CN108841833B

CN108841833B - DPBF1 recombinant fragment and application thereof

Info

Publication number: CN108841833B
Application number: CN201810602877.6A
Authority: CN
Inventors: 马建忠; 杨容容; 王世伟; 马燕林; 张婷; 王永刚; 冷非凡
Original assignee: Lanzhou University of Technology
Current assignee: Lanzhou University of Technology
Priority date: 2018-06-12
Filing date: 2018-06-12
Publication date: 2021-07-30
Anticipated expiration: 2038-06-12
Also published as: CN108841833A

Abstract

The invention provides a DPBF1 recombinant fragment and application thereof. The method is characterized in that a DPBF1 gene conserved region II (AD1) and a basic leucine zipper region (bZIP) are recombined and constructed on a modified genetic transformation vector pCAMBIA 1301-GUSSE, the ecotype of Arabidopsis thaliana Columbia is genetically transformed, a transgenic Arabidopsis thaliana rDPBF1 is obtained through screening and identification, and a transgenic Arabidopsis thaliana (DPBF1) which overexpresses the complete sequence of a DPBF1 coding region is used as a control. The analysis of transcription level shows that the recombinant gene can be transcriptionally expressed in transgenic Arabidopsis thaliana. Compared with wild plants, the obtained transgenic plant line has the excellent phenotypes of advanced flowering phase, large form size of mature seeds, obvious increase of thousand seed weight and obvious enhancement of drought resistance.

Description

DPBF1 recombinant fragment and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to an arabidopsis DPBF1 recombinant fragment and application thereof.

Background

The plant hormone abscisic acid (ABA) plays a major role in the initiation and maintenance of seed and shoot dormancy in plants, and in plant response to stress, particularly water stress. In addition, ABA affects many aspects of plant growth and development, such as flowering and leaf senescence, through interaction with other phytohormones.

The Arabidopsis transcription factor DPBF1 is a basic leucine zipper type transcription factor responding to ABA signals, and the expression of the transcription factor is induced by ABA and various abiotic stresses. DPBF1 can be combined with cis-element ABRE to further enhance the expression of downstream drought-resistant, saline-alkali resistant, low temperature resistant and other related functional genes and improve the capability of plants to resist abiotic stress. The transcription factor DPBF1 plays a key role in the late embryonic development and ABA signal transduction process and influences the growth and development processes of plant seeds, such as maturation, germination and the like. Recent studies have also shown that arabidopsis thaliana overexpressing the transcription factor DPBF1 gene has an altered flowering phase, exhibiting a delayed flowering trait.

However, the previous suggestions on whether the DPBF1 gene enhances the drought resistance of plants are not consistent, and enhancement or non-enhancement is reported. Because the transcription factor DPBF1 has transcription activation regulatory regions, the mode of the action of the regulatory regions is not clear at present, so that the phenotype of a transgenic plant constructed by the full-length DPBF1 gene is difficult to present or repeat. Based on this, we constructed different mutants of the transcription factor DPBF1, which retain their transcriptional activation region and DNA binding region, and delete transcriptional activation regulatory regions, to understand the role of DPBF1 in plant growth and development. The transgenic arabidopsis thaliana constructed by the DPBF1 mutant gene not only shows repeatable drought resistance, but also shows novel significant traits such as early flowering and seed thousand seed weight increase.

The problems existing in the prior art are as follows:

(1) the function of DPBF1 on drought resistance is not determined, and reports that the DPBF1 recombinant fragment influences the drought resistance of arabidopsis thaliana are not found.

(2) No report that the DPBF1 recombinant fragment influences the flowering period of Arabidopsis is found.

(3) Since the transcriptional regulatory region of the transcription factor DPBF1 is involved in the complex regulatory mechanism of plant growth and development processes, the attempt to elucidate the contradiction that the function of DPBF1 in plants is involved in many processes, complex mechanisms and often leads to conclusions is made.

(4) The prior art does not report that the yield of the DPBF1 is increased.

Disclosure of Invention

In view of the defects of the prior art, the invention provides a DPBF1 recombinant fragment and application thereof, and finally the advancing of flowering phase of an overexpression transgenic arabidopsis plant, the remarkable enhancement of drought resistance and the increase of thousand seed weight of seeds are realized by utilizing a recombinant DPBF1 gene conserved region II (AD1) and a DPBF1 gene alkaline leucine zipper region.

In order to achieve the purpose, the invention adopts the following technical scheme:

a recombinant fragment of DPBF1 protein, wherein the sequence comprises: pMX-1 contains 2 fragments of a conserved region II (AD1, amino acid residues from 59 to 79) and a basic leucine zipper region (bZIP, amino acid residues from 342 to 442) coded by the DPBF1 gene, and the recombinant fragment is constructed on an improved plant genetic transformation vector pCAMBIA 1301-GUSLESS. The length of the nucleotide sequence of the recombinant fragment AD1-bZIP carried by pMX-1 is 372bp, and the nucleotide sequence is shown in a sequence table SEQ ID NO: 1 is shown.

pMX-4 containing the full-length sequence of the coding region of the DPBF1 gene is constructed on the modified plant genetic transformation vector pCAMBIA 1301-GUSLESS. The length of the full-length DPBF1 gene coding region carried by pMX-4 is 1323bp, and the nucleotide sequence is shown in a sequence table SEQ ID NO: 2, respectively.

A method for cloning and recombining a DPBF1 protein recombinant fragment, comprising the following steps:

transformation of pCAMBIA1301 vector

The Multiple Cloning Site (MCS) in the pCAMBIA1301 vector is positioned at the upstream of a plant promoter (35S promoter), and the downstream of the 35S promoter lacks a restriction enzyme cutting site for inserting a target gene. In order to eliminate the influence of the polyclonal site in the original vector on the experimental operation, the polyclonal site in the pCAMBIA1301 vector needs to be removed, and meanwhile, the GUS gene sequence at the downstream of the 35S promoter is replaced by an artificially synthesized Linker containing the polyclonal site.

(1) Removal of multiple cloning sites in pCAMBIA1301 vector

The multiple cloning sites in the pCAMBIA1301 vector were double-digested with restriction enzymes EcoRI and HindIII, and ligated by parallel ligation. The HindIII enzyme was digested with 8.0. mu.L of 10 XM buffer, 12. mu.L of DNA, 4.0. mu.L of Hind III endonuclease, and sterile water to 80.0. mu.L. The reaction mixture was mixed well, centrifuged for about 30sec, and then subjected to enzyme digestion reaction in a 37 ℃ water bath for 2 hours.

And purifying the enzyme digestion product by using a bioengineering PCR product purification kit, wherein the purification method refers to the operation instruction of the PCR product purification kit. The product was purified and then digested with EcoRI, as follows (100. mu.L): 10 μ L of 10 Xquick cut buffer, 40 μ L of DNA, 2.0 μ L of Quickcut EcoRI, and sterile water to make up to 100.0 μ L.

The reaction mixture was mixed well, centrifuged for about 30sec, and reacted at 37 ℃ for 15 min. The enzyme digestion product was purified with a PCR product purification kit. For blunt-end ligation, the purified DNA fragment is subjected to blunt-end treatment, and the blunt-end reaction system is as follows (10. mu.L): HindIII and EcoRI double digested pCAMBIA1301

0.1pmol (> 0.1pmol, 1.7mmol/L dNTP mix 1. mu.l), 0.1% BSA 1. mu.L, 10 XT 4 DNA polymerase buffer 1. mu.L, T4 DNA polymerase 1. mu.L, sterile water to 10. mu.L. The above reaction system was incubated at 37 ℃ for 1h to complete blunting of the sticky ends.

The blunt-ended linear vector is ligated with ligase and then recircularized. The ligation reaction system is as follows: the blunt linear vector (3.5. mu.L), 10 XLigase buffer (1.5. mu.L), T4 DNA Ligase (350U/. mu.L) (1.5. mu.L), and sterile water (15. mu.L). After overnight ligation of the product at 16 ℃ E.coli DH 5. alpha. competent cells were transformed. The transformed product was spread on LB solid medium containing Kan resistance and cultured overnight at 37 ℃. Picking single colony growing on the resistant plate and extracting plasmid, using SacI and SacII double enzyme digestion to identify, and identifying correct plasmid to be named as pCAMBIA 1301-delta MCS.

The multiple cloning site of pCAMBIA1301 is cut by restriction enzymes EcoRI and HindIII and then is subjected to parallel connection to obtain a plasmid pCAMBIA 1301-delta MCS, and the double-enzyme digestion identification of SacI and SacII is carried out on the pCAMBIA 1301-delta MCS. After the pCAMBIA 1301-delta MCS vector is subjected to double enzyme digestion by SacI and SacII, a 11837bp fragment is formed; pCAMBIA1301 was double digested with SacI and SacII to yield two fragments, one of 9185bp in size and the other 2652bp in size (FIG. 1). It is presumed that the multiple cloning site of the pCAMBIA1301 vector has been excised.

(2) Removal of GUS Gene sequence in pCAMBIA 1301-delta MCS vector

The vector pCAMBIA 1301-delta MCS after the primary modification is subjected to double enzyme digestion by NcoI and BstEII respectively to remove GUS gene sequences. The NcoI cleavage system was as follows (100. mu.L): 10 XK buffer solution

10.0. mu.L of pCAMBIA 1301-. DELTA.MCS plasmid 10. mu.L, 10. mu.L of BSA, 6. mu.L of NcoI, sterile water to make up to 100.0. mu.L. The reaction solution was mixed well, centrifuged for 30s, and then digested at 37 ℃ for 2 hours.

The digestion reaction solution was purified and recovered by using a PCR product purification kit, and after the product was recovered, the digestion was performed by using BstEII, wherein the BstEII digestion system was as follows (20. mu.L): 2.0 mu.L of 10 xK buffer solution, less than or equal to 1 mu g of recovered product after the pCAMBIA 1301-delta MCS plasmid is digested by NcoI, 10 mu.L of BSA, 1 mu.L of BstEII and sterile water are added to make up to 20.0 mu.L. And mixing the reaction solution uniformly, reacting at 60 ℃ for 2 hours after centrifugation, and purifying the enzyme digestion product by using a PCR product purification kit.

A pair of perfectly complementary primers was synthesized for the following cleavage sites (NcoI EcoRI SalI KpnI BamHI SacI BstEII):

1301LinkerF：CATGGAATTCGTCGACGGTACCGGATCCGAGCTCG

1301LinkerR:GTCACCGAGCTCGGATCCGGTACCGTCGACGAATTC

primers 1301LinkerF1 and 1301LinkerR were annealed at 60 ℃ for 10min and ligated to the above purified linearized vector overnight at 16 ℃ to transform E.coli DH5 α. The transformants were plated on LB plates resistant to kanamycin (Kan 50. mu.g/ml) and cultured overnight at 37 ℃. Single colonies growing on resistant plates were picked, shaken overnight and plasmids were extracted. The plasmid was sent to Shanghai Producer, LLC for sequencing. The modified pCAMBIA1301 vector plasmid with correct sequencing was named pCAMBIA 1301-GUSLESS.

The pCAMBIA 1301-. DELTA.MCS vector plasmid was digested with NcoI and BstEII to remove the GUS sequence, and the plasmid from which the GUS sequence was removed was subjected to double-restriction enzyme identification. After the control vector pCAMBIA 1301-delta MCS is subjected to enzyme digestion by NcoI and BstEII, enzyme digestion products are a 9736bp large fragment and a 2050bp small fragment; the pCAMBIA1301-GUSLESS vector was digested with SacI and SacII to generate a large fragment of 6700bp and a small fragment of approximately 3018bp (FIG. 2). The enzyme digestion identification result shows that the GUS sequence in the pCAMBIA 1301-GUSSess vector is removed. The map of the pCAMBIA1301-GUSLESS vector is shown in FIG. 3.

Cloning of the conserved region II (AD1), the basic leucine zipper region (bZIP) encoded by the DPBF1 gene and the complete sequence of the DPBF1 gene

(1) PCR amplification of conserved region II (AD1) of DPBF1 gene

According to the sequence of pCAMBIA1301-GUSLESS plasmid and the sequence of DPBF1 gene recorded in NCBI database, a specific primer AD1F is designed: CGGAATTCGGCAAGAACTTTGGGTCCAT, and AD 1R: GGGGTACC CTCCTCTGCGTTCCAAATAG, restriction sites EcoRI, KpnI and a protective base were added to both ends of the primer, and the primers were synthesized by bioengineering (Shanghai) Co., Ltd.

And (3) amplifying a conserved region II of the DPBF1 gene by using a specific primer by using pET32a-DPBF1 as a template. A50. mu.L PCR reaction was as follows: 5.0. mu.L of 10 XPCR buffer (containing Mg2+), 4.0. mu.L of dNTP (2.5mM), 0.3. mu.L of TaKaRa rTaq DNA polymerase (5U/. mu.L), 1.0. mu.L of AD1-F (10. mu.M), 1.0. mu.L of AD1-R (10. mu.M), 1.0. mu.L of template, and sterile water to 50.0. mu.L.

Reaction conditions are as follows: pre-denaturation at 94 ℃ for 2min, then cycle 3 step: denaturation at 94 ℃ for 30sec, annealing at 40 ℃ for 30sec, and extension at 72 ℃ for 5sec, and extension at 72 ℃ for 10min after 30 cycles of reaction; 99min at 4 ℃. After completion of PCR amplification, PCR amplification products of AD1 and DNA DL2000Marker were electrophoresed in 1% agarose gel. Electrophoresis is carried out for 30min at 100V, observation is carried out under an ultraviolet lamp, and the size of an amplification product is preliminarily detected.

(2) PCR amplification of the basic leucine zipper region (bZIP) of DPBF1

Designing a specific primer DBDF according to the sequence of pCAMBIA1301-GUSLESS plasmid and the sequence of DPBF1 gene recorded in NCBI database: GGGGTACCAGGAAAAGAGTAGTGGATGGT and DBDR: TCGAGCTCTTAGAGTGGACAACTCGGGT, the restriction sites KpnI, SacI and the protection bases were added to both ends of the primers, and they were synthesized by bioengineering (Shanghai) Co., Ltd.

PCR amplification of the basic leucine zipper region (bZIP) of the DPBF1 gene was performed using pET32a-DPBF1 as a template. A50. mu.L PCR reaction was as follows: 5.0. mu.L of 10 XPCR buffer (containing Mg2+), 4.0. mu.L of dNTP (2.5mM), 0.5. mu.L of template, 0.3. mu.L of TaKaRa rTaq DNA polymerase (5U/. mu.L), 1.0. mu.L of DBD-F (10. mu.M), 1.0. mu.L of DBD-R (10. mu.M), and sterile water to 50.0. mu.L.

Reaction conditions are as follows: pre-denaturation at 94 ℃ for 2min, then cycle 3 step: denaturation at 94 ℃ for 30sec, annealing at 56 ℃ for 30sec, and elongation at 72 ℃ for 16sec, and after 30 cycles of reaction, elongation at 72 ℃ for 10 min; 99min at 4 ℃. After the PCR amplification is completed, the PCR amplification product and DNA DL2000Marker are electrophoresed in 1% agarose gel. Electrophoresis is carried out for 30min at 100V, observation is carried out under an ultraviolet lamp, and the size of an amplification product is preliminarily detected.

(3) Amplification of the entire coding region of the DPBF1 Gene

Designing a specific primer DPBF1F according to the sequence of pCAMBIA1301-GUSLESS plasmid and the sequence of DPBF1 gene recorded in NCBI database: 5' -CCGGAATTCACTAGAGAAACGAAGTTGACGT-3 and DPBF 1R: TCGAGCTCTTAGAGTGGACAACTCGGGT, restriction sites EcoRI/SacI and protective bases were added to both ends of the primers, and they were synthesized by bioengineering (Shanghai) Co., Ltd.

PCR amplification of the complete coding region of the DPBF1 gene was performed using pET32a-DPBF1 as a template. A50. mu.L PCR reaction was as follows: 5.0. mu.L of 10 XPCR buffer (containing Mg2+), 4.0. mu.L of dNTP (2.5mM), 0.5. mu.L of template, 0.3. mu.L of rTaq DNA polymerase (5U/. mu.L), 1.0. mu.L of DPBF1-F (10. mu.M), 1.0. mu.L of DPBF1-R (10. mu.M), and sterile water to 50.0. mu.L.

Reaction conditions are as follows: pre-denaturation at 94 ℃ for 2min, then cycle 3 step: denaturation at 94 ℃ for 30sec, annealing at 56 ℃ for 30sec, extension at 72 ℃ for 1min for 18sec, and extension at 72 ℃ for 10min after 30 cycles of reaction; 99min at 4 ℃. After the PCR amplification is completed, the PCR amplification product and DNA DL2000Marker are electrophoresed in 1% agarose gel. Electrophoresis is carried out for 30min at 100V, observation is carried out under an ultraviolet lamp, and the size of an amplification product is preliminarily detected.

And (3) taking the PCR amplification product of each sequence and DNA DL2000Marker to carry out electrophoresis in 1% agarose gel, carrying out electrophoresis at 100V for 30min, and observing under an ultraviolet lamp. The length of the fragment of AD1 is 63bp, the length of the fragment of bZIP is 303bp, and the length of the fragment of the full-length coding region of DPBF1 is 1323bp (FIG. 4). The molecular weight of the PCR amplification product is consistent with the expected theoretical value, and the amplified PCR product is preliminarily judged to be the required target fragment.

3. Construction of plant genetic transformation vector pMX-1

Carrying out EcoRI/KpnI double enzyme digestion on the PCR purified product of AD1 and the pCAMBIA 1301-GUSSSS vector, and carrying out gel recovery on a corresponding electrophoresis band according to a Shanghai worker gel recovery kit. The amplified product was then ligated into the vector pCAMBIA1301-GUSLESS using T4 DNA ligase. The ligation reaction was as follows (15. mu.L): the gel recovered the digested AD1 fragment 4.5. mu.L, the digested linearized vector pCAMBIA 1301-GUSSless 3.5. mu.L, 10 XLigase buffer 1.5. mu.L, T4 DNA Ligase (350U/. mu.L) 1.5. mu.L, sterile water to make up to 15. mu.L.

The reaction solution was mixed well and ligated overnight at 16 ℃ to transform E.coli DH 5. alpha. into the ligation product. The transformants were plated on LB plates resistant to kanamycin (Kan 50. mu.g/ml) and cultured overnight at 37 ℃. And (3) selecting a single colony growing on the resistant plate, shaking the bacteria overnight, and extracting the plasmid to obtain a first ligation product.

Carrying out KpnI/SacI double enzyme digestion on the PCR purified product of the bZIP and the first ligation product, and carrying out gel recovery on a corresponding electrophoresis strip according to a Shanghai bio-gel recovery kit. The gel recovery of bZIP and first ligation products was ligated overnight at 16 ℃ and the ligation products were transformed into E.coli DH5 α. The transformants were plated on LB plates resistant to kanamycin (Kan 50. mu.g/ml) and cultured overnight at 37 ℃. Single colonies growing on resistant plates were picked, shaken overnight and plasmids were extracted. The extracted recombinant plasmid was named pMX-1. The pMX-1 plasmid is sent to Shanghai bioengineering Co., Ltd for sequencing, and the sequencing result is analyzed and compared by DNAMAN software. And (5) storing the plasmid with correct sequencing result.

4. Construction of plant genetic transformation vector pMX-4

Carrying out EcoRI/SacI double enzyme digestion on a PCR purified product of the complete sequence of the coding region of the DPBF1 gene and pCAMBIA1301-GUSLESS plasmid, and carrying out gel recovery on a corresponding electrophoresis band according to a Shanghai bio-gel recovery kit. The entire sequence of DPBF1 and the gel recovery product of pCAMBIA1301-GUSLESS plasmid were ligated at 16 ℃ overnight. The ligation reaction system is shown in the following table: 4.5 mu L of DPBF1 gene fragment recovered from gel, 3.5 mu L of linearized vector pCAMBIA1301-GUSLESS recovered from gel after enzyme digestion, 1.5 mu L of 10 XLigase buffer solution, 1.5 mu L of T4 DNA Ligase (350U/. mu.L), and sterile water for supplementing to 15 mu L.

The ligation product was transformed into E.coli DH5 α. The transformants were plated on LB plates resistant to kanamycin (Kan 50. mu.g/ml) and cultured overnight at 37 ℃. Single colonies growing on resistant plates were picked, shaken overnight and plasmids were extracted. The extracted recombinant plasmid was named pMX-4. The pMX-4 plasmid is sent to Shanghai bioengineering GmbH for sequencing, and the sequencing result is analyzed and compared by DNAMAN software. And (5) storing the plasmid with correct sequencing result.

Transformation of Agrobacterium with pMX-1 and pMX-4 plasmids

Agrobacterium GV3101 was transformed with the plasmids pMX-1 and pMX-4, respectively, and the transformed products were plated on LB solid medium containing gentamicin (40. mu.g/ml), rifampicin (25. mu.g/ml) and kanamycin (50. mu.g/ml) and cultured at 30 ℃ for two days. Single colonies grown on the resistant plates were picked up to 4ml of liquid LB medium containing gentamicin (40. mu.g/ml), rifampicin (25. mu.g/ml) and kanamycin (50. mu.g/ml), incubated at 30 ℃ with slow shaking for 12 hours, and 1. mu.L was taken as a PCR template for colony PCR to identify positive clones. The colony PCR identification positive cloning method comprises the following steps: 10 mu L of sterile water is added into a sterilized 1.5mL EP tube, a white small gun head is used for picking the monoclonal colony to 10 mu L of sterile water and lightly blowing and mixing the colony uniformly, the sterile water is observed to be light milk white, 1 mu L of the colony is taken as a template of PCR reaction, and Taq DNA polymerase is used for PCR identification.

AD1F and DBD R are taken as specific primers, and agrobacterium liquid containing pMX-1 plasmid is taken as a template; and respectively carrying out PCR amplification by using DPBF1F and DBD R as specific primers and using an agrobacterium solution containing pMX-4 plasmid as a template to verify the insertion sequence. The PCR product was detected by electrophoresis in agarose gel. The PCR-identified product fragment length of pMX-1 plasmid in Agrobacterium was 372bp, and the PCR-identified product fragment length of pMX-4 plasmid in Agrobacterium was 1323bp (FIG. 5). The recombinant plasmids pMX-1 and pMX-4 have been transferred into Agrobacterium.

6. Agrobacteria dip-dyeing arabidopsis Columbia ecotype (agrobacterium dip method for transforming arabidopsis)

(1) After the arabidopsis grows to the bolting state, the top end of the main inflorescence of the arabidopsis is cut off, meanwhile, the growing inflorescence of the leaf is prevented from being damaged, so that the generation of the lateral inflorescence is induced, and the soaking dyeing is prepared when the lateral branches extend out for 2-10 cm. Watering the plants needing to be impregnated one day ahead of time based on the condition that more bloomes are not bloomed;

(2) inoculating Agrobacterium containing genetic transformation vector into 5ml LB liquid medium (gentamicin (40. mu.g/ml), rifampicin (25. mu.g/ml) and kanamycin (50. mu.g/ml)), shaking and culturing at 28 deg.C and 200r/min for about 15 hr;

(3) the culture in the above step was cultured in a 1: transferring 50 percent of the total weight of the mixture into 200ml of LB liquid culture medium containing corresponding antibiotics, and carrying out shake culture at the temperature of 28 ℃ and at the speed of 200r/min for about 15 hours until OD600 is 0.8-1.0;

(4) centrifuging at 4000r/min for 15min to collect thallus, re-suspending the thallus with osmotic buffer (1/2MS culture medium + 5% sucrose), and adding Silwett L-77 to make the final concentration 0.03%;

(5) the Agrobacterium suspensions containing the plasmids to be transformed, respectively, were aspirated with a 5ml syringe and dip-stained for each flower of the prepared Arabidopsis plants. Covering the soaked plants (T0 generation plants) with a fresh-keeping bag to keep humidity;

(6) culturing the dipped arabidopsis plant for 12h under dark condition, removing the freshness protection package, normally culturing until the pod is mature, and repeatedly dipping for 2-3 times in the period to improve the transformation efficiency;

(7) after the pod became yellow and before cracking, several pods were harvested into 1.5ml centrifuge tubes according to the label, and Arabidopsis seeds (T1 generation) were collected and stored after being sufficiently dried to screen for transformants.

(8) The transgenic plant obtained by screening the transformed pMX-1 plasmid is named as Arabidopsis thaliana rDPPBF 1, and the transgenic plant obtained by screening the transformed pMX-4 plasmid is named as Arabidopsis thaliana DPBF 1.

7. Screening and identification of transgenic line seeds

Harvested transformed T1 seeds were sterilized and plated on 1/2MS solid medium containing 25. mu.g/ml hygromycin. Vernalizing at 4 deg.C for 2-3 times, and culturing in normal light in plant illumination incubator. Two weeks after growth of green plants (dark green cotyledons, longer roots) may be transgenic positive plants, whereas non-transgenic plants have yellow cotyledons, short roots and do not survive for a long period. The green plants were transplanted in soil, cultured until the seeds were mature, and the seeds were harvested individually (T2 generation seeds). Seeds from T2 generations were screened on MS medium containing hygromycin resistance for additional T3 generations.

Specific primers were designed based on the sequences of the pMX-1 and pMX-4 plasmids to identify the expression of the recombinant gene in transgenic Arabidopsis. RNA of the whole plants of wild type and transgenic Arabidopsis seedlings grown for 7 days on 1/2MS medium was extracted, inverted to cDNA, and expression of the recombinant gene at the transcriptional level was identified by Reverse-Transcript PCR (RT-PCR) using specific primers.

RT F1：cgggggactcttgaccatgga

RT R1：ctgcgcattctcttctttcaactggt

The expression of the recombinant gene in transgenic Arabidopsis thaliana was analyzed by RT-PCR. The RT-PCR electrophoresis result of the transgenic Arabidopsis shows a specific band with corresponding molecular weight, and the wild type of the control group has no band (figure 6). The recombinant gene can be expressed in transgenic arabidopsis thaliana.

An application of a DPBF1 protein recombinant fragment in promoting early flowering of Arabidopsis thaliana.

(1) Selecting the same flowerpot, putting a certain amount of nutrient soil (No. 5 Danish matrix, pH5.5) into each flowerpot, putting the flowerpot filled with the nutrient soil into a flat-bottomed tray, and adding water into the tray to make the soil in the flowerpot in the tray automatically absorb water.

(2) The transgenic arabidopsis thaliana strain and the Columbia wild type seeds are vernalized for two days at 4 ℃, spotted on the soil surface, and cultivated in a greenhouse at 5 points (the temperature is 24 +/-2 ℃, the humidity is 20 percent, the illumination condition is 16h illumination/8 h darkness, and the illumination intensity is 5100 lux). After one week, the seedlings with poor growth conditions are removed, and 5 seedlings with similar growth conditions are kept in each flowerpot.

(3) And (5) continuously culturing in the greenhouse until flowering, and counting the flowering time and growth conditions.

The plants began to bolt at the flowering stage, wild type arabidopsis began to bolt 30 days later, and transgenic arabidopsis rDBPF 1 and DPBF1 began to bolt 25 days later and 27 days later, respectively (FIG. 7). The bolting time of the transgenic arabidopsis rDBPF 1 and DPBF1 is earlier than that of the wild type, and the transgenic arabidopsis rDBPF 1 and DPBF1 show early flowering phenotype.

An application of a DPBF1 protein recombinant fragment in improving thousand seed weight of Arabidopsis seeds.

(1) Selecting the same flowerpot, putting a certain amount of nutrient soil (No. 5 Denmark Denshoku matrix, pH5.5) into each flowerpot, putting the flowerpot filled with the nutrient soil into a flat-bottomed tray, and adding water into the tray to make the soil in the flowerpot in the tray automatically absorb water.

(3) Continuously culturing until the seeds are mature, and selecting the fruit pods with similar shapes and sizes to collect the seeds.

(4) One thousand seeds of the wild type and transgenic lines were taken and weighed. The average was taken in triplicate.

The seeds matured at the later stage of plant growth, and the shape of the seeds of the transgenic line is obviously larger than that of the wild type after water absorption (figure 8). Weighing 1000 mature seeds of each strain: thousand kernel weight of wild type seeds was 18mg, thousand kernel weight of transgenic Arabidopsis rDBPF 1 seeds was 24mg, and thousand kernel weight of transgenic Arabidopsis DPBF1 seeds was 20mg (FIG. 9). Statistical analysis shows that the thousand seed weight of the transgenic line and the wild type seed has extremely obvious difference.

An application of a DPBF1 protein recombinant fragment in improving drought resistance of arabidopsis thaliana.

(1) The same flowerpot is selected, nutrient soil (No. 5 Danish Denmark substrate, pH5.5) with the same weight is put into each flowerpot, the flowerpot filled with the nutrient soil with the same weight is placed in a flat-bottomed tray, and water is added into the tray to enable the nutrient soil in the flowerpot in the tray to automatically absorb water.

(2) The transgenic arabidopsis thaliana strain and the Columbia wild type seeds are vernalized for two days at 4 ℃, dibbled on the soil surface, and cultivated in a greenhouse at 8 points in total (the temperature is 24 +/-2 ℃, the humidity is 20%, the illumination condition is 16h illumination/8 h darkness, and the illumination intensity is 5100 lux). After one week, the seedlings with poor growth conditions are removed, and 8 seedlings with similar growth conditions are kept in each flowerpot.

(3) After further culturing for 2 weeks, watering was stopped and drought stress was applied for 10 days.

(4) Rehydrating after 10 days of drought, and observing and counting survival conditions of seedlings after 1 week.

And (3) stopping watering arabidopsis seedlings of wild type and transgenic lines which grow for three weeks and have consistent culture conditions, rehydrating for 1 week after 10 days of drought, and observing the drought tolerance of the transgenic arabidopsis. The wild type arabidopsis thaliana comprises eight seedlings, wherein leaves of the eight seedlings are completely dehydrated and withered to die, namely the survival rate of the wild type arabidopsis thaliana under drought stress is 0; the survival rate of seedlings of the transgenic line rDBPF 1 was 87.5%, and the survival rate of seedlings of the transgenic line DPBF1 was 100%. Leaves of transgenic lines returned to a healthy, active green color after rehydration and could enter the reproductive phase (fig. 10).

Drawings

FIG. 1 shows the results of enzyme digestion identification electrophoresis of pCAMBIA1301- Δ MCS according to the present invention;

wherein, 1: the pCAMBIA 1301-delta MCS is subjected to enzyme digestion of products by SacI and SacII; 2: the product of the enzyme digestion of pCAMBIA1301 by SacI and SacII; m: DL15000 Marker.

FIG. 2 shows the results of electrophoresis of the enzyme digestion identification of pCAMBIA1301-GUSLESS of the present invention;

wherein, 1: the pCAMBIA 1301-delta MCS is subjected to enzyme digestion of products through NcoI and BstEII; 2: the product of pCAMBIA 1301-GUSSESS is digested by SacI and SacII; m: DL15000 Marker.

FIG. 3 is a physical map of the plant genetic transformation vector pCAMBIA1301-GUSLESS after the modification of the present invention.

FIG. 4 is a photograph of agarose gel electrophoresis of the full-length PCR amplification of AD1, bZIP and DPBF1 in accordance with the present invention;

wherein, 1: PCR amplification product of AD1, the length of the fragment is 63 bp; 2: the PCR amplification product of bZIP has the fragment length of 303 bp; 3: PCR amplification product of complete coding region of DPBF1, fragment length 1323 bp; m: DL2000 molecular weight Marker.

FIG. 5 shows the PCR identification of the recombinant vectors pMX-1 and pMX-4 of the present invention in Agrobacterium;

wherein, 1: PCR identification product of pMX-1, the length of the fragment is 372 bp; 2: PCR identification product of pMX-4, fragment length 1323 bp; 3: negative control was performed using the empty pCAMBIA1301-GUSLESS as a template. M: DL2000 molecular weight Marker.

FIG. 6 shows the RT-PCR identification of transgenic Arabidopsis thaliana of the present invention over-expressed;

wherein, total RNA of a transgenic strain and a wild type strain growing for 7 days on 1/2MS culture medium is extracted, and is inverted into cDNA, and then RT-PCR analysis is carried out by using a specific primer. Wild Type (WT) was used as control and Actin2 was an internal control. The culture conditions are as follows: the temperature is 24 +/-2 ℃, the humidity is 20%, the illumination condition is 16 hours of illumination/8 hours of darkness, and the illumination intensity is 5100 lux.

FIG. 7 shows that the transgenic Arabidopsis plants over-expressed according to the present invention flower earlier;

wherein, the bolting condition of the transgenic arabidopsis thaliana plant and the wild type plant after 5 weeks of growth is overexpressed. The culture conditions are as follows: the temperature is 24 +/-2 ℃, the humidity is 20%, the illumination condition is 16 hours of illumination/8 hours of darkness, and the illumination intensity is 5100 lux.

FIG. 8 is the seed size of a transgenic Arabidopsis plant of the present invention overexpressed;

wherein, the sizes of mature seeds of the wild type and the transgenic line are compared after soaking in water for one day;

FIG. 9 shows thousand kernel weight of a transgenic Arabidopsis plant of the present invention overexpressed;

wherein the weight of each 1000 seeds of the wild type and transgenic lines. Students' tstest examined the differences between wild-type and transgenic lines, indicating P < 0.01 (the difference was extremely significant).

FIG. 10 is an enhancement of drought resistance of overexpressing transgenic plants of the invention;

wherein, the growth conditions of arabidopsis seedlings before and after drought stress treatment. After the wild type and the overexpression transgenic arabidopsis plants grow for three weeks under the same culture condition, watering is stopped, drought treatment is carried out for 10 days, and the plants grow and survive after 1 week of rehydration. Each pot had a total of 8 seedlings.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention are described in detail below with reference to the accompanying drawings. Examples of these preferred embodiments are illustrated in the accompanying drawings. The embodiments of the invention shown in the drawings and described in accordance with the drawings are exemplary only, and the invention is not limited to these embodiments.

It should be noted that, in order to avoid obscuring the technical solution of the present invention with unnecessary details, only the structures and/or processing steps closely related to the solution according to the present invention are shown in the drawings, and other details that are not relevant are omitted.

Example 1

The embodiment provides a DPBF1 protein recombinant fragment, the sequence of which comprises: pMX-1 contains 2 fragments of a conserved region II (AD1, amino acid residues from 59 to 79) and a basic leucine zipper region (bZIP, amino acid residues from 342 to 442) coded by the DPBF1 gene, and the recombinant fragment is constructed on an improved plant genetic transformation vector pCAMBIA 1301-GUSLESS. The length of the nucleotide sequence of the recombinant fragment AD1-bZIP carried by pMX-1 is 372bp, and the nucleotide sequence is shown in a sequence table SEQ ID NO: 1 is shown.

Example 2

The embodiment provides a method for cloning and recombining a DPBF1 protein recombination fragment, which comprises the following steps:

transformation of pCAMBIA1301 vector

(1) Removal of multiple cloning sites in pCAMBIA1301 vector

(2) Removal of GUS Gene sequence in pCAMBIA 1301-delta MCS vector

1301LinkerF：CATGGAATTCGTCGACGGTACCGGATCCGAGCTCG

1301LinkerR:GTCACCGAGCTCGGATCCGGTACCGTCGACGAATTC

(1) PCR amplification of conserved region II (AD1) of DPBF1 gene

(2) PCR amplification of the basic leucine zipper region (bZIP) of DPBF1

(3) Amplification of the entire coding region of the DPBF1 Gene

3. Construction of plant genetic transformation vector pMX-1

And carrying out KpnI/SacI double enzyme digestion on the PCR purified product of the bZIP and the first ligation product at the same time, and carrying out gel recovery on a corresponding electrophoresis strip according to the Shanghai bio-gel recovery kit. The gel recovery of bZIP and first ligation products was ligated overnight at 16 ℃ and the ligation products were transformed into E.coli DH5 α. The transformants were plated on LB plates resistant to kanamycin (Kan 50. mu.g/ml) and cultured overnight at 37 ℃. Single colonies growing on resistant plates were picked, shaken overnight and plasmids were extracted. The extracted recombinant plasmid was named pMX-1. The pMX-1 plasmid is sent to Shanghai bioengineering Co., Ltd for sequencing, and the sequencing result is analyzed and compared by DNAMAN software. And (5) storing the plasmid with correct sequencing result.

4. Construction of plant genetic transformation vector pMX-4

Transformation of Agrobacterium with pMX-1 and pMX-4 plasmids

6. The method comprises the following steps of infecting arabidopsis wild type with agrobacterium (transforming arabidopsis by agrobacterium floral dip method) by using agrobacterium:

7. Screening and identification of seeds

RT F1：cgggggactcttgaccatgga

RT R1：ctgcgcattctcttctttcaactggt

Example 3

The embodiment provides application of the DPBF1 protein recombinant fragment in promoting early flowering of Arabidopsis.

Example 4

The embodiment provides application of the DPBF1 protein recombinant fragment in improving thousand seed weight of Arabidopsis seeds.

Example 5

The embodiment provides application of a DPBF1 protein recombinant fragment in improving drought resistance of arabidopsis thaliana.

Has the advantages that:

(1) the drought resistance of transgenic plants which overexpress the complete sequence and the recombinant fragment of the coding region of the DPBF1 is verified for the first time.

(2) The transgenic plant over-expressing the recombinant fragment has advanced flowering phase, shortened plant growth period and capacity of being used in breeding early maturing variety in agricultural production.

(3) Compared with the complete sequence of the DPBF1 coding region, the recombinant fragment has shorter sequence.

(4) The recombinant fragment of the DPBF1 coding region is found for the first time to promote the increase of the seed morphology and the thousand seed weight, and the yield can be improved by laterally reacting the recombinant fragment

(5) Compared with the complete sequence of the coding region of DPBF1, the phenotype of the transgenic line of the over-expressed recombinant fragment is more obvious (thousand seed weight and early flowering phase).

The foregoing is directed to embodiments of the present application and it is noted that numerous modifications and adaptations may be made by those skilled in the art without departing from the principles of the present application and are intended to be within the scope of the present application.

<110> university of Rituo-Risk of Lanzhou

<120> DPBF1 recombinant fragment and application thereof

<160> 2

<210> 1

<211> 372

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

ggcaagaactttgggtccatgaacatggacgagtttcttgtctctatttggaacgcagaggagggtaccaggaaaagagtagtggatggtccagtggagaaagtagtggagagaagacagaggaggatgatcaagaaccgcgagtctgctgctagatctagagcaagaaaacaagcatatacagtggaattggaagctgaacttaaccagttgaaagaagagaatgcgcagctaaaacatgcattggcggagttggagaggaagaggaagcaacagtattttgagagtttgaagtcaagggcacaaccgaaattgccgaaatcgaacgggagattgcggacattgatgaggaacccgagttgtccactctaa

<210> 1

<211> 1323

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 2

atggtaactagagaaacgaagttgacgtcagagcgagaagtagagtcgtccatggcgcaagcgagacataatggaggaggtggtggtgagaatcatccgtttacttctttgggaagacaatcctctatctactcattgacccttgacgagttccaacatgctttatgtgagaacggcaagaactttgggtccatgaacatggacgagtttcttgtctctatttggaacgcagaggagaataataacaatcaacaacaagcagcagcagctgcaggttcacattctgttccggctaatcacaatggtttcaacaacaacaataacaatggaggcgagggtggtgttggtgtctttagtggtggttctagaggcaacgaagatgctaacaataagagagggatagcgaacgagtctagtcttcctcgacaaggctctttgacacttccagctccgctttgtaggaagactgttgatgaggtttggtctgagatacatagaggtggtggtagcggtaatggaggagacagcaatggacgtagtagtagtagtaatggacagaacaatgctcagaacggcggtgagactgcggctagacaaccgacttttggagagatgacacttgaggatttcttggtgaaggctggtgtggttagagaacatcccactaatcctaaacctaatccaaacccgaaccaaaaccaaaacccgtctagtgtaatacccgcagctgcacagcaacagctttatggtgtgtttcaaggaaccggtgatccttcattcccgggtcaagctatgggtgtgggtgacccatcaggttatgctaaaaggacaggaggaggagggtatcagcaggcgccaccagttcaggcaggtgtttgctatggaggtggcgttgggtttggagcgggtggacagcaaatgggaatggttggaccgttaagcccggtgtcttcagatggattaggacatggacaagtggataacataggaggtcagtatggagtagatatgggagggctaaggggaaggaaaagagtagtggatggtccagtggagaaagtagtggagagaagacagaggaggatgatcaagaaccgcgagtctgctgctagatctagagcaagaaaacaagcatatacagtggaattggaagctgaacttaaccagttgaaagaagagaatgcgcagctaaaacatgcattggcggagttggagaggaagaggaagcaacagtattttgagagtttgaagtcaagggcacaaccgaaattgccgaaatcgaacgggagattgcggacattgatgaggaacccgagttgtccactctaa

Claims

1. As shown in SEQ ID NO: 1 in the application of the DPBF1 recombinant fragment in promoting early flowering of arabidopsis thaliana.

2. As shown in SEQ ID NO: 1 in the application of the DPBF1 recombinant fragment in improving thousand seed weight of Arabidopsis seeds.

3. As shown in a sequence table SEQ ID NO: 1 in improving drought resistance of arabidopsis thaliana.