CN108841937A - It is general to separate ultrafast amplification magnesium, zinc cutting-type functional nucleic acid visible detection method - Google Patents
It is general to separate ultrafast amplification magnesium, zinc cutting-type functional nucleic acid visible detection method Download PDFInfo
- Publication number
- CN108841937A CN108841937A CN201810639040.9A CN201810639040A CN108841937A CN 108841937 A CN108841937 A CN 108841937A CN 201810639040 A CN201810639040 A CN 201810639040A CN 108841937 A CN108841937 A CN 108841937A
- Authority
- CN
- China
- Prior art keywords
- magnesium
- hcr
- zinc ion
- chain
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides magnesium, the zinc cutting-type functional nucleic acid visible detection method of a kind of general ultrafast amplification of partition.The present invention so that can carry out ultrafast amplification to template in the presence of magnesium, zinc ion, and makes amplified production form tetra- serobila of G in control environment by dexterously design primer, template and probe.It is further developed the color using the peroxidase activity of tetra- serobila of G, solves the problems, such as that normal PCR product is difficult to Visual retrieval, realize quick, Visual retrieval to magnesium, zinc ion.Moreover, method provided by the invention has the characteristics that high special, highly sensitive that testing result is more objective, accurate to magnesium, zinc ion.
Description
Technical field
The present invention relates to biosensor technology fields, specifically, being related to magnesium, the zinc of a kind of general ultrafast amplification of partition
Cutting-type functional nucleic acid visible detection method.
Background technique
Magnesium, chemical symbol are Mg, and atomic number is 12, and atomic weight is 24, belong to group iia, are that a kind of silvery white has metal
The metal of gloss, it is distributed more widely in nature.Chinese Soclety of Nutrition suggests that adult male about needs 350 milligrams of magnesium daily, adult
Women is about 300 milligrams, and pregnant woman and the phase women of breast-feeding are about 450 milligrams, and 2-3 years old children are 150 milligrams, and 3-6 years old is 200 millis
Gram.Tolerable highest intake (UL) is set to 700mg/d.Magnesium is the dominant cation in human body cell, is concentrated in mitochondria,
It is only second to potassium and phosphorus, sodium is only second in extracellular fluid and calcium occupies third position, is the required of the basic biochemical reaction of internal various kinds of cell
Substance.Magnesium is a kind of participation organism normal activities and the essential element of metabolic processes.Magnesium lacks in clinic
On be mainly shown as uneasy mood, emotional, tetany, exagger etc., under normal circumstances, due to the adjustment effect of kidney,
Magnesium poisoning will not be occurred by taking orally excessive magnesium generally.When renal insufficiency, largely oral magnesium can cause magnesium to be poisoned, and show as abdomen
Bitterly, there is expiratory dyspnea, cyanosis, mydriasis etc. in diarrhea, vomiting, polydipsia, fatigue and weak, serious person.
Zinc, chemical symbol are Zn, and atomic number is 30, and atomic weight is 65.38, belong to group iib, are a kind of grayish mistakes
Cross metal, it is distributed more widely in nature, mainly with zinc sulphide, zinc oxide state exist, can also with many elements for example lead, copper,
The mineral intergrowth of zinc.Zinc is the most microelement of body burden, and content is up to as many as 3g, is mainly joined in the form of zinc ion
With intracorporal metabolism, the synthesis and activation of more than 200 kinds of enzymes, are essential substances in body metabolism in participant's body.
Zinc pollution refers to environmental pollution caused by zinc and compound.Primary pollution source have zinc ore exploitation, smelting processing, machine-building with
And zinc-plated, instrument and meter, have an opportunity the discharge of synthesis and the industry such as papermaking.
Traditional magnesium, zinc ion detection method generally can be divided into cold atomic absorption spectrometry, graphite carbon atom absorption spectrum
Method and flame atomic absorption spectrometry etc., but generally existing complex pretreatment, large-scale instrument special messenger operate, detection cycle is long,
Expensive feature.Therefore there is an urgent need to develop free of contamination, easy quick, highly sensitive and high specific method to expire
The needs of the detection of sufficient metal ion, to ensure the safety of food.
Summary of the invention
The object of the present invention is to provide the systems that a kind of cutting-type quickly detects magnesium, zinc ion.
It is a further object of the present invention to provide a kind of magnesium of general ultrafast amplification of partition, the visualization of zinc cutting-type functional nucleic acid
Detection method.
In order to achieve the object of the present invention, inventor designs general partition according to the specific ribozyme of magnesium ion and zinc ion
It carries out ultrafast polymerase chain reaction (super Polymerase Chain Reaction, sPCR) to primer pair, in conjunction with rich G
Sequence is in K+Being formed under existence condition has active tetra- serobila of G of peroxidase, constructs a kind of novel based on partition
Magnesium ion, the zinc ion cutting-type functional nucleic acid colorimetric sensor of primer.
In order to achieve the object of the present invention, inventor designs general partition and draws according to magnesium ion and zinc ion specific ribozyme
Object carries out ultrafast polymerase chain reaction (super Polymerase Chain Reaction, sPCR) to it, in conjunction with rich G sequence
It is listed in K+Being formed under existence condition has active tetra- serobila of G of peroxidase, constructs a kind of novel draw based on partition
Magnesium ion, the zinc ion cutting-type functional nucleic acid colorimetric sensor of object.
In a first aspect, the present invention provides a kind of system for quickly detecting magnesium, zinc ion, including：(1) system, (2) are cut
SPCR amplification system, (3) HCR system, (4) include the detection architecture of ABTS developing solution.
