CN108841836A - Barley HvAIR12 gene and application thereof - Google Patents
Barley HvAIR12 gene and application thereof Download PDFInfo
- Publication number
- CN108841836A CN108841836A CN201810682137.8A CN201810682137A CN108841836A CN 108841836 A CN108841836 A CN 108841836A CN 201810682137 A CN201810682137 A CN 201810682137A CN 108841836 A CN108841836 A CN 108841836A
- Authority
- CN
- China
- Prior art keywords
- hvair12
- gene
- barley
- bsmv
- aluminium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to HvAIR12 genes in the annual Wild Barley genotype XZ16 and XZ61 and Cultivate berley kind Dayton in Qinghai-Tibet Platean and application thereof, belong to gene engineering technology field.Specifically, the invention discloses a kind of barley HvAIR12 gene, the CDS region nucleotide sequence of the gene such as SEQ ID NO：Shown in 1.The present invention goes back while providing the protein of above-mentioned Wild Barley HvAIR12 gene coding, the amino acid sequence of the protein such as SEQ ID NO：Shown in 2.The present invention goes back while providing above-mentioned Wild Barley HvAIR12 gene in enhancing barley to the purposes in terms of sour aluminium tolerance；Induction of the gene by sour aluminium significantly reduces barley to the tolerance of sour aluminium.
Description
Technical field
The present invention relates to a kind of barley genes, are specifically related to a kind of annual Wild Barley genotype XZ16 in Qinghai-Tibet Platean
With HvAIR12 gene and application thereof in XZ61 and Cultivate berley kind Dayton, belong to gene engineering technology field.
Background technique
The available arable land in the whole world about 30% and 50% potential arable soil be acid soil, in acid soil
Under the conditions of, aluminium toxicity is very important the factor (Kochian etc., 2004) of limitation crop yield and plant growth.Aluminium conduct
In the earth's crust other than oxygen and silicon the highest metallic element of content, generally deposited in the form of the silicate of slightly solubility or aluminium oxide
It is in soil, the existing forms of aluminium act on plant nonhazardous at this time, but when soil pH is less than 5.5, aluminium can be from mineral state
Ionic state is dissociated into (wherein with Al3+Ion toxicity is most strong) growth and function for inhibiting root system of plant into soil are discharged, influence root
It is the absorption to moisture and mineral element, and then reduces the yield (Lou etc., 2016) of plant.
In early stage, AIR12 (Auxin-Induced in Root cultures 12) is considered as the response of early growth element
Gene A ux/IAAs family member (Woodward etc., 2005), but it was unexpected that recent studies indicate that, AIR12 is identified
To be to restore type ascorbic acid cytochrome b family member, this conclusion is all verified in soybean, Kidney bean and arabidopsis
(Preger etc., 2009).AIR12 is anchored with glycosyl-phosphatidyl inositol (glycosylphosphatidylinositol, GPI)
Region (Borner etc., 2003), and it connect (Lefebvre etc., 2007) with Lipid Rafts together with other redox proteins, altogether
With the redox chain constituted inside and outside cell membrane, regulates and controls downstream ROS signal transduction, induce the morphogenesis of root.Alex's etc. grinds
Study carefully the AIR12 for showing overexpression and accumulate ROS (peroxide and hydrogen peroxide) and lipid peroxide in blade, illustrates
Under specified conditions, AIR12 may change the redox state in apoplast, and AIR12 is knocked out, and plant reduces to grey mold
The sensibility (Alex etc., 2015) of bacterium infection.Biniek (2017) etc. is studies have shown that NQR is mutual by quinones substance and AIR12
Effect, makes NAD (P) the H electron transmission of cytosol into single hydroascorbic acid of apoplast, thus the water of regulation activity oxygen
The redox state of gentle apoplast.
VIGS (Virus-induced gene silencing), virus induced gene silencing is initially one kind by RNA
The plant virus resistance mechanism of mediation, it becomes the important method with reverse genetics research gene function now
(Holzberg etc., 2002).BSMV-VIGS is in addition to high conversion efficiency, except cost performance is high, it and based on stablizing genetic transformation
The difference of RNAi not substantially.The most important advantage of BSMV-VIGS is exactly fast, and compared with RNAi, it also has very
The ability of the good larger target gene of receiving.So far, in some important unifacial leaf cereal crops such as barleys, wheat
It is applied successfully on (Triticum aestivum L.), rice and corn (Zea mays L.), compensates for some other
VIGS carrier may not apply to the deficiency of unifacial leaf cereal crops, be in recent years VIGS research a hot spot (Lee etc.,
2012), and this seminar establishes related system and application on Wild Barley.
Chinese Qinghai-Tibet Platean is one of Cultivate berley area of origin (Dai etc., 2012), the annual Wild Barley in Qinghai-Tibet Platean
(Hordeum vulgare L.ssp.Spontaneum) provides gene pool abundant for people, and due to its local environment
The reason of, the annual Wild Barley in Qinghai-Tibet Platean has oneself unique resistant gene regulated and control network, therefore from Wild Barley
Excellent resistant gene is excavated, and then is applied, is had great importance to improvement of crop cultivar and Barley Breeding.
Summary of the invention
The present invention provides a kind of barley HvAIR12 gene, the CDS region nucleotide sequence of the gene such as SEQ ID No：1 institute
Show.Barley HvAIR12cDNA is from annual Wild Barley (the Hordeum vulgare in Qinghai-Tibet Platean
L.ssp.Spontaneum, six-rowed barley) XZ16 (acidproof (aluminium) genotype), XZ61 (sour (aluminium) Sensitive genotype) and acidproof
(aluminium) Cultivate berley kind Dayton.
The present invention also provides the protein of above-mentioned HvAIR12 gene coding, are SEQ ID NO：Amino acid sequence shown in 2
Column.HvAIR12 amino acid sequence derives from XZ16, XZ61 and Dayton.
The present invention goes back while providing a kind of BSMV:HvAIR12 recombinant vector, by SEQ ID No：241bp shown in 3
HvAIR12 genetic fragment is connected between the site NheI of RNA γ carrier, to construct and obtain.SEQ ID No：3 is for constructing
BSMV:The HvAIR12 genetic fragment of HvAIR12 recombinant vector derives from XZ16.
The present invention goes back while providing the barley HvAIR12 gene in enhancing barley to the use in terms of sour aluminium tolerance
On the way.Induction of the gene by sour aluminium significantly reduces barley to the tolerance of sour aluminium.The present invention utilizes recombinant plasmid
BSMV:HvAIR12 studies the purposes of HvAIR12 gene on XZ16.
The annual Wild Barley XZ16 (acidproof (aluminium) genotype) in Qinghai-Tibet Platean that the present invention is screened early period with seminar
For main material (wearing Hua Xin, the research of the annual Wild Barley poison of the resistance to aluminium mechanism in Qinghai-Tibet Platean, doctoral thesis in 2013), clone
The barley related gene of resistance to aluminium under acid-aluminum stress has weight to the molecule mechanism and breeding that illustrate barley response acid-aluminum stress and production
Want meaning.
The present invention separates the CDS region sequence such as SEQ ID No for having cloned barley HvAIR12 gene：Shown in 1, the egg of coding
The amino acid sequence of white matter such as SEQ ID No：Shown in 2.
HvAIR12 gene cloning and analysis：Alternative Gene A uxin- is picked out based on root transcript profile sequencing result
Induced protein AIR12 has cloned the overall length CDS region sequence of the gene from XZ16, XZ61 and Dayton, has been named as
HvAIR12.HvAIR12 gene C DS area overall length 783bp, encodes the protein sequence of a 260aa, which is
25.35KDa isoelectric point pI=10.13.HvAIR12 protein sequence is passed through into SMART (http://smart.embl-
Heidelberg.de/) website and InterPro (http://www.ebi.ac.uk/interpro/) website carry out functional domain it is pre-
Analysis is surveyed, the albumen contains 1 functional domain as the result is shown：DOMON functional domain.HvAIR12 protein sequence is subjected to chadogram point
Analysis, the albumen and rice Os AIR12 are located on same clade as the result is shown.The inducing expression of aluminium is carried out to HvAIR12 gene,
Induction of the expression of the gene by aluminium as the result is shown.
BSMV:HvAIR12 construction of recombinant vector：The HvAIR12 genetic fragment of one 241bp is connected into RNA γ carrier
Between the site NheI.On the one hand the positive colony being reversely inserted into send company to be sequenced, correct monoclonal upgrading on the other hand will be sequenced
Grain carries out digestion verification, it is ensured that the accuracy of recombinant vector.
HvAIR12 gene function is verified on Wild Barley XZ16 using BSMV-VIGS method：With MluI restriction enzyme
Enzyme is by RNA α and RNA γ:The abundant digestion of HvAIR12 plasmid makes it with SpeI restriction enzyme by the abundant digestion of RNA β plasmid
Linearisation, to guarantee subsequent in vitro transcription production BSMV virus.Using in-vitro transcription kit by linearisation product after purification
It is transcribed in vitro, by the BSMV of in-vitro transcription:HvAIR12 is inoculated with second leaf of two leaf phase Wild Barley XZ16.In order to grind
Study carefully the function of HvAIR12 gene and determines BSMV:Four processing are arranged altogether, are respectively for HvAIR12 silencing efficiency：Blade inoculation
BSMV:HvAIR12 (processing 1), blade inoculation BSMV:γ (processing 2), blade inoculation BSMV:HvAIR12 simultaneously carries out 200 μM of aluminium
Processing (processing 3), blade inoculation BSMV:γ simultaneously carries out 200 μM of aluminium processing (processing 4).After being inoculated with 14d, the observation main root tip of a root
Growing state and plant underground part aluminium content.Under aluminium treatment conditions, BSMV is inoculated with simulation:The plant of γ is compared, and BSMV is inoculated with:
The aluminium content of the plant underground part of HvAIR12 significantly improves (processing 3vs.4).For being inoculated with BSMV:The plant of HvAIR12 comes
It says, either under normal or aluminium treatment conditions, compared with its adjoining tree, the expression quantity of HvAIR12 gene point in root system
It is not inhibited by 57% and 76% (processing 3vs.4, handle 1vs.2), and is inoculated with BSMV:HvAIR12 plant (processing 3) is opposite
In adjoining tree (processing 4), the damage that plant root contains more aluminium ions and main root tip of a root part is subject to is more serious,
These results significantly reduce barley to the tolerance of sour aluminium after illustrating the gene silencing.
The present invention combines BSMV-VIGS technology right on XZ16 by clone to barley HvAIR12 gene and analysis
The gene carries out functional verification discovery, and the expression of HvAIR12 gene can significantly improve under aluminium induction, silencing HvAIR12 gene
Include more aluminium ions in XZ16 plant body afterwards, the tolerance of sour aluminium is significantly reduced.The present invention is that barley alumite is educated
Kind provides theoretical foundation and related gene with production.
Detailed description of the invention
Fig. 1 is the HvAIR12 gene expression amount under aluminium processing and normal condition in ZX16.
Fig. 2 is the nucleotide alignments of three barley gene types (ZX16, ZX61 and Dayton).
Fig. 3 is HvAIR12 functional domain prognostic chart；Digital represented amino acid sequence site.
Fig. 4 is HvAIR12 and rice Os AIR12, corn ZmAIR12 and arabidopsis AtAIR12 Amino acid sequences alignment, is gone back
Chadogram constructed by other species including four.
Fig. 5 is BSMV:HvAIR12 vector construction figure, linearized graph and in-vitro transcription figure.(A)BSMV:HvAIR12 carrier
Schematic diagram.(B)RNAγ:HvAIR12 digestion products agarose gel electrophoresis figure.(C)RNAγ:HvAIR12 linearizes agarose
Gel electrophoresis figure.(D)RNAγ:Agarose gel electrophoresis figure is transcribed in vitro in HvAIR12.1 is RNA γ:HvAIR12,2 be RNA
γ:For HvAIR12 through MluI digestion, 3 be RNA γ:HvAIR12 gets off through NheI digestion, the digestion from carrier of arrow meaning
HvAIR12 genetic fragment, 4 be RNA α through MluI digestion, and 5 be RNA β through SpeI digestion, and 6 be RNA γ:HvAIR12 is through MluI enzyme
It cuts, 7 be the RNA α being transcribed in vitro, and 8 be the RNA β being transcribed in vitro, and 9 be the RNA γ being transcribed in vitro:HvAIR12.M1 is 15000bp
DNA marker, M2 are that 500bp DNA marker, M3 are 5000bp DNA marker.
Fig. 6 is the function of verifying HvAIR12 gene on Wild Barley XZ16 using BSMV-VIGS method.(A)RT-PCR
Analyze the expression of HvAIR12 gene in root.(B) ion concentration in ICP method measurement plant body.(C) stereomicroscope observation
Tip of a root phenotype.(D) morin dyes the plant tip of a root and calculates fluorescence volume.Processing (1) is inoculation BSMV:HvAIR12 and basic
14d is grown in culture solution (BNS), processing (2) is inoculation BSMV:γAnd 14d is grown in BNS, processing (3) is inoculation BSMV:
HvAIR12 simultaneously grows 7d in BNS and carries out 200 μM of aluminium processing 7d, and processing (4) is inoculation BSMV:γAnd 7d is grown in BNS
And it carries out 200 μM of aluminium and handles 7d.
Specific embodiment
Below by specific embodiment, technical scheme of the present invention will be further explained in detail.It should be appreciated that this hair
Bright implementation is not limited by the following examples, and the accommodation in any form made to the present invention and/or changed will all be fallen
Enter the scope of the present invention.
In the present invention, if not refering in particular to, all parts, percentage are unit of weight, used equipment and raw material etc.
It is commercially available or commonly used in the art.Method in following embodiments is unless otherwise instructed the normal of this field
Rule method.
Clone and the analysis of embodiment 1, the area gene C DS HvAIR12 and promoter sequence
1, barley growth condition
Qinghai-Tibet Platean annual Wild Barley XZ16, XZ61 and Cultivate berley kind Dayton seed with 2% H2O2Disinfection
30min is then used distilled water flushing 5-6 times, the seed sterilized is placed on the germination box for being covered with the double-deck wet filter paper, germination
Box is transformed by storage box, punches on lid, germination box in be added distilled water simultaneously ventilate, in growth room carry out dark culture (22 DEG C/
18 DEG C), light filling (22 DEG C/18 DEG C, daytime/night) are carried out after sprouting.When 6d, chooses the consistent seedling of growing way and be transferred to 1L
It fills in the black plastic bucket of barley basic culture solution, is covered with 5 hole plastic lids, two plants of every hole seedling is consolidated using sponge
It is fixed, it is cultivated in barley culturing room, barley basic culture solution is formulated using 1/5Hogland.By the ZX16 after preculture 3d
Plant carries out Acid-Al stress (200 μM of Al are dissolved in basic nutrition liquid, pH 4.3) test, is control with basic nutrition liquid (pH 4.3),
Handling the time is for 24 hours, to carry out the aluminium inducing expression of HvAIR12 gene.
By qRT-PCR's the results show that HvAIR12 gene in ZX16 by the induction of aluminium after, expression quantity improves
2.33 times (Fig. 1).
2, the clone of HvAIR12 gene C DS region sequence
The root XZ16, XZ61 and Dayton total serum IgE is carried out according to the specification of RNA extracts kit (Takara, Japan)
Extraction, and with DNaseI removal total serum IgE in contaminating genomic DNA, by the total serum IgE reverse transcription of extraction at cDNA.According to blast
Sequence carries out specific primer design, and specific primer sequence is：
HvAIR12-CDS-F：ATGGCCTCCACGATGCCGC
HvAIR12-CDS-R：TCATACTACCGCGAGGAGGC
The product after glue verifying is run amplifying, and is carried out glue recycling connection pMD18-T carrier, is converted Escherichia coli
Positive colony is sent to company and is sequenced by DH5 α, and sequencing correctly carries out upgrading grain respectively and glycerol saves.XZ16, XZ61 and
The CDS region nucleotide sequence of tri- barley gene types of Dayton is identical, is referred to as then HvAIR12 (Fig. 2), gained plasmid life
Entitled pMD18-T-HvAIR12 plasmid.
PCR primer is completed by Sangon Biotech (Shanghai) Co., Ltd., and gene sequencing work is still raw by Shanghai platinum
Object Technology Co., Ltd. completes.
The CDS region nucleotide sequence of barley HvAIR12 gene such as SEQ ID NO：Shown in 1.
3, HvAIR12 gene sequencing
HvAIR12 protein sequence is passed through into SMART (http://smart.embl-heidelberg.de/) website progress
The prediction and analysis of functional domain, the albumen contains only a functional domain as the result is shown：DUF568 functional domain (Fig. 3), but DUF
Domain is not discussed in detail on this website, and function is also indefinite.HvAIR12 protein sequence is then passed through into InterPro
(http://www.ebi.ac.uk/interpro/) website progress functional domain forecast analysis, the albumen contains one as the result is shown
Functional domain：DOMON domain, there is subordinate relation with cellobiose dehydrogenase and cytochrome d omain.
By 6 software of Clustal W and MEGA by the different plant species including containing HvAIR12 AIR12 sequence and
Difference AIR family protein sequence is analyzed in arabidopsis, phylogenetic tree construction.As the result is shown HvAIR12 evolve it is upper with
Rice Os AIR12 is located at same clade (Fig. 4).
Embodiment 2, BSMV-VIGS method verify HvAIR12 gene function in Wild Barley ZX16
1,BSMV:HvAIR12 vector construction
The root XZ16 carried out under normal growing conditions using the specification of RNA extracts kit (Takara, Japan) is total
The extraction of RNA, and contaminating genomic DNA in total serum IgE is removed with DNaseI, according to PrimeScriptTMII 1st Strand
CDNA Synthesis Kit (Takara, Japan) specification step is by blade RNA reverse transcription at cDNA.With previously stored
PMD18-T-HvAIR12 plasmid is template design primer, expands the HvAIR12 genetic fragment of 241bp.
| KOD enzyme PCR reaction system | μL |
| 2×PCR buffer for KOD FX | 25 |
| 2mM dNTPs | 10 |
| 10pmol/μl HvAIR12-γ-F | 1.5 |
| 10pmol/μl HvAIR12-γ-R | 1.5 |
| Template DNA | 1 |
| KOD FX | 1 |
| ddH2O | 10 |
| Total volume | 50 |
Amplification program is：94 DEG C of 2min, (98 DEG C of 10s, 59 DEG C of 30s, 68 DEG C of 15s) 35 circulations, 68 DEG C of 5min.
Primer sequence is (underscore is restriction enzyme site)：
HvAIR12-γ-F：GTACGCTAGCACAACATCACCGGCTACGTG
HvAIR12-γ-R：GTACGCTAGCAGGACGAGCTTGGACTTGGA
HvAIR12 genetic fragment is connected on pMD18-T carrier, bacillus coli DH 5 alpha is converted, picking positive colony is sent
It is sequenced toward company, correct monoclonal is sequenced and carries out shaking bacterium upgrading grain and glycerol preservation.The pMD18-T-HvAIR12 plasmid of extraction
Digestion is carried out using I restriction enzyme of Nhe, respectively and by same restriction enzyme endonuclease digestion and dephosphorylized virus
Vector rna γ:TaPDS carrier (He little Yan, point of Analysis of Tibetan Wild Barley root hair adjusting and controlling growth gene HvEXPB7 under drought stress
From, clone and Function Identification, doctoral thesis (2015)) reaction is attached by T4 ligase.Product conversion after connection
Bacillus coli DH 5 alpha uses the forward primer HvAIR12- of primer γ-stain-F and the HvAIR12 gene on RNA γ carrier
The positive colony being reversely inserted into is sent to company's sequencing by the reversed insertion of γ-F verifying, correct monoclonal is sequenced carries out shaking bacterium and mention
Plasmid and glycerol save, and the plasmid of extraction carries out digestion and verifies (Fig. 5 B) again, which is named as RNA γ:HvAIR12.
γ-stain-F：CAACTGCCAATCGTGAGTAGG.
PCR primer is completed by Sangon Biotech (Shanghai) Co., Ltd., and gene sequencing work is still raw by Shanghai platinum
Object Technology Co., Ltd. completes.
2, BSMV vector linearization and in-vitro transcription
Use I restriction enzyme single endonuclease digestion RNA α of Mlu, RNA γ and RNA γ:HvAIR12, while being limited using Spe I
Property restriction endonuclease single endonuclease digestion RNA β, make its linearisation respectively, digestion products run glue, glue recovery purifying product (Fig. 5 C, D).It will purifying
Certain density RNA α, RNA β, RNA γ and RNA γ afterwards:HvAIR12 is according to RiboMAXTM LargeScale RNA
Production System-T7kit and Ribo m7G Cap Analog kit kit description of test book carries out reverse transcription
(Promega, the U.S.), all operations need to guarantee the interference without RNase.By RNA α, RNA β and the RNA after in-vitro transcription
γ/RNAγ:HvAIR12 plasmid is according to 1:1:1 volume ratio is mixed, and the RNase-free water dilution of three times volume is added,
Then be added in cut back isometric 2 × GKP buffer (1%bentonite, 1%celite, 50mM glycine and
30mM dipotassium hydrogen phosphate pH 9.2), it is uniformly mixed, for subsequent inoculation.Products therefrom is named as BSMV:HvAIR12.
3, barley seedlings culture before BSMV is inoculated with
Required Wild Barley ZX16 seed is tested with 2% H2O230min is sterilized, is then used distilled water flushing 5-6 times, it will
The seed sterilized is placed on the germination box for being covered with the double-deck wet filter paper, and germination box is transformed by storage box, punches on lid, is germinateed
Distilled water is added in box and ventilates, carries out dark culture (22 DEG C/18 DEG C) in growth room, carries out light filling (22 DEG C/18 after sprouting
℃).When 6d, the selection consistent seedling of growing way is transferred to 1L and fills in the black plastic bucket of barley basic culture solution, is moulded with 5 holes
Material lid covering, two plants of every hole seedling are fixed using sponge, are cultivated in barley culturing room, barley basic culture solution
It is formulated using 1/5Hogland.Every 3d replaces a culture solution, and the pH of culture solution is adjusted to 5.9 ± 0.1 with NaOH or HCl, entirely
Incubation air pump Continuous aeration.
4, BSMV inoculation verifying gene function
Second leaf of barley for choosing for two leaf phases carries out BSMV frictional inoculation, each plant under RNase-free environment
Using the said mixture of 8 μ L, specially：With RNA α+RNA β+RNA γ+GKP mixture BSMV:γ be control, with RNA α+
RNAβ+RNAγ:HvAIR12+GKP mixture BSMV:HvAIR12 is processing.Plant after inoculation sprays suitable DEPC immediately
Water, and with transparent plastic jacket moisturizing, after moisturizing 3d, cloche is taken down, continues culture (22 in barley growth culturing room
DEG C/18 DEG C, daytime/night), the phenotype of plant is observed in timing.This experiment shares 4 processing：It is inoculated with BSMV:HvAIR12 and
Growth 14d (processing 1), is inoculated with BSMV in basic culture solution (BNS):γ and the growth 14d (processing in basic culture solution (BNS)
2), it is inoculated with BSMV:HvAIR12 simultaneously grows 7d in basic culture solution (BNS), then carries out 200 μM of aluminium processing 7d (processing 3), connects
Kind BSMV:γ simultaneously grows 7d in basic culture solution (BNS), then carries out 200 μM of aluminium processing 7d (processing 4).3 weights of each processing
It is multiple, 8 plant of each repetition.After being inoculated with 14d, the growing state of the main root tip of a root and the aluminium content of plant are observed.Aluminium treatment conditions
Under, BSMV is inoculated with simulation:The plant of γ is compared, and BSMV is inoculated with:The aluminium content of the plant underground part of HvAIR12 significantly improves
(processing 3vs.4) (Fig. 6 B), and it is inoculated with BSMV:HvAIR12 plant (processing 3) is relative to adjoining tree (processing 4), main root root
The damage that nose part is subject to is more serious and contains more aluminium ions (Fig. 6 C, D), these results indicate that silencing HvAIR12
Include more aluminium ions in XZ16 plant body after gene, the tolerance of sour aluminium is significantly reduced.
5, RT-PCR verifies the expression quantity of HvAIR12 gene
Extract the RNA of XZ16 different disposal sample respectively using the specification of RNA extracts kit (Takara, Japan),
And contaminating genomic DNA in total serum IgE is removed with DNaseI, use PrimeScriptTMRT reagent Kit (Takara, Japan)
By the difference reverse transcription of each sample rna at cDNA.Utilize SYBR green fluorescence multienzyme complex (Takara, Japan) and Light
Cycler 480PCR instrument (Roche, Switzerland) carries out quantitative fluorescent PCR analysis to the expression of HvAIR12 gene in respective sample
(qRT-PCR), correction process and with a reference gene Actin is carried out to expression value.
PCR system is：
| Takara SYBR green fluorescence enzyme system | μL |
| SYBR Permix Ex TaqⅡ(Tli RNaseH Plus)(2×) | 10 |
| HvAIR12-RT-PCR-F/Actin-F | 0.8 |
| HvAIR12-RT-PCR-R/Actin-R | 0.8 |
| cDNA | 2 |
| ddH2O | 6.4 |
| Total volume | 20 |
The specific procedure of PCR is：95 DEG C of 30s, (95 DEG C of 5s, 60 DEG C of 30s) 40 circulations.Solubility curve program is：95℃
5s, 60 DEG C of 1min, 95 DEG C, 50 DEG C of 30s coolings.Utilize 2-ΔΔCqRelative quantitation method calculates gene expression values variation.Every group of experiment
In triplicate.RT-PCR primer sequence is：
HvAIR12-RT-PCR-F：5'-GGGGAAGACGTACGCCAAGT-3',
HvAIR12-RT-PCR-R：5'-CACGAACGCCAGCGAGAG-3',
Actin-F：5'-AAGCATGAAGATACAGGGAGTGTG-3',
Actin-R：5'-AAATTTATTCTCGGAAGAGGTTGTACA-3'.
Acquired results are：For being inoculated with BSMV:For the plant of HvAIR12, either in normal or aluminium treatment conditions
Under, compared with its adjoining tree, the expression quantity of HvAIR12 gene is inhibited by 57% and 76% (processing respectively in root system
3vs.4 handles 1vs.2) (Fig. 6 A).
In conclusion by clone to barley HvAIR12 and analysis, and combine BSMV-VIGS technology in Qinghai-Tibet Platean
Functional verification discovery is carried out to the gene on annual Wild Barley XZ16, the expression of HvAIR12 gene can be shown under aluminium induction
It writes and improves, include more aluminium ions in the XZ16 plant body after silencing HvAIR12 gene, the tolerance of sour aluminium is significantly dropped
It is low.
The above list is only a few specific embodiments of the present invention for finally, it should also be noted that.Obviously, this hair
Bright to be not limited to above embodiments, acceptable there are many deformations.Those skilled in the art can be from present disclosure
All deformations for directly exporting or associating, are considered as protection scope of the present invention.
Sequence table
<110>Zhejiang University
<120>Barley HvAIR12 gene and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 783
<212> DNA
<213>The annual Wild Barley (Hordeum vulgare L. ssp. spontaneum) in Qinghai-Tibet Platean
<400> 1
atggcctcca cgatgccgcg ccacatcgcg ctgctgttgc tcctgctcct cgtggcgtcc 60
acgcgcgcgg cgtccgcggc cggcgccggc gcgtgcgcgg ccgagaagtt cccggcgggg 120
aagacgtacg ccaagtgcga ggacctcccg cagctggggg ccgcgctgca ctggacctac 180
gacgagtcca agtcgtccct ctcgctggcg ttcgtggccg cgccggcggg ggccaacggg 240
tgggtggcct gggcgctcaa ccccacgggc gagggcatgg ccggcgcgca ggcgctcgtg 300
gcgctcaagg gctccggcgc cgccgcgccc accgtcagga cgtacaacat caccggctac 360
gtgccgctcg gcaaggcctc cacgcccatc gcgttcccgg ccaccgacct cgccgccgac 420
tccggcagcg ccggcaagat ccggctctac ggcaagctgc agctgcacag cggcatgaag 480
gccgtcaacc atatatggca ggtcggcacc tccgtcaccg ccggggcccc cgacaagcac 540
gctttcgccc ccggcaacct cgcctccaag tccaagctcg tcctctcggg caaagcggct 600
tccgcgacct cgccttcgcc gtcgcccgcc cccatggccg gtggcccgtc cggaagcgac 660
gccggcgcgg cggcgaccac ggcgccttct gccggcaagt ccccgtcggc cgcggccgcg 720
gccggcgtgt cggcgccggc actccttgtg ctcgcgttga tgggcctcct cgcggtagta 780
tga 783
<210> 2
<211> 260
<212> PRT
<213>The annual Wild Barley (Hordeum vulgare L. ssp. spontaneum) in Qinghai-Tibet Platean
<400> 2
Met Ala Ser Thr Met Pro Arg His Ile Ala Leu Leu Leu Leu Leu Leu
1 5 10 15
Leu Val Ala Ser Thr Arg Ala Ala Ser Ala Ala Gly Ala Gly Ala Cys
20 25 30
Ala Ala Glu Lys Phe Pro Ala Gly Lys Thr Tyr Ala Lys Cys Glu Asp
35 40 45
Leu Pro Gln Leu Gly Ala Ala Leu His Trp Thr Tyr Asp Glu Ser Lys
50 55 60
Ser Ser Leu Ser Leu Ala Phe Val Ala Ala Pro Ala Gly Ala Asn Gly
65 70 75 80
Trp Val Ala Trp Ala Leu Asn Pro Thr Gly Glu Gly Met Ala Gly Ala
85 90 95
Gln Ala Leu Val Ala Leu Lys Gly Ser Gly Ala Ala Ala Pro Thr Val
100 105 110
Arg Thr Tyr Asn Ile Thr Gly Tyr Val Pro Leu Gly Lys Ala Ser Thr
115 120 125
Pro Ile Ala Phe Pro Ala Thr Asp Leu Ala Ala Asp Ser Gly Ser Ala
130 135 140
Gly Lys Ile Arg Leu Tyr Gly Lys Leu Gln Leu His Ser Gly Met Lys
145 150 155 160
Ala Val Asn His Ile Trp Gln Val Gly Thr Ser Val Thr Ala Gly Ala
165 170 175
Pro Asp Lys His Ala Phe Ala Pro Gly Asn Leu Ala Ser Lys Ser Lys
180 185 190
Leu Val Leu Ser Gly Lys Ala Ala Ser Ala Thr Ser Pro Ser Pro Ser
195 200 205
Pro Ala Pro Met Ala Gly Gly Pro Ser Gly Ser Asp Ala Gly Ala Ala
210 215 220
Ala Thr Thr Ala Pro Ser Ala Gly Lys Ser Pro Ser Ala Ala Ala Ala
225 230 235 240
Ala Gly Val Ser Ala Pro Ala Leu Leu Val Leu Ala Leu Met Gly Leu
245 250 255
Leu Ala Val Val
260
<210> 3
<211> 241
<212> DNA
<213>The annual Wild Barley (Hordeum vulgare L. ssp. spontaneum) in Qinghai-Tibet Platean
<400> 3
acaacatcac cggctacgtg ccgctcggca aggcctccac gcccatcgcg ttcccggcca 60
ccgacctcgc cgccgactcc ggcagcgccg gcaagatccg gctctacggc aagctgcagc 120
tgcacagcgg catgaaggcc gtcaaccata tatggcaggt cggcacctcc gtcaccgccg 180
gggcccccga caagcacgct ttcgcccccg gcaacctcgc ctccaagtcc aagctcgtcc 240
t 241
Claims (5)
1. barley HvAIR12 gene, it is characterized in that：The CDS region nucleotide sequence of the gene such as SEQ ID NO：Shown in 1.
2. the protein of Wild Barley HvAIR12 gene coding as described in claim 1, it is characterized in that：The ammonia of the protein
Base acid sequence such as SEQ ID NO：Shown in 2.
3. a kind of BSMV:HvAIR12 recombinant vector, it is characterized in that：The BSMV:HvAIR12 recombinant vector is by SEQ ID
No：The HvAIR12 genetic fragment of 241bp shown in 3 is connected between the site NheI of RNA γ carrier, to construct and obtain.
4. Wild Barley HvAIR12 gene as described in claim 1 is in enhancing barley to the purposes in terms of sour aluminium tolerance.
5. the purposes of Wild Barley HvAIR12 gene according to claim 4, it is characterized in that：The gene is by sour aluminium
It induces, significantly reduces barley to the tolerance of sour aluminium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810682137.8A CN108841836B (en) | 2018-06-27 | 2018-06-27 | Barley HvAIR12 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810682137.8A CN108841836B (en) | 2018-06-27 | 2018-06-27 | Barley HvAIR12 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108841836A true CN108841836A (en) | 2018-11-20 |
| CN108841836B CN108841836B (en) | 2019-09-17 |
Family
ID=64199961
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810682137.8A Active CN108841836B (en) | 2018-06-27 | 2018-06-27 | Barley HvAIR12 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108841836B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880829A (en) * | 2019-03-22 | 2019-06-14 | 浙江大学 | Barley HvPAA1 gene and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018502A (en) * | 2015-08-12 | 2015-11-04 | 浙江大学 | HvEXPB7 gene of annual wild barley of Qinghai-Tibet Plateau and application thereof |
-
2018
- 2018-06-27 CN CN201810682137.8A patent/CN108841836B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018502A (en) * | 2015-08-12 | 2015-11-04 | 浙江大学 | HvEXPB7 gene of annual wild barley of Qinghai-Tibet Plateau and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| GENBANK: "AK248372.1", 《GENBANK》 * |
| GENBANK: "BAJ86090.1", 《GENBANK》 * |
| VERONIKA ZELINOV Á: "Short-term alumini um-induced change s in barley root tips", 《PROTOPLASMA》 * |
| 戴华鑫: "青藏高原一年生野生大麦耐铝毒机制的研究", 《中国博士学位论文全文数据库（电子期刊）农业科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880829A (en) * | 2019-03-22 | 2019-06-14 | 浙江大学 | Barley HvPAA1 gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108841836B (en) | 2019-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8927807B2 (en) | Nitrate-responsive promoter | |
| He et al. | Functional activation of a novel R2R3-MYB protein gene, GmMYB68, confers salt-alkali resistance in soybean (Glycine max L.) | |
| CN107759676A (en) | A kind of plant amylose synthesis associated protein Du15 and its encoding gene and application | |
| CN114752579A (en) | Application of ZmMAPK protein and coding gene thereof in regulation and control of low-temperature stress tolerance of plants | |
| CN109880829B (en) | Barley HvPAA1 gene and application thereof | |
| CN111172179A (en) | Ubiquitin ligase gene OsNLA2, protein and application thereof in rice breeding | |
| CN105018502B (en) | Annual Wild Barley HvEXPB7 genes in Qinghai-Tibet Platean and application thereof | |
| CN109182351B (en) | Barley HvALS1 gene and application thereof | |
| CN107475266A (en) | A kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application | |
| CN108841836B (en) | Barley HvAIR12 gene and application thereof | |
| CN109867716B (en) | Chimonanthus praecox CpVIN3 gene and application thereof | |
| CN109371041B (en) | Rice gene OsHGN for increasing grain number per ear and application thereof | |
| CN114921473B (en) | Gene for negative regulation and control of synthesis of endogenous salicylic acid of cassava and application of gene | |
| CN109666069A (en) | A kind of flowering of plant time character-related protein AtJAZ5 and its encoding gene and application | |
| CN104109192A (en) | Wheat draught-resistant gene and use thereof | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN111088239B (en) | Corn high-temperature response protein kinase ZmCDPK7, and coding gene and application thereof | |
| CN114921583A (en) | QTL for controlling wheat plant height, candidate gene TaDHL-7B thereof and application | |
| CN108103075B (en) | Switchgrass gene PvC3H29 for delaying plant senescence and application thereof | |
| CN112877326A (en) | Application of aluminum ion receptor ALR1 gene or protein for regulating and controlling aluminum resistance of plants | |
| CN109694873A (en) | Barley HvHOX9 gene and application thereof | |
| CN104017781A (en) | Agapanthus praecox gibberellin synthesis dioxygenase APGA20ox protein, and coding gene and probe thereof | |
| CN103834666A (en) | Gossypium spp. GhHSFA7 gene coding sequence and use thereof | |
| CN109355270A (en) | A kind of rice kinases OSK1 and its application | |
| CN106349353A (en) | Plant starch synthesis regulation related protein OsFSE as well as coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |