGG-3′
Wherein, rA indicates ribonucleic acid;Indicate sodium ion cleavage site.
The present invention also provides detection kit matched with the above method, the kit includes at least following component:Bottom
Object chain, enzyme chain, positive partition primer, template, probe 1 and probe 2 etc..
The detection and analysis principle of kit of the present invention:Substrate chain hybridize formation with specific sodium with enzyme chain first
The ribozyme of ion cleavage activity, existing for the sodium ion under the conditions of cleavage reaction occurs, the nucleic acid fragment cut down can be with
Template, which combines, carries out PCR extension, since the partition effect of primer hinders the extension of polymerase, so that PCR product is with rush
The particular sequence of HCR is sent out, HCR product (contains K under suitable buffer condition in buffer+) tetra- serobila of G is formed, it is catalyzed H2O2
It develops the color with ABTS, and then completes to detect the quick visualization of sodium ion.
The specific detection method is as follows:
1) building of ribozyme:Substrate chain and enzyme chain are mixed in equimolar ratio, are diluted to 1-2 μM of concentration with buffer,
Then 85-95 DEG C of heating 15min is slowly dropped to 25-37 DEG C (about time-consuming 45min) to get ribozyme liquid;
2) cleavage reaction:Testing sample solution is added into the above-mentioned ribozyme liquid of 35 μ L, 40 μ L systems are formed, in 36-38 DEG C
It is incubated for 6min, 4-6 μ L terminate liquid is then added, obtains cleaved products;
3) hypervelocity PCR reaction:It prepares slow by forward direction partition primer, cleaved products, template, archaeal dna polymerase, dNTP, reaction
Fliud flushing and ddH2The PCR reaction system of O composition, is arranged following response procedures:90-95 DEG C of 2s, 55-60 DEG C of 3s, 30-40 are followed
Ring carries out PCR reaction, obtains PCR product;
4) HCR reacts:The HCR reaction system being made of probe 1, probe 2, PCR product and self assembly buffer is constructed, in
37 DEG C of reaction 30-60min, obtain HCR product;
5) chromogenic reaction:80 μ L enzyme activity buffers, 10 μ L hemin solution are mixed with 10 μ L HCR products, in
37 DEG C of reaction 30min, forming HCR product combination hemin has active tetra- stranded structure of G of peroxidase,
100 μ L ABTS developing solutions are added, mix, 37 DEG C are protected from light incubation 5-10min, according to the change that developing solution front and back solution colour is added
Change judge in sample to be tested whether the height containing sodium ion and Na ion concentration.Direct visual perception solution face can be passed through
The variation of color, or changed using the OD value of microplate reader measurement solution.
Wherein, the formula of the step 1) buffer is:50mM MES, pH 6.0,25mM LiCl.
The formula of the step 2) terminate liquid is:0.2M EDTA, 2M NaCl, 0.5M Tris.
The formula of step 4) the self assembly buffer is:8mM Na2HPO4,2.5mM NaH2PO4,0.15M NaCl,
2mM MgCl2,pH 7.4。
The formula of step 5) the enzyme activity buffer is:100mM Tris,120mM NaCl,10mM MgCl2、100mM
KCl, pH8.4.
The preparation method of step 5) the hemin solution is:The chlorine siderosis for being 20mM with DMSO compound concentration
Red pigment stoste, 2 μ L hemin stostes are mixed with enzyme activity buffer described in 1mL to get.
Preferably, PCR reaction system is as follows in step 3):
The construction method of HCR reaction system is as follows in step 4):
1. probe 1, probe 2 are dissolved to 100 μM with water respectively, in 90-95 DEG C of heating 5min, it is then slowly dropped to room temperature
It is spare;
2. PCR product is added in final concentration of 2-3 μM of probe 1 and the mixed liquor of probe 2, and self assembly buffering is added
Liquid is to 50 μ L of total volume.
A series of sodium ion standard solution for preparing concentration, is detected according to the method described above.Step 5) utilizes microplate reader
Measure solution O D415Value changes the standard curve that drafting develops the color according to solution colour to judge the situation that develops the color:Y=0.005x-
0.031, R2=0.992, so that the quantitative detection to sodium ion can be realized.
The sodium ion detection limit of this method is 20-200nM.
By above-mentioned technical proposal, the present invention at least has following advantages and beneficial effect:
The present invention provides the system and method that a kind of cutting-type quickly detects sodium ion, by dexterously design primer,
Template and probe, so that ultrafast amplification can be carried out to template in the presence of sodium ion, by time-consuming 3 hours or so normal PCR mistakes
Journey is reduced to 10 minutes, significantly reduces the used time of PCR reaction.Further combined with tetra- serobila of G peroxidase activity into
Row colour developing, solves the problems, such as that normal PCR product is difficult to Visual retrieval, realizes quick, Visual retrieval to sodium ion.
Moreover, System and method for provided by the present invention has the characteristics that high special, highly sensitive, detection to sodium ion
As a result more objective, accurate.
The present invention by establishing a kind of partition rapid amplifying sodium ion cutting-type functional nucleic acid colorimetric sensor, for sodium from
The quick visualization detection of son.According to the specific ribozyme of sodium ion, its ultrafast polymerase chain of progress of design partition primer pair
Reaction, in conjunction with rich G sequence in K+Being formed under existence condition has active tetra- serobila of G of peroxidase, constructs a kind of new
The sodium cutting-type functional nucleic acid colorimetric sensor based on general partition primer of type, and provide a kind of quick, visual sodium from
Sub- new detecting method.Greatly shorten the detection time of sample, detection limit reaches nM grades, and the present invention successfully solves PCR production
The visualization problem of object, to the scene that solves, detection has important practical significance real-time, quickly.
(1) this method constructed partition primer for the first time, carries out ultrafast amplification to template, by time-consuming 3 hours or so tradition
PCR process is reduced to 10 minutes, significantly reduces the used time of PCR reaction.
(2) the partition effect of primer hinders the extension of polymerase, obtains single strand nucleotide sequence.It is anti-HCR can be inspired
It answers, so that product (contains K under appropriate conditions in buffer+) formed with active tetra- serobila of G of peroxidase.
(3) color change occurs for PCR product or HCR product and ABTS, solves normal PCR product and is difficult to visualization inspection
The problem of survey.
(4) this method can realize the high-volume of sodium ion, quickly detection.
Detailed description of the invention
Fig. 1 is that sodium ion ribozyme prepares and cuts the result of verifying in the embodiment of the present invention 1;Wherein, swimming lane 1:Ribozyme-
Na;Swimming lane 2-4:Cutting system.
Fig. 2 is the surface structure of hypervelocity PCR instrument in the embodiment of the present invention 1.
Fig. 3 is the glue figure of hypervelocity pcr amplification product in the embodiment of the present invention 1;Wherein, swimming lane 1:DNA Marker2000;
Swimming lane 2-3:Sodium ion hypervelocity PCR product.
Fig. 4 is the standard song for drawing colour developing in the embodiment of the present invention 1 according to various concentration sodium ion and solution colour variation
Line.
Fig. 5 is biosensor specific detection result in the embodiment of the present invention 2.
Fig. 6 optimizes experimental result for the HCR reaction time in the embodiment of the present invention 4;Wherein, M:DNA Marker2000;1:
It is negative;2:2μM Hairpin 1;3:2μM Hairpin 2;4:2μM Hairpin 1+2μM Hairpin 2;5-6:30min;
7-8:1h;9-10:1.5h;11-12:2h.
Fig. 7 is hairpin probe sequence optimisation experimental result in the embodiment of the present invention 5;Wherein, M:DNA Marker2000;1-
4 be group 3;5-8 is group 2;9-12 is group 1;1st group of point sample sequence is followed successively by from left to right:500nM Hairpin 1;500nM
Hairpin 2;500nM Hairpin 1+500nM Hairpin 2;500nM Hairpin 1+500nM Hairpin 2+ promotees
Hair.2nd group of point sample sequence is followed successively by from left to right:500nM Hairpin3;500nM Hairpin 4;500nM Hairpin
2+500nM Hairpin 3;500nM Hairpin 2+500nM Hairpin 3+ inspires son.3rd group of point sample sequence from a left side to
The right side is followed successively by:500nM Hairpin4;500nM Hairpin 5;500nM Hairpin 4+500nM Hairpin 5;500nM
Hairpin 4+500nM Hairpin 5+ inspires son.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
Used in the conventional means that are well known to those skilled in the art of technological means, raw materials used is commercial goods.
In the present invention, the formula of ABTS developing solution is:1mL DNAzyme substrate buffer solution, citric acid 0.933g, distilled water
100mL, 5 μ L ABTS substrate solutions, 1 μ L 30%H2O2。
DNAzyme substrate buffer solution:The as citrate buffer of pH 3.6, is formulated and is:Na2HPO4.12H2O
1.843g, citric acid 0.933g, distilled water 100mL.
ABTS substrate solution:Take 20mg 2,2 '-connection bis- (3- ethyl benzo thiazole phenanthroline -6- sulfonic acid) the diammonium salt powders of nitrogen (purchase
From Sigma company) be dissolved in 1mL DMSO to get.
The foundation of the ultrafast amplification visible sensor of the general partition of 1 sodium ion cutting-type of embodiment
1, experimental material
SYBR Gold nucleic acid dye, nucleic acid molecular weight standard ultra-low range DNA ladder, dNTP, Ex
Taq archaeal dna polymerase, 10 × Taq buffer, hemin, sodium chloride, 2,2- join (the 3- ethyl-benzothiazole-of nitrogen-two
6- sulfonic acid) diamine salts (ABTS), H2O2,4- hydroxyethyl piperazineethanesulfonic acid (HEPES), MES, LiCl, Tris, ethylenediamine tetra-acetic acid
It is silent winged scientific and technological (Thermo Scientific Life Technologies) to be purchased from match for disodium, tetramethyl benzidine, urea.
Experimental water is all from Milli-Q pure water system.
Following (the SEQ ID NO of sequence design:1-7):
Note:Ribozyme cuts target product and amplification 3 ' terminal sequence of template is complementary;
Overstriking base sequence added by ribozyme substrate chain end is to increase the Tm value in conjunction with template;Cleavage site is used
"-" indicates;
17EV1 ribozyme substrate chain-Na and ribozyme enzyme chain-Na collectively constitutes the specific ribozyme (ribozyme-Na) of sodium ion.
2, the building of ribozyme and the verifying of cleavage reaction system
By 4 μ L ribozyme substrate chain-Na (10 μM of mother liquors) and 4 μ L ribozyme enzyme chain-Na (10 μM of mother liquors) buffer (final concentrations
40 μ L are diluted to for 50mM MES, pH 6.0,25mM LiCl), then 95 DEG C of heating 15min are slowly dropped to 37 DEG C, about consume
When 45min.
5 μ L sodium chloride solution standard samples (1 μM of mother liquor) are added, forms 40 μ L systems, is incubated for 6 minutes at 37 DEG C,
5 μ L terminate liquids (concentration is 0.2M EDTA, 2M NaCl, 0.5M Tris), 4 DEG C of preservations after mixing are added in 40 μ L systems.With
20% denaturing polyacrylamide gel electrophoresis verifying, the small fragment after obtaining the cutting of sodium ion ribozyme, it was demonstrated that sodium ion ribozyme
Preparation and cut successfully (Fig. 1).
3, exceed the speed limit PCR device build and the foundation and verifying of the PCR reaction system that exceeds the speed limit
The primary structure for the PCR device that exceeds the speed limit is as shown in Fig. 2, its specific structure, connection type and working principle, worked
Journey includes:The temperature change for the PCR device that exceeds the speed limit is come via one 95 DEG C of high temperature water bath and one 58 DEG C of medium temperature water-bath
It realizes.The sample room PCR is used as using the capillary (20 μ L, 04 929 292 001, Roche) of Light Cycler model.It is logical
The mode of rapid centrifugation is crossed, sample can gather each capillary one end respectively;The capillary quilt of sample is had after the completion of centrifugation
It is fixed on a dedicated plastic stent.
Sodium ion hypervelocity PCR system is as follows:
In actually detected, cleaved products refer in above-mentioned cleavage reaction system, replace standard specimen with sample to be tested.
10 μ L reaction systems are prepared on ice, are immediately placed in hypervelocity PCR reaction unit and are carried out temperature control.Exceed the speed limit PCR
Response procedures:95 DEG C of 2s, 58 DEG C of 3s, 36 circulations, amount to 3min.
Hypervelocity PCR reaction process is completed, is imitated using the amplification that 2% agarose gel electrophoresis verifies hypervelocity PCR reaction system
Fruit, reaction condition:120V 0.5h, camera system:Molecular Imager Gel Doc XR(Bio-Rad).
The experimental results showed that template can be made to be expanded (Fig. 3) in a short time in the presence of cleaved products.
4, PCR product self assembly
Hairpin probe Hairpin 1, Hairpin 2 is dissolved to 100 μM with ultrapure water respectively, in 95 DEG C of heating 5min, so
After be slowly dropped to room temperature, it is spare;Hypervelocity PCR reaction is completed according to hypervelocity PCR reaction system and response procedures, the PCR that will exceed the speed limit is anti-
It answers product to be added in 2 mixed liquor of final concentration of 2 μM of Hairpin 1 and Hairpin, and self assembly buffer (8mM is added
Na2HPO4,2.5mM NaH2PO4,0.15M NaCl,2mM MgCl2, pH 7.4) so that the total volume of each reaction system is 50
μ l, carries out HCR reaction by 37 DEG C, 30min.
5, the foundation and verifying for the module that develops the color
80 μ L enzyme activity buffer (100mM Tris, 120mM NaCl, 10mM MgCl2, 100mM KCl, pH8.4), 10 μ L
Hemin solution and 10 μ L HCR products, 37 DEG C of reaction 30min after mixing make HCR product combination hemin
Being formed has active tetra- stranded structure of G of peroxidase, and 100 μ L ABTS developing solutions are added, and mixes, 37 DEG C are protected from light incubation
10min, microplate reader measure OD415。
The preparation method of the hemin solution is:The hemin for being 20mM with DMSO compound concentration is former
Liquid, 2 μ L hemin stostes are mixed with enzyme activity buffer described in 1mL to get.
6, sodium ion hypersensitive, visual quickly detection
According to above-mentioned optimization system, it is separately added into the 20 of the various concentration, Na of 60,90,150,200nM+Cleaved products
Ultrafast PCR is carried out, PCR is subjected to self assembly, is developed the color under suitable buffer condition, colour developing is drawn according to color change
Standard curve (Fig. 4).
Na+Detection range is 20-200nM (can realize quantitative detection within this range), and minimum detectability is 3.6nM.
The specificity of 2 sensor of embodiment is investigated
According to the biosensor that embodiment 1 constructs, respectively by 100nM Na+, 10 μM of Ag+、Mg2+、Zn2+、Cd2+、Hg2 +、Cr3+It is added in system and is detected, the results showed that, the Na established+Biosensor has preferable specificity (figure
5)。
The experiment of 3 mark-on of embodiment
High purity water is taken to be detected with the biosensor that embodiment 1 constructs, Na+Without detection, mark-on experiment is carried out to it,
The multiple acquired results of METHOD FOR CONTINUOUS DETERMINATION are shown in Table 1.
1 Na of table+Recovery testu result
The optimization in 4 HCR reaction time of embodiment
According to the biosensor that embodiment 1 constructs, probe 1, probe 2 are dissolved to 100 μM with water respectively, added in 95 DEG C
Then it is spare to be slowly dropped to room temperature by hot 5min;PCR product is added in the mixed liquor of final concentration of 2 μM of probe 1 and probe 2,
And self assembly buffer is added to 50 μ L of total volume.The HCR reaction time is 30min, 1h, 1.5h, 2h respectively.As a result see Fig. 6, by
Fig. 6, which can be seen that, can form enough long double-strands in 30min, it is thus determined that the reaction time is 30min.
The optimization of hairpin probe sequence in 5 HCR of embodiment reaction
According to the biosensor that embodiment 1 constructs, following hairpin probe combination experiment group (table 2) is designed.It is used to inspire
The base sequence of son is as follows:5′-AGACGAAGCACTGGTTGAAACTCC-3′.
Table 2
As a result see Fig. 7, as seen from Figure 7, the effect that experimental group 1 inspires HCR is best, therefore the present invention is selected hair clip
Probe combinations Hairpin 1+Hairpin 2 inspires sequence as HCR.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be modified or is improved, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>China Agricultural University
<120>A kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type
<130> KHP181111301.7
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 32
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ctctatctat aggaagtacc gccgcggagg ga 32
<210> 2
<211> 61
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gcggcggtac caggtcaaag gtgggtgagg ggacgccaag agtccccgcg gttagataga 60
g 61
<210> 3
<211> 70
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
agacgaagca ctggttgaaa ctccggagtt tcaaccagtg cttcgtcttc atcgcaccgt 60
caaaggaacc 70
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ggaagtaccg ccgcggaggg a 21
<210> 5
<211> 94
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
tcatcgcacc gtcaaaggaa cctcagtatc agtgctatac gtcgatcagt agccccgaat 60
ttcgccatct tcctccctcc gcggcggtac ttcc 94
<210> 6
<211> 64
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
agggcgggtg ggtggagttt caaccagtgc ttcgtctccc cagacgaagc actggttgat 60
gggt 64
<210> 7
<211> 64
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
tgggtagacg aagcactggt tgaaactcct caaccagtgc ttcgtctggg gtgggtaggg 60
cggg 64
Claims (10)
1. a kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type, which is characterized in that including:(1) cutting body
System, (2) sPCR amplification system, (3) HCR system, (4) include the detection architecture of ABTS developing solution;
The detection architecture is used to successively carry out sample to be tested via the cutting system, sPCR amplification system and HCR system
Products therefrom carries out color developing detection after reaction;
Wherein, the cutting system includes substrate chain and enzyme chain:
Substrate chain:5′-CTCTATCTATrA-GGAAGTACCGCCGC-3′
Enzyme chain:5′-GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTAGATAGAG-3′
Wherein, rA indicates ribonucleic acid;Indicate sodium ion cleavage site;
The sPCR amplification system includes:Forward direction partition primer, reverse primer, template:
Forward direction partition primer:5 '-AGACGAAGCACTGGTTGAAACTCC- blocker-
GGAGTTTCAACCAGTGCTTCGTCTTCATCGCACCGTCAAAGGAACC-3′
Reverse primer:5′-GGAAGTACCGCCGCGGAGGGA-3′
Template:5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAGCCCCGAATTTCGC
CATCTTCCTCCCTCCGCGGCGGTACTTCC-3′
The HCR system includes 2 probes:
Probe 1:5′-AGGGCGGGTGGGTGGAGTTTCAACCAGTGCTTCGTCTCCCCAGACGAAGCACTGGTTGATGGGT
-3′
Probe 2:5′-TGGGTAGACGAAGCACTGGTTGAAACTCCTCAACCAGTGCTTCGTCTGGGGTGGGTAGGGCGGG
-3′。
2. sensor according to claim 1, which is characterized in that the interruption in the positive partition primer is poly- six second
Glycol.
3. sensor according to claim 1 or 2, which is characterized in that the detection architecture includes:Enzyme activity buffer and chlorine
Protoferriheme solution.
4. the described in any item sensors of claim 1-3 in terms of detect sodium ion in application.
5. application according to claim 4, which is characterized in that described to be detected as qualitative detection or quantitative detection.
6. the method for carrying out qualitative detection to sodium ion using the described in any item sensors of claim 1-3, which is characterized in that
Include the following steps:
S1, sample to be tested is added into the cutting system, carries out cleavage reaction;
S2, ultrafast polymerase chain reaction will be carried out in the addition of cleaved products obtained by the S1 sPCR amplification system, obtains sPCR production
Object;
S3, progress HCR reaction in the HCR system is added in the sPCR product, obtains HCR product;
S4, the HCR product is detected using the detection architecture.
7. according to the method described in claim 6, it is characterized in that, S1 is specific as follows:Substrate chain and enzyme chain are pressed into equimolar ratio
Example mixing, is diluted to 1 μM -2 μM of concentration with buffer, then 85 DEG C of -95 DEG C of heating 15min are cooled to 25-37 DEG C, obtain core
Enzyme solution;Testing sample solution is added into ribozyme liquid described in 35 μ L, forms 40 μ L systems, in 36-38 DEG C of incubation 4-6min, then
4-6 μ L terminate liquid is added, obtains cleaved products.
8. according to the method described in claim 6, it is characterized in that, the detection architecture includes enzyme activity buffer and chlorine siderosis
Enzyme activity buffer, hemin dilute solution and HCR product are 8 by red pigment dilute solution by volume:1:1 mixes,
20-40min, addition and the isometric ABTS developing solution of aforementioned mixture are reacted under the conditions of 35-38 DEG C, are mixed, 35-38 DEG C is protected from light
It is incubated for, is visually monitored.
9. the method for carrying out quantitative detection to sodium ion using the described in any item sensors of claim 1-3, which is characterized in that
Include the following steps:
SI, production standard curve:
Using the sodium ion solution of known concentration, the cutting system with different Na ion concentrations is constructed, sPCR amplification, HCR are anti-
Should and detecting step it is identical as the step in claim 6;
Using Na ion concentration as abscissa, using OD415 value as ordinate, standard curve is drawn;
SII, sample to be tested is detected according to the method for claim 6, it is bent that the OD415 value measured is substituted into standard
The content of sodium ion in sample to be tested is calculated in line, realizes the quantitative detection to sodium ion.
10. according to the method described in claim 9, it is characterized in that, the concentration ranges of the difference Na ion concentration are 20-
200nM。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810634838.4A CN108841935B (en) | 2018-06-20 | 2018-06-20 | Sodium ion cutting type universal partition ultrafast amplification visual sensor |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810634838.4A CN108841935B (en) | 2018-06-20 | 2018-06-20 | Sodium ion cutting type universal partition ultrafast amplification visual sensor |
Publications (2)
Publication Number | Publication Date |
---|---|
CN108841935A true CN108841935A (en) | 2018-11-20 |
CN108841935B CN108841935B (en) | 2020-10-02 |
Family
ID=64203354
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810634838.4A Active CN108841935B (en) | 2018-06-20 | 2018-06-20 | Sodium ion cutting type universal partition ultrafast amplification visual sensor |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108841935B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107976435A (en) * | 2017-10-27 | 2018-05-01 | 中国农业大学 | A kind of sensor based on functional nucleic acid and its application in sodium ion detection |
-
2018
- 2018-06-20 CN CN201810634838.4A patent/CN108841935B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107976435A (en) * | 2017-10-27 | 2018-05-01 | 中国农业大学 | A kind of sensor based on functional nucleic acid and its application in sodium ion detection |
Non-Patent Citations (1)
Title |
---|
JINGJING TIAN, ET AL.: "Visual Single Cell Detection of Dual-Pathogens based on Multiplex Super PCR (MS-PCR) and Asymmetric Tailing HCR (AT-HCR)", 《SENSORS AND ACTUATORS B》 * |
Also Published As
Publication number | Publication date |
---|---|
CN108841935B (en) | 2020-10-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109321672B (en) | Nucleotide composition, kit and detection method | |
Zhang et al. | Label-free and ultrasensitive fluorescence detection of cocaine based on a strategy that utilizes DNA-templated silver nanoclusters and the nicking endonuclease-assisted signal amplification method | |
CN107976435B (en) | Sensor based on functional nucleic acid and application of sensor in sodium ion detection | |
CN108949931A (en) | A kind of general ultrafast amplification visible sensor of partition of zinc ion cutting-type | |
CN110205394A (en) | Biosensor and method for detecting salmonella | |
CN108251514A (en) | A kind of colorimetric sensing new method of dual pathogenic bacteria | |
CN110283919A (en) | Biosensor and method for quantitative detection of salmonella | |
CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
CN108949932B (en) | Universal partition ultrafast amplification copper and calcium cutting type functional nucleic acid visual detection method | |
CN108841937B (en) | General partition ultrafast amplification magnesium and zinc cutting type functional nucleic acid visual detection method | |
CN118147284A (en) | Method and kit for fluorescence detection of ochratoxin | |
CN112501257B (en) | Visualization sensor based on nucleic acid self-assembly enzyme-catalysis-free circRNA living cell imaging | |
CN108949934A (en) | A kind of general ultrafast amplification visible sensor of partition of chromium ion cutting-type | |
CN108841935A (en) | A kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type | |
CN110628950B (en) | Primer combination, kit and PSR method for detecting EV71 virus | |
CN105838790B (en) | A kind of silver nanoclusters sensor and preparation method thereof and the application in detection viral gene | |
CN106755379A (en) | 4 kinds of Aspergillus are synchronously quantified and the dimer of Genotyping is mutated fluorescent primer quantifying PCR method | |
CN108841938A (en) | A kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type | |
CN108841936A (en) | A kind of general ultrafast amplification visible sensor of partition of calcium ion cutting-type | |
CN108949918A (en) | It is general to separate ultrafast amplification magnesium, sodium cutting-type functional nucleic acid visible detection method | |
CN108949936A (en) | A kind of general ultrafast amplification visible sensor of partition of magnesium ion cutting-type | |
CN108929900A (en) | A kind of general ultrafast amplification visible sensor of partition of cadmium ion cutting-type | |
CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
CN108949935B (en) | Universal partition ultrafast amplification chromium and cadmium cutting type functional nucleic acid visual detection method | |
CN109022561B (en) | Universal partition ultrafast amplification mercury and copper mismatch type functional nucleic acid colorimetric sensor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
CB03 | Change of inventor or designer information | ||
CB03 | Change of inventor or designer information |
Inventor after: Xu Wentao Inventor after: Luo Yunbo Inventor after: Huang Kunlun Inventor after: Du Zaihui Inventor after: Tian Jingjing Inventor before: Luo Yunbo Inventor before: Xu Wentao Inventor before: Huang Kunlun Inventor before: Du Zaihui Inventor before: Tian Jingjing |
|
GR01 | Patent grant | ||
GR01 | Patent grant |