The detection architecture is used for sample to be tested successively via the cutting system, sPCR amplification system and HCR system
Products therefrom carries out color developing detection after being reacted；
Wherein, the cutting system includes substrate chain I and enzyme chain I and substrate chain II and enzyme chain II：
Substrate chain I：5′-GTCACGAGTCACTATrA—GGAAGATGGCGAAA-3′
Enzyme chain I：5′-TTTCGCCATCTTCTCCGAGCCGGTCGAAATAGTGACTCGTGAC-3′
Wherein, rA indicates ribonucleic acid；Indicate magnesium ion cleavage site；
Substrate chain II：5′-CCACCACAATGTTATACAGGTACTATrA—
GGAAGTTGAGTTACGAGGCGGTGGTGG-3′
Enzyme chain II：5′-TTTCGCCATCTTCTCCGAGCCGGTCGAAATAGTGACTCGTGAC-3′
Wherein, rA indicates ribonucleic acid；Indicate zinc ion cleavage site；
The sPCR amplification system includes：Forward direction partition primer I, reverse primer I, positive partition primer I I, reverse primer
II, template：
Forward direction partition primer I：5 '-GTGGGTAGGGCGGGTTGG- interruptions-
CCAACCCGCCCTACCCACTCATCGCACCGTCAAAGGAACC-3′
Reverse primer I：5′-GGAAGATGGCGAAATTCGGGGC-3′
Forward direction partition primer I I：5 '-AGACGAAGCACTGGTTGAAACTCC- interruptions-
GGAGTTTCAACCAGTGCTTCGTCTTCATCGCACCGTCAAAGGAACC-3′
Reverse primer II：5′-GGAAGTTGAGTTACGAGGCGGTGGTGG-3′
Template：5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAGCCCCGAATT
TCGCCATCTTCCCCACCACCGCCTCGTAACTCAACTTCC-3′；
The HCR system includes 2 probes：
Probe 1：5′-AGGGCGGGTGGGTGGAGTTTCAACCAGTGCTTCGTCTCCCCAGACGAAGCACTGGTTGAT
GGGT-3′
Probe 2：5′-TGGGTAGACGAAGCACTGGTTGAAACTCCTCAACCAGTGCTTCGTCTGGGGTGGGTAGGG
CGGG-3′。
Wherein, the interruption in the positive partition primer is poly- six ethylene glycol.Other partitions that PCR can be prevented to extend
Structure can also be used for the present invention.
The archaeal dna polymerase be Ex Taq archaeal dna polymerase, the buffer be 10 × Ex Taq Buffer, the two with
It is silent winged scientific and technological (Thermo Scientific Life Technologies) that the dNTP is purchased from match.
Detection architecture of the present invention includes：Enzyme activity buffer, hemin solution.
Wherein, the enzyme activity buffer is：100mM Tris,120mM NaCl,10mM MgCl2, 100mM KCl,
pH8.4。
The hemin stoste that the hemin solution is 20mM is with above-mentioned enzyme activity buffer according to 2 μ L：
The mixed hemin dilute solution of the ratio of 1mL.
The present invention also provides aforementioned systems in detection magnesium, in terms of zinc ion in application, the detection can behave as qualitative
Detection or quantitative detection.
Second aspect, the ultrafast amplification magnesium of the general partition that the present invention provides a kind of based on aforementioned system, zinc cutting-type function
Energy nucleic acid visualizes qualitative checking method, includes the following steps：
S1, sample to be tested is added into the cutting system, carries out cleavage reaction；
S2, ultrafast polymerase chain reaction will be carried out in the addition of cleaved products obtained by the S1 sPCR amplification system, obtained
SPCR product；
S3, progress HCR reaction in the HCR system is added in the sPCR product, obtains HCR product；
S4, the HCR product is detected using the detection architecture.
S1 is specific as follows：Substrate chain and enzyme chain are mixed in equimolar ratio, are diluted to 1 μM -2 μM of concentration with buffer,
85 DEG C of -95 DEG C of heating 15min, are then cooled to 25-37 DEG C, obtain ribozyme liquid；It is added into ribozyme liquid described in 35 μ L to test sample
Product solution forms 40 μ L systems, in 36-38 DEG C of incubation 4-6min, 4-6 μ L terminate liquid is then added, obtains cleaved products.
Further, the detection architecture includes enzyme activity buffer and hemin dilute solution, and enzyme activity is buffered
Liquid, hemin dilute solution and HCR product are 8 by volume:1:1 mixes (total volume is 100 μ L), at 35-38 DEG C
Under the conditions of react 20-40min, be added with the isometric ABTS developing solution of aforementioned mixture, mix, 35-38 DEG C is protected from light incubation, meat
Eye is monitored.
The third aspect, the ultrafast amplification magnesium of the general partition that the present invention provides a kind of based on aforementioned system, zinc cutting-type function
Energy nucleic acid visualizes quantitative detecting method, includes the following steps：
SI, production standard curve：
Using the magnesium of known concentration, zinc ion solution, the cutting system with different magnesium, zinc ion concentration, sPCR are constructed
The step of amplification, HCR reaction and detecting step are with aforementioned qualitative detection is identical；
Using magnesium, zinc ion concentration as abscissa, using OD415 value as ordinate, standard curve is drawn；
SII, sample to be tested is detected according to aforementioned qualitative checking method, it is bent that the OD415 value measured is substituted into standard
The content of magnesium in sample to be tested, zinc ion is calculated in line, realizes the quantitative detection to magnesium, zinc ion.
The present invention provides magnesium, the zinc cutting-type functional nucleic acid visible detection method of a kind of general ultrafast amplification of partition, tool
Body is as follows：
A magnesium ion specific ribozyme, including substrate chain I and enzyme chain I) are designed, substrate chain I is carried out hybridizing shape with enzyme chain I
At the ribozyme I with specific magnesium ion cleavage activity, existing for the magnesium ion under the conditions of cleavage reaction occurs, cut down
Nucleic acid fragment is anti-to template progress PCR amplification together with forward direction partition primer I as reverse primer I (i.e. target initiation molecule)
It answers, one end of gained PCR product I has one section of single strand nucleotide sequence；The PCR product I is in K+Under existence condition, G tetra- is formed
Serobila is catalyzed H2O2It develops the color with ABTS, and then completes to detect the quick visualization of magnesium ion；Or
HCR reaction is inspired by PCR product I, so that HCR product I is in K+Tetra- serobila of G is formed under existence condition, is catalyzed H2O2
It develops the color with ABTS, and then completes to detect the quick visualization of magnesium ion；
The base sequence of the substrate chain I and enzyme chain I are as follows：
Substrate chain I：5′-GTCACGAGTCACTATrA—GGAAGATGGCGAAA-3′
Enzyme chain I：5′-TTTCGCCATCTTCTCCGAGCCGGTCGAAATAGTGACTCGTGAC-3′
Wherein, rA indicates ribonucleic acid；Indicate magnesium ion cleavage site；
5 ' ends of the positive partition primer I have a hairpin structure, between two sections of reverse complemental base sequences at least provided with
One blocker, the blocker can block PCR to extend；
B zinc ion specific ribozyme, including substrate chain II and enzyme chain II) are designed, substrate chain II and enzyme chain II is carried out miscellaneous
Hand over the ribozyme II for being formed and there is specific zinc ion cleavage activity, existing for the zinc ion under the conditions of cleavage reaction occurs, cut
The nucleic acid fragment to get off carries out template together with forward direction partition primer I I as reverse primer II (i.e. target initiation molecule)
One end of pcr amplification reaction, gained PCR product II has one section of single strand nucleotide sequence；The PCR product II is in K+Existence condition
Under, tetra- serobila of G is formed, H is catalyzed2O2It develops the color with ABTS, and then completes to detect the quick visualization of zinc ion；Or
HCR reaction is inspired by PCR product II, so that HCR product II is in K+Tetra- serobila of G, catalysis are formed under existence condition
H2O2It develops the color with ABTS, and then completes to detect the quick visualization of zinc ion；
The base sequence of the substrate chain II and enzyme chain II are as follows：
Substrate chain II：5′-CCACCACAATGTTATACAGGTACTATrA—
GGAAGTTGAGTTACGAGGCGGTGGTGG-3′
Enzyme chain II：5′-TTTCGCCATCTTCTCCGAGCCGGTCGAAATAGTGACTCGTGAC-3′
Wherein, rA indicates ribonucleic acid；Indicate zinc ion cleavage site；
5 ' the ends of the positive partition primer I I have a hairpin structure, between two sections of reverse complemental base sequences at least provided with
One blocker, the blocker can block PCR to extend；
Wherein, step A) and step B) involved in cleavage reaction can be carried out in system independent, can also be with
It is carried out in same system；Step A) and step B) involved in pcr amplification reaction can be carried out in system independent,
It can also be carried out in same system；Step A) and step B) involved in chromogenic reaction can in system independent into
Row, can also carry out in same system；Step A) and step B) involved in HCR reaction can be in system independent
It carries out, can also be carried out in same system.
In the present invention, developing solution can be substituted with TMB.
Preferably, there is richness G base sequence on the hairpin structure of the positive partition primer I and/or positive partition primer I I
Column.When design has rich G base sequence on the hairpin structure of the positive partition primer, then reacted without HCR, Ji Keshi
Now the quick visualization of magnesium ion is detected.
Method above-mentioned detects magnesium ion, the spy in the reaction system of HCR at least containing a band hairpin structure
Needle, the base composition of the hairpin structure and the base sequence of the positive partition primer I hairpin structure are essentially identical, so that institute
HCR reaction can be inspired by stating PCR product I.
Zinc ion is detected, the probe in the reaction system of HCR at least containing a band hairpin structure, the hair clip knot
The base composition of structure and the base sequence of the positive partition primer I I hairpin structure are essentially identical, so that the PCR product II
HCR reaction can be inspired.
It is detected preferably for magnesium ion, the 3 ' ends of the substrate chain I can increase the reverse primer I added with one section
The base sequence of Tm value in conjunction with template, so that the control of PCR annealing temperature is at 50-60 DEG C.It is preferred that added sequence is
TTCGGGGC。
Preferably, the blocker is poly- six ethylene glycol.
Method above-mentioned, substrate chain I used, enzyme chain I, positive partition primer I, reverse primer I and mould in magnesium ion detection
The base sequence of plate is as follows：
Substrate chain I：5′-GTCACGAGTCACTATrA—GGAAGATGGCGAAATTCGGGGC-3′
Enzyme chain I：5′-TTTCGCCATCTTCTCCGAGCCGGTCGAAATAGTGACTCGTGAC-3′
Forward direction partition primer I：Poly- six ethylene glycol-of 5 '-GTGGGTAGGGCGGGTTGG-
CCAACCCGCCCTACCCACTCATCGCACCGTCAAAGGAACC-3′
Reverse primer I：5′-GGAAGATGGCGAAATTCGGGGC-3′
Template：5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAGCCCCGAATT
TCGCCATCTTCCCCACCACCGCCTCGTAACTCAACTTCC-3′
Wherein, rA indicates ribonucleic acid；Indicate magnesium ion cleavage site.
Substrate chain II used in zinc ion detection, enzyme chain II, positive partition primer I I, reverse primer II, template and 2
The base sequence of probe is as follows：
Substrate chain II：5′-CCACCACAATGTTATACAGGTACTATrA—
GGAAGTTGAGTTACGAGGCGGTGGTGG-3′
Enzyme chain II：5′-CTCAACTTCTCCGAGCCGGTCGAAATAGTACCT-3′
Forward direction partition primer I I：Poly- six ethylene glycol-of 5 '-AGACGAAGCACTGGTTGAAACTCC-
GGAGTTTCAACCAGTGCTTCGTCTTCATCGCACCGTCAAAGGAACC-3′
Reverse primer II：5′-GGAAGTTGAGTTACGAGGCGGTGGTGG-3′
Template：5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAGCCCCGAATT
TCGCCATCTTCCCCACCACCGCCTCGTAACTCAACTTCC-3′
Probe 1：5′-AGGGCGGGTGGGTGGAGTTTCAACCAGTGCTTCGTCTCCCCAGACGAAGCACTGGTTGAT
GGGT-3′
Probe 2：5′-TGGGTAGACGAAGCACTGGTTGAAACTCCTCAACCAGTGCTTCGTCTGGGGTGGGTAGGG
CGGG-3′
Wherein, rA indicates ribonucleic acid；Indicate zinc ion cleavage site.
The present invention also provides detection kit matched with the above method, the kit includes at least following component：Bottom
Object chain I and II, enzyme chain I and II, positive partition primer I and II, template, probe 1, probe 2, probe 3 and probe 4 etc..
The detection and analysis principle of kit of the present invention：Substrate chain hybridize formation with specificity gold with enzyme chain first
The ribozyme for belonging to ion cleavage activity, existing for the metal ion under the conditions of cleavage reaction occurs, the nucleic acid fragment cut down can
To carry out PCR extension in conjunction with template, since the partition effect of primer hinders the extension of polymerase, so that PCR product is band
There is the particular sequence for inspiring HCR, HCR product (contains K under suitable buffer condition in buffer+) form tetra- serobila of G, catalysis
H2O2It develops the color with ABTS, and then completes to detect the quick visualization of metal ion.
The specific detection method is as follows：
1. individually detection magnesium ion：
A1) the building of ribozyme I：Substrate chain I and enzyme chain I is mixed in equimolar ratio, is diluted to 1 μ of concentration with buffer I
M-2 μM, 85-95 DEG C of heating 15min, it is slowly dropped to 25-37 DEG C (about time-consuming 45min) then to get ribozyme liquid I；
A2) cleavage reaction：Testing sample solution is added into the above-mentioned ribozyme liquid I of 35 μ L, forms 40 μ L systems, is incubated in 37 DEG C
4-6min is educated, 4-6 μ L terminate liquid is then added, obtains cleaved products I；
A3) hypervelocity PCR reaction：It prepares and primer I, cleaved products I, template, archaeal dna polymerase, dNTP, reaction is separated by forward direction
Buffer and ddH2The PCR reaction system of O composition, is arranged following response procedures：90-95 DEG C of 2s, 55-60 DEG C of 3s, 30-40 are followed
Ring carries out PCR reaction, obtains PCR product I；
A4) chromogenic reaction：80 μ L enzyme activity buffers, 10 μ L hemin solution are mixed with 10 μ L PCR product I,
In 37 DEG C of reaction 30min, 100 μ L ABTS developing solutions are added, mix, 37 DEG C are protected from light incubation 5-10min, according to addition developing solution
The variation of front and back solution colour come judge in sample to be tested whether the height containing magnesium ion and magnesium ion concentration；Meat can be passed through
Eye directly observes the variation of solution colour, or is changed using the OD value of microplate reader measurement solution.
2. individually detection zinc ion：
B1) the building of ribozyme II：Substrate chain II and enzyme chain II is mixed in equimolar ratio, is diluted to buffer II dense
1 μM -2 μM, 85-95 DEG C of heating 15min of degree, is slowly dropped to 25-37 DEG C (about time-consuming 45min) then to get ribozyme liquid II；
B2) cleavage reaction：Testing sample solution is added into the above-mentioned ribozyme liquid II of 35 μ L, 40 μ L systems are formed, in 25 DEG C
It is incubated for 4-6min, 4-6 μ L terminate liquid is then added, obtains cleaved products II；
B3) hypervelocity PCR reaction：It prepares by forward direction partition primer I I, cleaved products II, template, archaeal dna polymerase, dNTP, anti-
Answer buffer and ddH2The PCR reaction system of O composition, is arranged following response procedures：90-95 DEG C of 2s, 55-60 DEG C of 3s, 30-40
Circulation carries out PCR reaction, obtains PCR product II；
B4) HCR reacts：Construct the HCR reactant being made of probe 1, probe 2, PCR product II and self assembly buffer
System, in 37 DEG C of reaction 30-60min, obtains HCR product II；
B5) chromogenic reaction：80 μ L enzyme activity buffers, 10 μ L hemin solution and 10 μ L HCR product II are mixed
It closes, in 37 DEG C of reaction 30min, 100 μ L ABTS developing solutions is added, mix, 37 DEG C are protected from light incubation 10min, according to addition developing solution
The variation of front and back solution colour come judge in sample to be tested whether the height containing zinc ion and zinc ion concentration；Meat can be passed through
Eye directly observes the variation of solution colour, or is changed using the OD value of microplate reader measurement solution.
3. magnesium ion and zinc ion double check：
S1) the building of ribozyme I and ribozyme II：Substrate chain I and enzyme chain I is mixed in equimolar ratio, is diluted with buffer I
To 1 μM -2 μM of concentration；Substrate chain II and enzyme chain II is mixed in equimolar ratio, is diluted to 1 μM -2 μM of concentration with buffer II,
Then 85-95 DEG C of heating 15min is slowly dropped to 25-37 DEG C (about time-consuming 45min) to get ribozyme liquid；
S2) cleavage reaction：Testing sample solution is added into the above-mentioned ribozyme liquid of 35 μ L, 40 μ L systems are formed, in 25-37 DEG C
It is incubated for 4-6min, 4-6 μ L terminate liquid is then added, obtains cleaved products；
S3) dual hypervelocity PCR reaction：Prepare by forward direction partition primer I, positive partition primer I I, cleaved products, template,
Archaeal dna polymerase, dNTP, reaction buffer and ddH2The PCR reaction system of O composition, is arranged following response procedures：90-95 DEG C of 2s,
55-60 DEG C of 3s, 30-40 circulation, carries out PCR reaction, obtains PCR product；
S4) HCR reacts：The HCR reaction system being made of probe 1, probe 2, PCR product and self assembly buffer is constructed,
In 37 DEG C of reaction 30-60min, HCR product is obtained；
S5) chromogenic reaction：80 μ L enzyme activity buffers, 10 μ L hemin solution are mixed with 10 μ L HCR products,
In 37 DEG C of reaction 30min, 100 μ L ABTS developing solutions are added, mix, 37 DEG C are protected from light incubation 5-10min, according to addition developing solution
The variation of front and back solution colour judges in sample to be tested whether to contain magnesium ion and zinc ion；It can be molten by direct visual perception
The variation of liquid color, or changed using the OD value of microplate reader measurement solution.
Wherein, the formula of buffer I used is in ribozyme building：140mM NaCl,50mM Tris,pH 7.5.
The formula of buffer II is：25mM HEPES liquid (pH 7.6).
The formula of terminate liquid used is in cleavage reaction：0.2M EDTA, 2M NaCl, 0.5M Tris.
The formula of self assembly buffer used is in HCR reaction：8mM Na2HPO4,2.5mM NaH2PO4,0.15M
NaCl,2mM MgCl2,pH 7.4。
The formula of enzyme activity buffer used is in chromogenic reaction：100mM Tris,120mM NaCl,10mM MgCl2、
100mM KCl, pH8.4.
The preparation method of the hemin solution is：The hemin for being 20mM with DMSO compound concentration is former
Liquid, 2 μ L hemin stostes are mixed with enzyme activity buffer described in 1mL to get.
Preferably, PCR reaction system is as follows：
Individually detection magnesium ion：
Individually detection zinc ion：
Magnesium ion and zinc ion double check：
The construction method of HCR reaction system is as follows：
1. individually detection zinc ion：Probe 1, probe 2 are dissolved to 100 μM with water respectively, in 90-95 DEG C of heating 5min,
Then it is spare to be slowly dropped to room temperature；PCR product II is added in the mixed liquor of final concentration of 2 μM -3 μM of probe 1 and probe 2,
And self assembly buffer is added to 50 μ L of total volume；
2. magnesium ion and zinc ion double check：Probe 1 and probe 2 are dissolved to 100 μM with water respectively, in 90-95 DEG C
5min is heated, it is spare to be then slowly dropped to room temperature；The mixed of final concentration of 2 μM -3 μM of probe 1 and probe 2 is added in PCR product
It closes in liquid, and self assembly buffer is added to 50 μ L of total volume.
A series of magnesium ion standard solution for preparing concentration, is detected according to the method described above, and is measured using microplate reader
Solution O D415Value changes the standard curve that drafting develops the color according to solution colour to judge the situation that develops the color：Y=0.1008x+
0.0255, R2=0.9974, so that the quantitative detection to magnesium ion can be realized.
The magnesium ion detection limit of this method is 0.5-15 μM.
A series of zinc ion standard solution for preparing concentration, is detected according to the method described above, and is measured using microplate reader
Solution O D415Value changes the standard curve that drafting develops the color according to solution colour to judge the situation that develops the color：Y=0.0017x+
0.2482, R2=0.996, so that the quantitative detection to zinc ion can be realized.
The zinc ion detection limit of this method is 1-800nM.
By above-mentioned technical proposal, the present invention at least has following advantages and beneficial effect：
The present invention by establishing a kind of partition rapid amplifying magnesium ion, zinc ion cutting-type functional nucleic acid colorimetric sensor,
Quick visualization for magnesium ion, zinc ion detects.According to the specific ribozyme of metal ion, design partition primer pair its into
The ultrafast polymerase chain reaction of row, in conjunction with rich G sequence in K+Being formed under existence condition has active tetra- chain of G of peroxidase
Body constructs a kind of novel metal ion cutting-type functional nucleic acid colorimetric sensor based on general partition primer, and provides
A kind of quick, visual magnesium ion, zinc ion double check new method.Greatly shorten the detection time of sample, detection limit
Reachable μM, nM grades respectively, and the present invention successfully solves the visualization problem of PCR product, to the scene that solves inspection real-time, quickly
Survey has important practical significance.
(1) this method constructed partition primer for the first time, carries out ultrafast amplification to template, by time-consuming 3 hours or so tradition
PCR process is reduced to 10 minutes, significantly reduces the used time of PCR reaction.
(2) the partition effect of primer hinders the extension of polymerase, obtains single strand nucleotide sequence.It is anti-HCR can be inspired
It answers, or is directly detected.
(3) it develops the color in conjunction with the peroxidase activity of tetra- serobila of G, PCR product or HCR product and ABTS occur
Color change solves the problems, such as that normal PCR product is difficult to Visual retrieval.
(4) this method can realize magnesium ion, the high-volume of zinc ion, quickly detection.
Detailed description of the invention
Fig. 1 is that magnesium ion ribozyme prepares and cuts the result of verifying in the embodiment of the present invention 1；Wherein, swimming lane 1：Ribozyme-
Mg；Swimming lane 2-4：Cutting system.
Fig. 2 is that zinc ion ribozyme prepares and cuts the result of verifying in the embodiment of the present invention 1；Wherein, swimming lane 1：Ribozyme-
Zn；Swimming lane 2-4：Cutting system.
Fig. 3 is the surface structure of hypervelocity PCR instrument in the embodiment of the present invention 1.
Fig. 4 is the glue figure of hypervelocity pcr amplification product in the embodiment of the present invention 1；Wherein, swimming lane 1：DNAMarker2000；Swimming
Road 2：Magnesium ion hypervelocity PCR product；Swimming lane 3：Zinc ion hypervelocity PCR product；Swimming lane 4：Dual hypervelocity PCR product.
Fig. 5 is Zn in the embodiment of the present invention 12+The glue figure of HCR product；Wherein, 1 is DNA Marker2000；2 are
Hairpin 1；3 be Hairpin 2；4 are added to HCR system for 1 μ l PCR product；5 are added to HCR system for 10 μ l PCR products.
Fig. 6 is the standard song for drawing colour developing in the embodiment of the present invention 1 according to various concentration magnesium ion and solution colour variation
Line.
Fig. 7 is the standard song for drawing colour developing in the embodiment of the present invention 1 according to various concentration zinc ion and solution colour variation
Line.
Fig. 8 is that the specificity of detection method in the embodiment of the present invention 2 investigates result.
Fig. 9 optimizes experimental result for the HCR reaction time in the embodiment of the present invention 4；Wherein, 1:Feminine gender, 2：10min, 3：
20min, 4：30min, 5：1h.
Figure 10 is hairpin probe sequence optimisation experimental result in the embodiment of the present invention 5；Wherein, 1-3 corresponds respectively to a group 1-
Group 3.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
Used in the conventional means that are well known to those skilled in the art of technological means, raw materials used is commercial goods.
In the present invention, the formula of ABTS developing solution is：1mL DNAzyme substrate buffer solution, citric acid 0.933g, distilled water
100mL, 5 μ L ABTS substrate solutions, 1 μ L 30%H2O2。
DNAzyme substrate buffer solution：The as citrate buffer of pH 3.6, is formulated and is：Na2HPO4.12H2O
1.843g, citric acid 0.933g, distilled water 100mL.
ABTS substrate solution：Take 20mg 2,2 '-connection bis- (3- ethyl benzo thiazole phenanthroline -6- sulfonic acid) the diammonium salt powders of nitrogen (purchase
From Sigma company) be dissolved in 1mL DMSO to get.
Magnesium, the zinc cutting-type functional nucleic acid visible detection method of the general ultrafast amplification of partition of embodiment 1
1, experimental material
SYBR Gold nucleic acid dye, nucleic acid molecular weight standard ultra-low range DNA ladder, dNTP, Ex
Taq archaeal dna polymerase, 10 × Taq buffer, hemin, magnesium chloride, zinc chloride, 2,2- join (the 3- ethyl-benzene of nitrogen-two
And thiazole -6- sulfonic acid) diamine salts (ABTS), H2O2, 4- hydroxyethyl piperazineethanesulfonic acid (HEPES), sodium hydroxide, disodium hydrogen phosphate,
It is silent winged scientific and technological (Thermo Scientific Life Technologies) to be purchased from match.It is pure that experimental water is all from Milli-Q
Water system.
Following (the SEQ ID NO of sequence design:1-11)：
Note：Ribozyme cuts target product and amplification 3 ' terminal sequence of template is complementary；
Overstriking base sequence added by ribozyme substrate chain end is to increase the Tm value in conjunction with template；Cleavage site is used
"-" indicates；
17E ribozyme substrate chain-Mg and ribozyme enzyme chain-Mg collectively constitutes the specific ribozyme (ribozyme-Mg) of magnesium ion；Ribozyme
Substrate chain-Zn and ribozyme enzyme chain-Zn collectively constitutes the specific ribozyme (ribozyme-Zn) of zinc ion.
2, the building of ribozyme and the verifying of cleavage reaction system
(1) 4 μ L ribozyme substrate chain-Mg (10 μM of mother liquors) and 4 μ L ribozyme enzyme chain-Mg (10 μM of mother liquors) are (whole with buffer
Concentration is diluted to 40 μ L, 95 DEG C of heating 15min for 140mM NaCl, 50mM Tris, pH 7.5) and is then slowly dropped to 37 DEG C,
About time-consuming 45min.
It is added 5 μ L magnesium chloride solutions (1 μM of mother liquor), forms 40 μ L systems, be incubated for 5 minutes at 37 DEG C, in 40 μ L systems
5 μ L terminate liquids of middle addition (concentration is 0.2M EDTA, 2M NaCl, 0.5M Tris), 4 degrees Celsius of preservations after mixing.With 20%
Denaturing polyacrylamide gel electrophoresis verifying, the small fragment after obtaining the cutting of magnesium ion ribozyme, it was demonstrated that the preparation of magnesium ion ribozyme
With cut successfully (Fig. 1).
(2) 4 μ L ribozyme substrate chain-Zn (10 μM of mother liquors) and 4 μ L ribozyme enzyme chain-Zn (10 μM of mother liquors) are used into buffer
(25mM HEPES liquid, pH 7.6) is diluted to 40 μ L, 95 DEG C of heating 15min and is then slowly dropped to 25 DEG C, about time-consuming 45min.
It is added 5 μ L liquor zinci chloridis (1 μM of mother liquor), forms 40 μ L systems, be incubated for 6 minutes at 25 DEG C, in 40 μ L systems
5 μ L terminate liquids of middle addition (concentration is 0.2M EDTA, 2M NaCl, 0.5M Tris), 4 degrees Celsius of preservations after mixing.With 20%
Denaturing polyacrylamide gel electrophoresis verifying, the small fragment after obtaining the cutting of zinc ion ribozyme, it was demonstrated that the preparation of zinc ion ribozyme
With cut successfully (Fig. 2).
3, exceed the speed limit PCR device build and the foundation and verifying of the PCR reaction system that exceeds the speed limit
The primary structure for the PCR device that exceeds the speed limit is as shown in figure 3, its specific structure, connection type and working principle, worked
Journey includes：The temperature change for the PCR device that exceeds the speed limit is come via one 95 DEG C of high temperature water bath and one 58 DEG C of medium temperature water-bath
It realizes.The sample room PCR is used as using the capillary (20 μ L, 04 929 292 001, Roche) of Light Cycler model.It is logical
The mode of rapid centrifugation is crossed, sample can gather each capillary one end respectively；The capillary quilt of sample is had after the completion of centrifugation
It is fixed on a dedicated plastic stent.
Magnesium ion hypervelocity PCR system is as follows：
Zinc ion hypervelocity PCR system is as follows：
Dual hypervelocity PCR system is as follows：
In actually detected, cleaved products refer in above-mentioned cleavage reaction system, replace standard specimen with sample to be tested.
10 μ L reaction systems are prepared on ice, are immediately placed in hypervelocity PCR reaction unit and are carried out temperature control.Exceed the speed limit PCR
Response procedures：95 DEG C of 2s, 58 DEG C of 3s, 36 circulations, amount to 3min.
Dual hypervelocity PCR reaction process is completed, the expansion of hypervelocity PCR reaction system is verified using 2% agarose gel electrophoresis
Synergy fruit, reaction condition：120V 0.5h, camera system：Molecular Imager Gel Doc XR(Bio-Rad).
The experimental results showed that can be carried out template in short-term when cutting target product and being respectively present or exist simultaneously
It is interior to be expanded (Fig. 4).
4, PCR product self assembly
Hairpin probe Hairpin 1, Hairpin 2 is dissolved to 100 μM with ultrapure water respectively, in 95 DEG C of heating 5min, after
It is slowly dropped to room temperature, it is spare；Hypervelocity PCR reaction is completed according to hypervelocity PCR reaction system and reaction process, by hypervelocity PCR reaction
Product is added in the array of different compositions, so that being added in array final concentration of 2 μM of Hairpin 1, Hairpin 2 from group
Fill buffer (8mM Na2HPO4,2.5mM NaH2PO4,0.15M NaCl,2mM MgCl2, pH 7.4) so that each reactant
The total volume of system is 50 μ l, 37 DEG C, 30min, carries out HCR reaction.As a result see Fig. 5.
5, the foundation and verifying for the module that develops the color
80 μ L enzyme activity buffer (100mM Tris, 120mM NaCl, 10mM MgCl2, 100mM KCl, pH8.4), 10 μ L
Hemin solution and 10 μ L HCR products, 37 DEG C of reaction 30min after mixing make HCR product combination hemin
Being formed has active tetra- stranded structure of G of peroxidase, and 100 μ L ABTS developing solutions are added, and mixes, 37 DEG C are protected from light incubation
10min, microplate reader measure OD415。
The preparation method of the hemin solution is：The hemin for being 20mM with DMSO compound concentration is former
Liquid, 2 μ L hemin stostes are mixed with enzyme activity buffer described in 1mL to get.
6, the hypersensitive of double metal ion, visual quickly detection
According to above-mentioned optimization system, it is separately added into 0.5,1,5,10,15 μM of Mg of various concentration2+With 20,60,90,
120, the Zn of 160nM2+Cleaved products carry out ultrafast PCR, PCR is subjected to self assembly, is shown under suitable buffer condition
Color draws the standard curve of colour developing, Mg according to color change2+Standard curve is shown in Fig. 6, Zn2+Standard curve is shown in Fig. 7.
Mg2+Detection range is 0.5-15 μM (can realize quantitative detection within this range), and minimum detectability is 0.12 μM.
Zn2+Detection range is 1-800nM (can realize quantitative detection within this range), and minimum detectability is 0.86nM.
The specificity of 2 detection method of embodiment is investigated
According to the biosensor that embodiment 1 constructs, respectively by 1 μM of Mg2+、500nM Zn2+, 10 μM of Ag+、Cu2+、Cd2 +、Hg2+、Cr3+、Fe2+、Ca2+, be added in system and detected, the results showed that, the Mg established2+、Zn2+Bio-sensing utensil
There is preferable specific (Fig. 8).
The experiment of 3 mark-on of embodiment
High purity water is taken to be detected with the biosensor that embodiment 1 constructs, Mg2+、Zn2+Without detection, mark-on is carried out to it
Experiment, the multiple acquired results of METHOD FOR CONTINUOUS DETERMINATION are shown in Table 1, table 2.
1 recovery testu result of table
2 recovery testu result of table
The optimization in 4 HCR reaction time of embodiment
According to the biosensor that embodiment 1 constructs, probe 1, probe 2 are dissolved to 100 μM with water respectively, added in 95 DEG C
Then it is spare to be slowly dropped to room temperature by hot 5min；PCR product is added in the mixed liquor of final concentration of 2 μM of probe 1 and probe 2,
And self assembly buffer is added to 50 μ L of total volume.The HCR reaction time is 10min, 20min, 30min, 1h respectively.HCR is produced
Object develops the color, and as a result sees Fig. 9, can form enough long double-strands as seen from Figure 9, in 30min, it is thus determined that reaction
Time is 30min.
The optimization of hairpin probe sequence in 5 HCR of embodiment reaction
According to the biosensor that embodiment 1 constructs, following hairpin probe combination experiment group (table 3) is designed.It is used to inspire
The base sequence of son is as follows：5′-AGACGAAGCACTGGTTGAAAC-3′.
Table 3
The result is shown in Figure 10, as seen from Figure 10, the effect that experimental group 1 inspires HCR are best, therefore present invention selection will hair
Folder probe combinations Hairpin 1+Hairpin 2 inspires sequence as HCR.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be modified or is improved, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>China Agricultural University
<120>It is general to separate ultrafast amplification magnesium, zinc cutting-type functional nucleic acid visible detection method
<130> KHP181111295.9
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 38
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gtcacgagtc actataggaa gatggcgaaa ttcggggc 38
<210> 2
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
tttcgccatc ttctccgagc cggtcgaaat agtgactcgt gac 43
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ggaagatggc gaaattcggg gc 22
<210> 4
<211> 58
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gtgggtaggg cgggttggcc aacccgccct acccactcat cgcaccgtca aaggaacc 58
<210> 5
<211> 54
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ccaccacaat gttatacagg tactatagga agttgagtta cgaggcggtg gtgg 54
<210> 6
<211> 33
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
ctcaacttct ccgagccggt cgaaatagta cct 33
<210> 7
<211> 27
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
ggaagttgag ttacgaggcg gtggtgg 27
<210> 8
<211> 70
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
agacgaagca ctggttgaaa ctccggagtt tcaaccagtg cttcgtcttc atcgcaccgt 60
caaaggaacc 70
<210> 9
<211> 64
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
agggcgggtg ggtggagttt caaccagtgc ttcgtctccc cagacgaagc actggttgat 60
gggt 64
<210> 10
<211> 64
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
tgggtagacg aagcactggt tgaaactcct caaccagtgc ttcgtctggg gtgggtaggg 60
cggg 64
<210> 11
<211> 100
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
tcatcgcacc gtcaaaggaa cctcagtatc agtgctatac gtcgatcagt agccccgaat 60
ttcgccatct tccccaccac cgcctcgtaa ctcaacttcc 100
Claims (10)
1. the system of a kind of quickly detection magnesium, zinc ion, which is characterized in that including：(1) system is cut, (2) sPCR expands body
System, (3) HCR system, (4) include the detection architecture of ABTS developing solution；
The detection architecture is used to successively carry out sample to be tested via the cutting system, sPCR amplification system and HCR system
Products therefrom carries out color developing detection after reaction；
Wherein, the cutting system includes substrate chain I and enzyme chain I and substrate chain II and enzyme chain II：
Substrate chain I：5′-GTCACGAGTCACTATrA—GGAAGATGGCGAAA-3′
Enzyme chain I：5′-TTTCGCCATCTTCTCCGAGCCGGTCGAAATAGTGACTCGTGAC-3′
Wherein, rA indicates ribonucleic acid；Indicate magnesium ion cleavage site；
Substrate chain II：5′-CCACCACAATGTTATACAGGTACTATrA—GGAAGTTGAGTTACGAGGCGGTGGTGG-3′
Enzyme chain II：5′-TTTCGCCATCTTCTCCGAGCCGGTCGAAATAGTGACTCGTGAC-3′
Wherein, rA indicates ribonucleic acid；Indicate zinc ion cleavage site；
The sPCR amplification system includes：Forward direction partition primer I, reverse primer I, positive partition primer I I, reverse primer II, mould
Plate：
Forward direction partition primer I：5 '-GTGGGTAGGGCGGGTTGG- interruption-CCAACCCGCCCTACCCACTCATCGCACCGT
CAAAGGAACC-3′
Reverse primer I：5′-GGAAGATGGCGAAATTCGGGGC-3′
Forward direction partition primer I I：5 '-AGACGAAGCACTGGTTGAAACTCC- interruption-GGAGTTTCAACCAGTGCTTCGTC
TTCATCGCACCGTCAAAGGAACC-3′
Reverse primer II：5′-GGAAGTTGAGTTACGAGGCGGTGGTGG-3′
Template：5′-TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTAGCCCCGAATTTCGC
CATCTTCCCCACCACCGCCTCGTAACTCAACTTCC-3′；
The HCR system includes 2 probes：
Probe 1：5′-AGGGCGGGTGGGTGGAGTTTCAACCAGTGCTTCGTCTCCCCAGACGAAGCACTGGTTGATGGGT
-3′
Probe 2：5′-TGGGTAGACGAAGCACTGGTTGAAACTCCTCAACCAGTGCTTCGTCTGGGGTGGGTAGGGCGGG
-3′。
2. system according to claim 1, which is characterized in that the interruption in the positive partition primer is poly- six second two
Alcohol.
3. system according to claim 1 or 2, which is characterized in that the detection architecture includes：Enzyme activity buffer and chlorine are high
Iron haemachrome solution.
4. the described in any item systems of claim 1-3 in detection magnesium, in terms of zinc ion in application.
5. application according to claim 4, which is characterized in that described to be detected as qualitative detection or quantitative detection.
6. the ultrafast amplification magnesium of general partition, zinc cutting-type functional nucleic acid based on any one of the claim 1-3 system are visual
Change qualitative checking method, which is characterized in that include the following steps：
S1, sample to be tested is added into the cutting system, carries out cleavage reaction；
S2, ultrafast polymerase chain reaction will be carried out in the addition of cleaved products obtained by the S1 sPCR amplification system, obtains sPCR production
Object；
S3, progress HCR reaction in the HCR system is added in the sPCR product, obtains HCR product；
S4, the HCR product is detected using the detection architecture.
7. according to the method described in claim 6, it is characterized in that, S1 is specific as follows：Substrate chain and enzyme chain are pressed into equimolar ratio
Example mixing, is diluted to 1 μM -2 μM of concentration with buffer, then 85 DEG C of -95 DEG C of heating 15min are cooled to 25-37 DEG C, obtain core
Enzyme solution；Testing sample solution is added into ribozyme liquid described in 35 μ L, forms 40 μ L systems, in 36-38 DEG C of incubation 4-6min, then
4-6 μ L terminate liquid is added, obtains cleaved products.
8. according to the method described in claim 6, it is characterized in that, the detection architecture includes enzyme activity buffer and chlorine siderosis
Enzyme activity buffer, hemin dilute solution and HCR product are 8 by red pigment dilute solution by volume:1:1 mixes,
20-40min, addition and the isometric ABTS developing solution of aforementioned mixture are reacted under the conditions of 35-38 DEG C, are mixed, 35-38 DEG C is protected from light
It is incubated for, is visually monitored.
9. the ultrafast amplification magnesium of general partition, zinc cutting-type functional nucleic acid based on any one of the claim 1-3 system are visual
Change quantitative detecting method, which is characterized in that include the following steps：
SI, production standard curve：
Using the magnesium of known concentration, zinc ion solution, cutting system of the building with different magnesium, zinc ion concentration, sPCR amplification,
HCR reaction and detecting step are identical as the step in claim 6；
Using magnesium, zinc ion concentration as abscissa, with OD415Value is ordinate, draws standard curve；
SII, sample to be tested is detected according to the method for claim 6, the OD that will be measured415Value substitutes into standard curve,
The content of magnesium in sample to be tested, zinc ion is calculated, realizes the quantitative detection to magnesium, zinc ion.
10. according to the method described in claim 9, it is characterized in that, the concentration ranges difference of the difference magnesium, zinc ion concentration
For 0.5-15 μM and 1-800nM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810639040.9A CN108841937B (en) | 2018-06-20 | 2018-06-20 | General partition ultrafast amplification magnesium and zinc cutting type functional nucleic acid visual detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810639040.9A CN108841937B (en) | 2018-06-20 | 2018-06-20 | General partition ultrafast amplification magnesium and zinc cutting type functional nucleic acid visual detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108841937A true CN108841937A (en) | 2018-11-20 |
| CN108841937B CN108841937B (en) | 2020-07-28 |
Family
ID=64202628
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810639040.9A Active CN108841937B (en) | 2018-06-20 | 2018-06-20 | General partition ultrafast amplification magnesium and zinc cutting type functional nucleic acid visual detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108841937B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609607A (en) * | 2018-12-25 | 2019-04-12 | 中国农业大学 | A method of for zinc ion quantitative detection |
| CN109777860A (en) * | 2019-01-29 | 2019-05-21 | 中国农业大学 | One kind being used for Zn2+The functional nucleic acid biosensor of quantitative detection |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107012208A (en) * | 2017-03-08 | 2017-08-04 | 广东省生态环境技术研究所 | A kind of label-free lead ion visible detection method and detection kit |
| CN107966438A (en) * | 2017-10-27 | 2018-04-27 | 中国农业大学 | A kind of sensor of resistance to high salt of functional nucleic acid based on zinc and its application |
| CN107966423A (en) * | 2017-10-27 | 2018-04-27 | 中国农业大学 | A kind of colorimetric sensor of resistance to high salt of functional nucleic acid based on zinc and its application |
| CN107966436A (en) * | 2017-10-27 | 2018-04-27 | 中国农业大学 | A kind of visible sensor of functional nucleic acid based on cadmium and its application |
-
2018
- 2018-06-20 CN CN201810639040.9A patent/CN108841937B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107012208A (en) * | 2017-03-08 | 2017-08-04 | 广东省生态环境技术研究所 | A kind of label-free lead ion visible detection method and detection kit |
| CN107966438A (en) * | 2017-10-27 | 2018-04-27 | 中国农业大学 | A kind of sensor of resistance to high salt of functional nucleic acid based on zinc and its application |
| CN107966423A (en) * | 2017-10-27 | 2018-04-27 | 中国农业大学 | A kind of colorimetric sensor of resistance to high salt of functional nucleic acid based on zinc and its application |
| CN107966436A (en) * | 2017-10-27 | 2018-04-27 | 中国农业大学 | A kind of visible sensor of functional nucleic acid based on cadmium and its application |
Non-Patent Citations (2)
| Title |
|---|
| JINGJING TIAN等: "Visual Single Cell Detection of Dual-Pathogens based on Multiplex Super PCR (MS-PCR) and Asymmetric Tailing", 《SENSORS AND ACTUATORS B》 * |
| WENTAO XU等: "A rapid and visual turn-off sensor for detecting copper (II) ion based", 《SCIENTIFIC REPORTS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609607A (en) * | 2018-12-25 | 2019-04-12 | 中国农业大学 | A method of for zinc ion quantitative detection |
| CN109609607B (en) * | 2018-12-25 | 2022-03-01 | 中国农业大学 | Method for quantitative detection of zinc ions |
| CN109777860A (en) * | 2019-01-29 | 2019-05-21 | 中国农业大学 | One kind being used for Zn2+The functional nucleic acid biosensor of quantitative detection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108841937B (en) | 2020-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109321672B (en) | Nucleotide composition, kit and detection method | |
| CN107686863A (en) | The method that loop-mediated isothermal amplification technique detects three kinds of Urogenital Mycoplasmas | |
| CN108841937A (en) | It is general to separate ultrafast amplification magnesium, zinc cutting-type functional nucleic acid visible detection method | |
| CN104328212B (en) | The primer sets of ring mediated isothermal amplification method detection B group streptococcus and test kit | |
| CN108949931A (en) | A kind of general ultrafast amplification visible sensor of partition of zinc ion cutting-type | |
| CN102827929A (en) | Method for detecting nucleic acid | |
| CN104131112A (en) | Primer group for gonococci detection, kit containing primer group and application thereof | |
| CN108251514A (en) | A kind of colorimetric sensing new method of dual pathogenic bacteria | |
| CN106370638A (en) | Colorimetric and fluorescent double-signal biosensor for detecting Hg<2+>, and detection method of biosensor | |
| CN110373485A (en) | A kind of ureaplasma urealyticum, three joint inspection kit of chlamydia trachomatis and gonococcus | |
| CN108949932A (en) | It is general to separate ultrafast amplification copper, calcium cutting-type functional nucleic acid visible detection method | |
| CN101886122A (en) | Method for detecting chlamydia pneumoniae by loop-mediated isothermal amplification and detection kit | |
| CN114875174A (en) | LAMP primer group, kit and detection method for rapidly identifying russula vinosa | |
| CN111560377A (en) | Multivalent nucleic acid and application thereof in preparation of MALAT1 detection kit | |
| CN108949934B (en) | Chromium ion cutting type universal partition ultrafast amplification visual sensor | |
| CN110592186B (en) | AND molecular logic gate sensing system AND preparation method AND application thereof | |
| CN104152601A (en) | Preparation method of flame retardant phosphorylation fatliquor | |
| CN110628950A (en) | Primer combination, kit and PSR method for detecting EV71 virus | |
| CN108949918A (en) | It is general to separate ultrafast amplification magnesium, sodium cutting-type functional nucleic acid visible detection method | |
| CN110218775A (en) | PCR fluorescence visual colorimetric determination detection method and kit based on ruthenium complex | |
| CN108949936A (en) | A kind of general ultrafast amplification visible sensor of partition of magnesium ion cutting-type | |
| CN108841938A (en) | A kind of general ultrafast amplification visible sensor of partition of copper ion cutting-type | |
| CN108841935A (en) | A kind of general ultrafast amplification visible sensor of partition of sodium ion cutting-type | |
| CN106755379A (en) | 4 kinds of Aspergillus are synchronously quantified and the dimer of Genotyping is mutated fluorescent primer quantifying PCR method | |
| CN109022561B (en) | Universal partition ultrafast amplification mercury and copper mismatch type functional nucleic acid colorimetric sensor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |