CN1088260A - Be used to detect the oligonucleotide probe and the primer of chromosome translocation - Google Patents

Abstract

For on the fragment at the leap juncture that in the cell that experiences chromosome translocation, hybridizes to nucleic acid molecule and the molecule that designs on the duplicate product of its amplification.

Description

Be used to detect the oligonucleotide probe and the primer of chromosome translocation

The present invention relates to by using the detection of the nucleic acid that nucleic acid probe carries out.

By using specific nucleic acid (RNA or DNA) probe, can detect nucleic acid molecule and other morbid state of obvious infection.The feature of some genetic diseases is to have the gene that should not have in healthy tissues.The feature of other pathological state is to be expressed in the RNAs or the RNA translational product (being peptide or albumen) of not expressing in the normal cell.The feature of some morbid state is to lack some gene or gene partly, perhaps lacks or alternately expressing gene product or albumen.

A kind of cell of particularly important is the normal cell that becomes distortion cell (may be cancer) that is caused by chromosome translocation.Therefore wish to detect cell with chromosome translocation.Standard karyotype technology can be differentiated the cell that chromosome translocation has taken place.Yet, finish to identify it is favourable by the method for in situ hybridization, because this can make a large amount of cells be analyzed faster by flow cytometry.This hybridization technique need be exclusively used in the probe that has only the nucleic acid that just exists when cell produces transposition, protect and increase primer or primer sets.In fact, the nucleic acid technology has been used to detect the nucleic acid (people such as M.J.Embleton who is produced by chromosome translocation; Above-mentioned quoting as proof; People such as Fritsch, U.S.P.4725536; People U.S.P.4681840 such as Stephenson).

When probe target is DNA, the normally double-stranded target of this target: " antisense " chain, by this chain RNA(such as mRNA) transcribed, another " sense strand ", it is a complementary to antisense strand in base sequence.So just can suppose, for the cell DNA target of giving determined number, adopt to comprise the multiplicable signal that produces by the target bonding probes at the sense strand of target and two probes of antisense strand.

Yet in general, if not only containing with a chain complementary molecule of target, probe populations contains another chain complementary molecule with target, the trend that then exists hybridization efficiency (being added to the resulting target bonding probes of every μ g probe amount in the test system) to reduce.Making great efforts in reaching in the saturated process of target in the short period of time as far as possible, a feasible especially approach is to increase total concentration and probe concentration, and it obviously mainly is owing to there is the tendency of probe molecule phase mutual cross that this efficient reduces, and therefore produces high molecular weight aggregates.In the present invention, carried out suitable measurement, the result has at the sense strand probe and during at the antisense strand probe, hybridization efficiency reduces hardly or not when probe populations.

Be applicable to that design also is applicable to the design only probe molecule or the primer molecule of the RNA in being present in the cell that chromosome translocation takes place or dna molecule hybridize to some principles of the probe populations of double-stranded target hybridization.This class probe has utilized the superiority of the new base sequence that exists owing to generation transposition juncture, and at this junction point, two normal dyeing body fragments have been connected to form translocation chromosome.

On the one hand, the present invention relates to hybridize specially nucleic acid probe or primer in RNA or DNA, this RNA or DNA cross over the nucleic acid transposition juncture in the cell that chromosome translocation has taken place.

Another aspect of the present invention forms a kind of nucleic acid probe colony, can hybridize another chain in this target although make some probe molecule can hybridize in a chain of double-stranded target and other probe molecule, and probe molecule can the phase mutual cross.Best is that a series of probes that can hybridize with end to end system on each chain of this target are arranged.Size by the restriction probe molecule and the length that limits between any two probe molecules complementary district are avoided the hybridization certainly of probe populations.

Fig. 1 mark Gen Bank sequence HUMREPA84 Nucleotide 101-400, and show Nucleotide 101 to be positioned at 5 of this sequence ' end and Nucleotide 400 is positioned at 3 ' end.And the Nucleotide in the sequence complementary sequence between the Nucleotide 101-400 is shown in by under those Nucleotide that replenish.This figure has provided the nucleotide sequence of five probes (H18-100L, H18-100R, H18-110R, H18-10 and H18-11).

Fig. 2 is used for graph of a relation between the probe of embodiment 3 for expression.

Fig. 3 a is the micro-photograph with embodiment 4 middle probe HYR-7-25 gained results.

Fig. 3 b is the micro-photograph with embodiment 4 middle probe HYR-7-12 gained results.

Definition

" analyte molecule " detects the molecule of test for design.

The nucleic acid molecule that " amplifier molecule " generates for the use amplification method (as, PCR, 3SR, TAS).Itself or have with all or part of RNA analyte molecule complementary base sequence or have and the identical base sequence of all or part of RNA analyzing molecules.

" probe " is one to contain oligonucleotide and usually also contain the molecule of report thing part, and this report thing can be detected, and this oligonucleotide can be hybridized in a cloning RNA molecule.Report thing part (being also referred to as detectable label) can be radioactive, fluorescence, chemiluminescent, enzyme (as the enzyme of alkaline phosphatase, horseradish peroxidase or other catalysis colorimetric reaction) but or for the part that can be specially reacts with the part characteristic binding molecule (such as streptavidin) that is directly connected to the test section (such as vitamin H or haptens, can with the digoxigenin of antibody response), but should the test section for example be radioactive, fluorescence, chemiluminescent, or enzyme.

If " Watson-Crick " base pairing rules defines two relations between nucleotide sequence: anywhere promptly, one guanine (G) is arranged in a sequence and a cytosine(Cyt) (C) is arranged in another sequence, and anywhere, one VITAMIN B4 (A) is arranged and in another sequence or a thymus pyrimidine (T) is arranged or a uridylic (V) is arranged in a sequence, then first nucleotide sequence and second nucleotide sequence " complementation ".

" hybrid " is (or partially double stranded) molecule of a two strands being formed by two nucleic acid molecule, one of them nucleic acid molecule have with another molecule in sequence complementary nucleotide sequence.

When the chromosome segments of joining because of transposition by two formed a new karyomit(e), these two fragment junction locas were " chromosome translocation juncture ".

" nucleotide sequence " speech is intended to comprise such sequence, wherein has certain non-phosphorus atom (as sulphur) and is in some positions that phosphorus occurs usually between nucleosides.

" juncture cell RNA molecule is crossed in transposition " is for containing the cell RNA molecule (such as hnRNA or mRNA molecule) of two nucleotide sequences, these two sequences be adjacency and be connected this RNA molecule transposition junction point, a nucleotide sequence is transcribed by a part of karyomit(e) of chromosome translocation juncture one side, and second nucleotide sequence transcribed by a part of karyomit(e) of this karyomit(e) juncture opposite side.For example, the cell that adopts transposition to cross over juncture hnRNA molecule is handled and just can produce transposition leap juncture mRNA molecule in cell.

" juncture cell RNA fragment is crossed in transposition " is for containing cell RNA molecule (such as hnRNA or the mRNA molecule) fragment of two nucleotide sequences, these two sequences are adjacent and be connected this RNA molecule transposition junction point, a nucleotide sequence is transcribed by a part of karyomit(e) of chromosome translocation juncture one side, and second nucleotide sequence transcribed by a part of karyomit(e) of this karyomit(e) juncture opposite side.

" juncture cell DNA molecule is crossed in transposition " is for containing the cell DNA molecule of two nucleotide sequences, these two sequences are docked mutually so that the sequence length that forms equals their length sums separately, nucleotide sequence is positioned on the chromosome dyad that its transposition engages this side, and second nucleotide sequence is positioned on the chromosome dyad of this juncture opposite side.

" the zygoneure dna fragmentation is crossed in transposition " is the cell DNA molecule fragment, this fragment has two nucleotide sequences, these two sequences are docked each other so that the sequence length that forms equals their length sums separately, a nucleotide sequence is positioned on the chromosome dyad of its transposition juncture one side, and second nucleotide sequence is positioned on that part of karyomit(e) of this juncture opposite side.

In phrase " juncture nucleus fragment or its amplification duplicate are crossed in transposition ", " amplification duplicate " comprises having the fragment that is equal to (regard U as RNA, regard T as DNA equally) or complementary base sequence with the base sequence of described nucleic acid fragment.

" transposition cross over juncture amplification of nucleotide acid molecule " for contain one with the amplifier nucleic acid molecule of the nucleotide sequence of crossing over juncture nucleus molecule or fragment complementation.

" transposition cross over juncture nucleus molecule " or be " juncture cell RNA molecule is crossed in transposition " or be leap juncture cell DNA molecule ".

" transposition cross over juncture nucleus fragment " or be " juncture cell RNA fragment is crossed in transposition " or be the molecule fragment of " leap juncture cell DNA fragment ".

" primer " be by such as the enzyme of archaeal dna polymerase (as, in polymerase chain reaction, " RCR ") or reversed transcriptive enzyme (as, the 3SR method, people such as Guatelli, Proc.Natl.Acad.Sci.U.S.A., vol87, pp 1874-1878(1990)) be extended to the oligonucleotide of longer molecule.

" transposition cross over juncture primer " is for having the primer with leap juncture RNA fragment complementation or identical nucleotide sequence.

" original position " speech be used for describing the inner process of cell or complete substantially virus that occurs in (as, such as hybridization or the amplification of PCR or 3SR); This cell or virus are usually handled through crosslinked or precipitation fixing agent, and wherein many (rather than all) have name in this article.

" transposition cross over juncture probe " is for having the probe with leap juncture RNA fragment complementation or identical nucleotide sequence.

Be used for " biological entities " herein or be cell, or be virus.

" molecule colony " refers to many molecules.Because probe and primer molecule length can be as small as 20-50 Nucleotide, and its concentration that adds reaction mixture is in the higher scope of 100ng-10 μ g or (as if being necessary then), so this molecular amounts is usually very big.

" molecule homogeneous colony " refers to that each molecule of each molecule and other in colony is identical.

Phrase " molecule that contains a nucleotide sequence; this nucleotide sequence with or for transposition cross over the juncture nucleus segmental or for the nucleotide sequence 20-50 Nucleotide of its amplification duplicate but be not more than the Nucleotide complementation of 20-50 " refer to, those not can be the part of this molecule for leap juncture sequence sequence partly.

Cross over juncture probe or primer design

In the present invention, in cell, one cross over and engage RNA and divide the period of the day from 11 p.m. to 1 a.m when crossing over juncture primer or probe hybridization, just this probe not can with the condition of non-leap joint molecule hybridization under (temperature, time, ionic strength etc.) hybridization has taken place.By the length of this primer of suitable selection or probe, and, can realize this selective cross process according to the following suitable hybridization conditions of rule selection.This rule is:

Concerning any a pair of single chain molecule, if molecule self inside has and this second intramolecularly nucleotide sequence complementary nucleotide sequence, and those two nucleotide sequences all are N Nucleotide long (total length of the two molecule can greater than N), then only when N is longer than certain threshold value, this molecule can form hybrid.This threshold value depends in part on hybridization conditions (temperature, selected solvent etc.) and depends in part on the Nucleotide composition of this complementary sequence.

The base sequence of conversion hybridization conditions and/or this probe molecule, the just threshold value of convertible N.Adopt normal experiment, can determine the threshold value under any hybridization conditions and the target sequence composite state, thereby implement method of the present invention.

The fact that N must surpass an adjacent dividing value has constituted the basis of detecting the nucleotide sequence that comprises binding site.Normocellular nucleic acid should have the dual part of this sequence, but these two portions do not connect.Therefore, if the complementation of the sequence that is not more than N-1 Nucleotide (perhaps preferably being not more than the sequence of N-3 Nucleotide) of this probe and juncture one side and with the sequence that is not more than N-1 Nucleotide (or being preferably the sequence that the is not more than N-3 Nucleotide) complementation of this juncture opposite side, this probe just can not hybridized with normal cell Nucleotide.

Preferably, transposition cross over the probe at juncture or primer have with length be that juncture fragments sequence complementary nucleotide sequence is crossed in the transposition of 20-50 Nucleotide (better length is 20-35 Nucleotide).Preferably, for adopting probe L6-26 as described below and the situation of K28-26, with this probe or primer complementary half cross over juncture fragment should be a side that contains this segmental transposition juncture (mean its second half should at the opposite side at this juncture).

Overlapping probe

Application rule is set up the probe populations that can form hybrid with the two strands of analyte molecule.

Should be taken into account, to arbitrary concerning single chain molecule, if have and the second intramolecular nucleotide sequence complementary nucleotide sequence molecule self inside, and these two nucleotide sequences are N Nucleotide long (the length overall master worker of the two molecule can greater than N), then only when N during greater than a certain threshold value this molecule can form hybrid.This threshold value depends in part on the Nucleotide composition that hybridization conditions (temperature, solvent selection etc.) also depends in part on complementary sequence.

Can find out, below this threshold value in the experiment enumerated of embodiment between 12-23.In these embodiments, be about 24 Nucleotide and do not make arbitrary N surpass 12 that by the length that makes probe molecule just acquisition is used to hybridize to the effective probe populations on the double-stranded target to probe molecule.So this colony is effective, be because it can obtain double in using the such big signal that probe obtained of only hybridizing to strand.

The base sequence of conversion hybridization conditions and/or this probe molecule, the just threshold value of convertible N.This can confirm from the included embodiment of this paper.Yet, adopt the normal experiment of doing according to rule given below, can determine to organize arbitrarily the threshold value under the hybridization conditions, thereby implement method of the present invention.

On the one hand, the present invention is a kind of method that is used to detect the double-strandednucleic acid target, and the step that this method comprises is:

(1) this target chain is fully separated so that its separately with the nucleic acid probe hybridization of complementary nucleotide sequence;

(2) an abundant isolating target chain and a nucleic acid probe colony are cultivated altogether, this nucleic acid probe colony comprises with a target chain and is nucleotide sequence complementary molecule and is nucleotide sequence complementary molecule with another target chain; And

(3) detect the nucleic acid probe molecules of hybridizing with target molecule:

Carry out the residing condition of step (2) should make each target chain be nucleotide sequence complementary nucleic acid probe molecules with this and form hybrid;

Make for the nucleotide sequence of each nucleic acid probe molecules in target, to have whole complementary sequences;

Make each nucleic acid probe molecules and the nucleic acid probe molecules that at least one is other be the part complementation of nucleotide sequence;

Make two nucleic acid probe molecules nucleotide sequence each other that do not have complementary fully;

Make to be the complementary part of nucleotide sequence in the part of a nucleic acid probe molecules and another nucleic acid probe molecules, that a part of length be short under the condition of step (2) can not with other nucleic acid probe molecules hybridization.

" nucleotide sequence " speech is intended to include the sequence that there is the part of some non-phosphorus atom (as sulphur) in some positions that between nucleosides phosphorus occurs usually.Under this situation, with two molecules of nucleotide sequence complementary replaceable be with nucleotide sequences complementary or with the nucleotide sequence complementation.

Usually use detectable label (as radioactivity ³²P, such as the dye molecule of fluorescein, maybe can enter the part of chemiluminescence reaction) come the label probe molecule.

In a total embodiment of present method, two target chains are arranged in or for cell or be the biological entities of virus.This cell or virus can be suspended in the solution but not be fixed on the solid carrier.On the other hand, this cell or virus can be fixed on the solid carrier.This cell or virus can be the portion of tissue section.

The cell that contains target nucleic acid molecule can be eukaryotic cell (as human body cell), prokaryotic cell prokaryocyte (as bacterium), vegetable cell or other cell type.But they can be such as simple eukaryote of zymic or the complicated eukaryote (such as human body) of derivative.

The target chain of nucleic acid can be in naked virus or bag quilt virus (having the no coated film such as the lipid protein film).

In one embodiment of the invention, a plurality of molecules among the probe group or directly or by cross-linker molecules each is covalently bound to a luminescent dye molecule.

In the method, two target chains can be purification of nucleic acid.They may take from virus, cell or multicellular organism.

In the step (2) of this method, two target chains can be fixed on the solid carrier (such as nitrocellulose paper or nylon6 chips).Randomly, this target chain also can be in solution and is not fixed on the solid carrier.

In the method, the target chain can be DNA.The target chain also can be RNA, as promptly being like this to wherein having the situation of the virus (lacking virus as human immunity) of complementary RNA chain in unicellular simultaneously at one.

The viral nucleic acid target can be part virus, in this case should virus can or can be not at cell interior.Randomly, the viral nucleic acid target can not be viral part, but can be at cell interior.

In a preferred embodiment of present method, probe molecule has nucleotide sequence, so that if a chain of this target chain is saturated by probe molecule, does not then contain the not target chain-ordering of hybridization that forms gap between probe molecule.

Preferably, each probe molecule sequence complementation being not more than about 100 Nucleotide with being present in that length at least one other probe molecule is not less than about 12 Nucleotide.

More preferably, each probe molecule is not less than about 12 Nucleotide and a sequence complementation of no more than about 20 Nucleotide with the length that is present at least one other the probe molecule.

In a preferred embodiment, each probe molecule and the sequence complementation that is present in about 12 length of nucleotides at least one other probe molecule.

The length of preferred each probe is between about 15-100 Nucleotide.More preferably, the length of each probe is between about 15-40 Nucleotide.

In this method, preferably be no less than about 12 Nucleotide and be not more than about 100 Nucleotide with another probe molecule complementary probe molecule length partly.More preferably, the length with another probe molecule complementary probe molecule part is no less than about 12 Nucleotide and no more than about 20 Nucleotide.In a highly preferred embodiment of present method, should partly to be about 12 Nucleotide long with another probe molecule complementary probe molecule.

In the specific embodiments of aforesaid method, this two strands target has the first target chain and the second target chain, and wherein in nucleotide sequence with the first target chain complementary probe molecule have structure be different from the second target chain complementary probe molecule on the detectable label of detectable label.For example, be in the nucleotide sequence with the first target chain complementary probe molecule on detectable label can be fluorescence dye, and with the second chain complementary probe molecule on detectable label also can be fluorescence dye.In a special embodiment, its double center chain target is the DNA target, in nucleotide sequence with the first target chain complementary probe molecule also in nucleotide sequence with the RNA complementary element of cell.Show among the effective embodiment of back one particular embodiment, in the target cell of being concerned about, has a double-stranded DNA viral chromosome group (or-the genomic reversed transcriptive enzyme dna replication dna of RNA viruses), and, then has the RNA that maybe may not transcribe from this genome if having such genome really.From clinical viewpoint, not only understand the DNA genome and whether exist and have meaning, and understand whether this genome is expressed as mRNA or genomic other rna replicon also has clinical meaning.If there is not virus mRNA (or other RNA) to exist, then should equal nucleic acid amount by the probe in detecting that acts on the meaning chain by the amount of the nucleic acid of the probe in detecting that acts on antisense strand.If also have a virus mRNA, then surpass nucleic acid amount by the probe in detecting that acts on the DNA antisense strand by the nucleic acid amount of the probe in detecting that acts on DNA meaning chain.This exceeding the quata is because the existence of mRNA is arranged.Really, act on the viral RNA of known quantity and the probe of viral DNA by demarcation, just can learn the fluorescence volume of emitting by the hybridization probe of specified rate, just available this result calculates the viral RNA that is present in the test sample and the amount (total mass) of viral DNA, and also can calculate each test sample the RNA molecular replication number of each cell and the copies of viral DNA then according to the molecular weight of RNA and DNA target.

If continuing, the plan of embodiment 4 and 7 uses respectively 30 chain links with four fluorine, if and on slide glass with cell hybridization, if and cover the two strands of target with enough 30 chain links, then should be able to detect unicellular singly duplicating of hitting, even this target is as short as 750 base pairs, available eyes arrive fluorescence by microscopic examination, or observe with the picture analysis device when target is as short as the 75-150 base pair.

This two strands target can be cell DNA, cell RNA, viral DNA or viral RNA.

The present invention also relates to nucleic acid probe colony at this except that having several different methods, comprise all concrete and embodiment preferred, all is disclosed in the middle of the use of these methods.

Relevant invention is the probe populations that is used for aforesaid method of the present invention.Nucleic acid probe colony herein is an example, wherein

1) each probe molecule length at about 15 Nucleotide between about 100 Nucleotide.

2) incomplete and other probe molecule complementary probe molecule in nucleotide sequence, and

3) each probe molecule is the part complementary with at least 1 other probe molecule in nucleotide sequence.

Use detectable disease of probe and the transposition example of crossing over the juncture

Table A is the explanation that can use the disease type that the present invention detects.But this is not to attempt to limit the disease that can detect with the present invention and the type of transposition.

The nucleotide sequence at the leap juncture of transposition or open, or can be used for openly that the technology of sequence is determined by use.

Table A

The example of known transposition

T (2; 8) (p11; Q24) Burkitt lymphoma (Fujino et al., Jpn. J. Cancer

Res.,vol 77,pp 24-77(1986)

T (11; 14) (q13; Q32) chronic lymphocytic leukemia (Y.Tsujimoto et al.,

NAture,vol 315,pp 340-343(1985)

T (7; 9) (q34; Q34.3) acute T cell lymphoblast leukemia (T.C.Reynolds

et al.,Cell,vol 50,107-117(1987)

T (14; 14) (q11; Q32) T cell chronic lymphocytic leukemia (M.P.Davey et

al.,Proc.Natl.Acad.Sci.USA,vol 85,pp9287-9291(1988)

T (8; 14) (q24; Q32) Burkitt lymphoma (F.G.Haluska et al., Proc.

Natl.Acad.Sci.,USA,vol 84,pp 6835-6839(1987))

T (10; 14) (q24; Q11) T cell acute lymphoblastic leukemia (M.Zutter et

al.,Proc.Natl.Acad.Sci.USA,vol 87,pp 3161-3165(1990)

T (9; 14) (p13; Q32) diffusion large celllymphoma (H.Ohmo et al., Proc.

Natl.Acad.Sci.USA,vol 87,pp 628-632(1990))

T (1; 14) (p33; Q11) leukemia cell (8) (C.G.Begley et al., Proc.

Natl.Acad.Sci.USA,vol 86,pp 2031-2035(1989))

T (X; 18) (p11.2; Q11.2) synovial sarcoma

The chain recessive dyschondroplasia point (punctata) of (X-Y transposition) X (47, XY,

+del(s)(q12,q34),

T (15; 21) (q21; Q22) acute myeloblastic leukemia (AML)

47, XY ,+del (s) (q12, q34) acute nonlymphocytic leukemia (ANLL)

T (8; 14) (q24; Q11) acute lymphoblastic leukemia (T-ALL)

T (8; 14) (q24; Q11) leukemia/lymphoma

Other each ALL of 13 (q11)

(de115q of nearly base) Prader-Willi syndrome

T (1; 15) (p36.2; P11.2) the diffustivity muscle tone goes down

(X; 5) (p11.2; Q35.2) incontinentia pigmenti

(2q13) rhabdosarcoma

T (16; 21) (q11; P11) trisomy 16p

T (1; 19) leukemia precursor B-cell acute lymphoblastic

T (15; 17) acute promyelocyte leukemia (APL)

T (1; 7) (p11; P11) acute myeloid leukemia or myelodysplasia

(8q24 14q32) Burkitt's lymphoma

Bcl-2

t(11;14)(q13;q32) Bcl-1

T (14; 18) (q32; Q21) Hodgkin lymphoma (NHL)

T (8; 14) (q24; Q32) lymphatic nodule histology type

T (3; 22) (q24; Q11) class Burkitt lymphoma

T (11; 14) (q13; Q32) Kuo San large celllymphoma

T (9; 22) (q34; Q11) chronic myelomonocyte leukemia W/ (Ph)

T (4; 6) (p15; P12) chronic myelomonocyte leukemia W/ (Ph)

Inv (3) (q21; Q26) refractory anemia

t(3;3)(q21;q26) RAEB-T

The myelofibrosis (MMM) that inv (3) (q21 q26) follows the marrow alienation to give birth to

The last damage of 3p renal cell carcinoma (RCC)

(3; 21) (q26; Q22) Secondary cases leukemia

T (3; 21) (q26.3; Q22) acute myeloid leukemia

Malignant histiocytosis Childhood of 5q35

t(5;6)(q35;q21)

T (2; 13) (q37; Q14) rhabdosarcoma (RMS)

(Y; 11) (q11.2; Q24) Jacobsen syndrome

T (X; 18) (p11; Q11) two classes and a stage synovial sarcoma

t(X;15;18)(p11;q15;q11) "

t(X;7)(q11-12;q32) "

14q32 (28%) or 14q11 (14%) adulthood T-chronic myeloid leukemia/lymphoma

T (19; 22) (q13.3; P11.2) basic 19q far away

* transposition * neuroepithelioma between karyomit(e) * 11 and 22

The disorder of+der (1q9p) myelosis

Point cut-off is at Xp22 and Xq28 equilibrated X-euchromosome

11q23 adulthood acute myeloid leukemia

The distortion of 13q or trisomy 13 7q and 1q

Trisomy 1 1q

T (8; 14) (q24; Q32) Burkitt type leukemia

t(9;22)(q34;q11) Philadelphia+All(PhL+ALL)

X; The congenital acute lymphoblastic leukemia of 6 q15-16 (ALL)

(8; 21) refractory anemia

46,XY,der(5)t(5;11)(p15.2;p14)[11p15]

Beckwith-Wiedemann syndrome (BWS)

11p15, fus (14p; 21p), and fus (15p; 21p)

Giant cell tumor of bone (GCT)

The 11q13 multiple endocrine adenomas forms 1 type (MEN1)

T (7; 22) (p22; Q13) with (p13q22) acute non-lymphocyte of inv (16)

The property leukemia relevant (M4)

46, XY/46, XY, t (7; 19) (q22; P13.3) acute myelomonocyte leukemia

(FAB M4)

46, XY/46, XY, t (7; 19) (q11; Q13) the ALL Childhood

46,XY,t(3q;11q),t(7q;19p),t(15;17)(q26;q22)

ANLL(FABM3)'2

Probe

Nucleic acid probe can be DNA, RNA, or oligonucleotide or the polynucleotide be made up of DNA or RNA.This DNA or RNA major ingredient can be adenosine, uridine, thymidine, guanine, cytosine(Cyt) or its any natural can artificial chemical derivative.This probe can pass through one or more chemical bonds, is connected on the genetic sequence of complementary or mirror image target cell by the hydrogen bond form usually.

Nucleic acid probe can be detected ground mark before adding hybridization solution.That is to say, can select to be connected to the detectable label on the hybridization product.But probe can be used to implement detection moiety mark of the present invention with any.But this detection moiety can be any material that can detect physics or chemical property that has.This detectable label is in depth studied in field of immunology, and most in general any mark that is used for these methods all can be used for the present invention.Useful especially is the enzymic activity group, for example enzyme is (referring to Clin, Chem., 22: 1243(1976)), enzyme substrates (seeing British Pat.Spec.1548741), coenzyme (seeing U.S.Patents Nos.4230797 and 4238565) and enzyme inhibitor (seeing U.S.Patent No 4134792); Fluorescent agent (seeing Clin.Chem., 25: 353(1979)); Chromophoric group; Luminous agent is chemoluminescence agent and luminescent biological agent (seeing Clin.Chem., 25: 512(1979)) for example; But specific linking ligand; The interaction partners of near-end; And radio isotope as ³H, ³⁵S, ³²P, ¹²⁵I and ¹⁴C.Term " nucleic acid probe " is considered to comprise by any way, comprises the nucleic acid that is labeled in the above described manner.

Biotin labeled Nucleotide can be translated by fracture, and enzymolysis process or chemical process are mixed DNA or RNA.Biotinylated probe uses avidin/chain avidin after hybridization, fluorescence, enzymolysis or colloidal gold engage and to be detected.Nucleic acid can also be used other fluorescent chemicals, but with the fluorescent derivative of immunodetection or with the analogue mark of vitamin H.Nucleic acid also can come mark by means of connecting protein.Also can use to be linked on radioactivity or the fluorescence histone HI, on the enzyme (alkaline phosphatase and peroxidase), or strand is in conjunction with the nucleic acid on (ssB) protein.In order to improve the susceptibility that detects colloidal gold or peroxidase product, can use some reinforcement of adopting silver-colored solution or amplification step.

Also can utilize indirect fluorescence immunoassay cytochemistry step (Rudkin and Stollar(1977) Nature 265: 472; People (1982) Exp.Cell.Res.141 such as Van Prooijen: 397).By increased the ability of the anti-RNA-DNA hybrid of polyclonal antibody to animal injection many (rA)-many (dT).To cell, and hybrid detects by cultivating with the antibody of anti-RNA-DNA hybrid with dna probe in situ hybridization.

The photobiotin of probe ^TMMark is preferable for biotin labeling.

Nucleic acid probe can be used at nucleic acid target various viruses, protokaryon and eucaryon.The target of the probe populations of these inventions is the DNA target normally, and for example gene (as oncogene) is controlled composition (as promotor, repressor, or intensifying factor), chromosomal transposition tie point, or to the sequence of ribosome-RNA(rRNA), transfer RNA (tRNA) or RN enzyme P coding.Randomly, this target can be any nucleic acid target, or RNA or DNA, and it comprises in two complementary target nucleotide sequences one; It is exactly this kind situation in hope with the occasion that characteristic sequence or its complement detect any DNA or mRNA molecule for example.As under the situation of the molecule at the leap juncture of transposition, or under viral RNA sequence and RNA complement thereof the situation about existing in same cell, this target can be RNA.

By each embodiment as can be seen, the probe of any desired sequence all can be made.

When target is the nucleic acid of purifying

The nucleic acid of purifying is considered in this article from cell extraction, or thinks synthetic in the ectopic cell free system.For with probe hybridization to the nucleic acid of this purification, many methods are disclosed.Under normal conditions, if target is a dna molecular, before taking place, its chain is separated hybridization step so by heating or other method.Hybridization can take the good step of formulating to carry out with the target that is fixed on the solid-state carrier (as the DNA nitrocellulose paper, RNA nylon).This probe can be labeled with the method identical with following original position experiment label probe; Or they are carried out mark with other detectable method.For these experiments of experiment, the method for mark is not limit.If a known markers step is applicable to the probe at the purifying nucleic acid target, can expect that then this markers step is applicable to the probe group who beats under the situation of two strands.

At cell, the target in tissue and the fluid

For in liquid suspension, in the cell on slide or other solid-state carrier, in tissue culture cells, and the target in the biological entities in tissue slice can carry out cross experiment.When biological entities was cell, it can take from Solid State Structure (marrow for example, nerve, muscle, heart, skin, lung, kidney, pancreas, spleen, lymphoglandula, testis, uterine cervix, and brain) or be present in lining, conduit and cavity (gi tract for example in various roads, urethra, vas deferens, uterine cavity, uterus pipe, vagina, respiratory tract, nasal cavity, oral cavity, pharynx, larynx, tracheae, segmental bronchus and lung) film in cell or the cell in organism fluid (for example urine, gastric juice, phlegm, blood and lymph liquid) or the ight soil.

When target is in biological entities

Two parts of explanations of great use of possible hybridization conditions are documented in the pct international patent application that publication number is WO90/02173 and WO 90/02204, and the two is the application of Research Development Corp..

In situ hybridization makes can be at individual RNA or the dna sequence dna of detecting in cell.Because target is enough big,, it lacks to 1-5 target molecule/each cell so can detecting in 2-4 hour short like that time.(PCT application 90/02173 and WO90/02204).It also allows to detect simultaneously in the individual cells the different polynucleotide sequence more than 1.It also allows to detect protein and polynucleotide in the same cell.

As mentioned above, have many different hybridization conditions (solvent composition, temperature, time).Following several only be to attempt to advise the hybridization conditions that some is better to the reader.Under any technician in field should know that many other conditions also can be used effectively.

Hybridization step for example can carry out in following solution, this solution contains chaotropic reagent as 50% methane amide, the hybrid stablizer is as the SSC solution of 5 times of concentration (1 *=0.15M sodium-chlor and 0.015M Trisodium Citrate), damping fluid such as 0.1M sodium phosphate (pH7.4), about 100 micrograms (μ g)/milliliter (ml) low-molecular-weight dna connects to reduce non-characteristic, 0.1%Triton X-100 enters cell with the promotion probe, and about 10-20mM vanadyl ribonucleoside title complex.

Except that other add indicate, all percentage number averages of liquid are based on v/v.

Probe populations is added hybridization solution, make with target nucleic acid and hybridize.If final slide glass (or other solid-state carrier) is gone up observation of cell, then will or as single-cell suspension liquid or as the cell deposition of tissue slice on this slide.By selecting a kind of fixing agent to make cell fixation, this fixing agent provides the optimal spatial dissolving and the best hybridization efficiency of cell.After fixing, can dehydrated and at room temperature store, perhaps can carry out hybridization step immediately by the cell of carrier both constrains.

The hybridization solution that contains probe adds with q.s, to cover cell.Then cell is cultivated under suitable temperature.

The used temperature of following embodiment can find out it is in 42-46 ℃ of scope.Preferable temperature condition is disclosed as in 50 °-55 ° scope by PCT application WO 90/02173 and WO 90/02204.But available 15 ℃-80 ℃ temperature range.

Hybridization solution can comprise chaotropic denaturing agent, damping fluid, pore-forming agent, hybrid stablizer, and target characteristic probe molecule.

Chaotropic denaturing agent (Robinson, D.W.and Grant, M.E.(1966) J.Biol.Chem.241:4030; Hamaguchi, K.and Geiduscheck, E.P.(1962) J.Am.Chem.Soc.84:1329) comprise methane amide, urea, thiocyanate-, guanidine, trichloroacetate, trifluoroacetate, tetramethyl-amine, perchlorate, and sodium iodide.The preferred pH that keeps is at least at the damping fluid of 7.0-8.0.

Pore-forming agent can be for example washing agent, as Brij35, and Brij58, sodium lauryl sulphate, CHAPS ^TMTriton X-100.According to the position of target biopolymer, select pore-forming agent to pass through plasma membrane or nuclear membrane, or the branch cell structure of cell enter to promote probe.For example 0.05%Brij 35 or 0.1%Triton X-100 allow probe not allow by plasma membrane to enter by nuclear membrane.Sodium desoxycholate then allows probe to cross nuclear membrane in addition.Therefore, hybridize to tenuigenin biopolymer target, avoid using the nuclear membrane pore-forming agent for restriction.This optionally Subcellular Localization is examined specificity and the susceptibility that helps to strengthen test on the sequence by the restriction probe hybridization to complementary when the target biopolymer is arranged in tenuigenin.Reagent such as fixing agent without washing agent also can play this function.In addition, also can select the biopolymer probe to make its size enough little of crossing the plasma membrane of cell, but big as can not to pass through nuclear membrane.

Hybrid stablizer such as monovalence and divalent cation salt are included in the hybridization solution, with the formation of hydrogen bond between the complementary nucleotide sequence of facilitating probe and the target biopolymer thereof.The preferably sodium-chlor of working concentration 0.15M-1M.For preventing the non-characteristic combination of nucleic acid probe, will add hybridization solution with about 100 times of concentration with the nucleic acid that the target biopolymer has nothing to do to probe.

After above-mentioned each step, remove sample and use phase microscope observation of cell form, relatively analyze with new untreated cell.For making each step optimum, the condition of selecting to determine is with the approaching as far as possible new untreated cell of the space dissolving that keeps cellular form and various subcellular structures.

Before nucleic acid hybridization, can in the salt solution of phosphate buffered, make cell and antibody response.After the hybridization, can the two carries out cell analysis to bonded antibody and bonded hybridization probe.

Sealing biological entities/tissue

Many type solid-state carriers can be used for implementing the present invention.Available support includes but not limited to: glass, Scotch is with (3M) nylon, Gene Screen Plus(New England Nuclear) and soluble cotton.Use microslide the best.The use of these carriers and thereon the step of deposited samples be conspicuous to the those skilled in the art.The method of estimating cell and used quantivative approach are depended in the selection of carrier substance.Some filtering material uneven thickness, thereby pucker ﹠ bloat inequality in the crossover process in position.In addition, some self fluorescigenic carrier will influence and measure low-level fluorescence.The microscope fragmentation is as solid-state carrier the best, and this is because they have high signal-noise ratio, and can be processed so that grasping tissue preferably.

Fixing of biological entities/tissue

Fixing agent can be selected from following thing group: any precipitation agent or linking agent, they are independent or unite use, and can be aqueous or water-free.Fixing agent can be selected from following thing group: formaldehyde solution, alcohol, salts solution, mercury chloride sodium-chlor, sodium sulfate, potassium bichromate, potassiumphosphate, brometo de amonio, calcium chloride, sodium acetate, lithium chloride, cesium acetate, lime acetate or magnesium acetate, saltpetre, potassium bichromate, Sodium chromate, potassiumiodide, sodium iodate, Sulfothiorine, picric acid, acetate, paraformaldehyde, sodium hydroxide, acetone, chloroform, the glycerine thymol, or the like.Fixing agent preferably contains a kind of reagent, it is by precipitating action fixed cell structure, and have following characteristic: effect is a reversible, the form that keeps cell (or virus), the antigenicity that keeps required cell to form, make nucleic acid remain on appropriate location in the cell, nucleic acid is so that they become the mode that can not form two strands or three chain hybrids is modified, and cell form not with stop with nucleic acid hybridization on the residual target sequence the such mode of process and be affected.The selection of fixing agent and fixing step can influence cell to be formed and cellular form, and this influence may be tissue-specific.Being used for fixing agent of the present invention is preferably and is selected from following thing group: ethanol, ethanol-acetate, methyl alcohol, and methyl alcohol-acetone, these fixing agents are given the highest hybridization efficiency and the good cellular form of preserving.

Implementing fixing agent of the present invention comprises: 95% ethanol/5% acetate is used for HL-60 and general medullary cell, 75% ethanol/20% acetate is used for K562 and general peripheral blood cell, 50% methyl alcohol/5% acetone is used for inoblast and general medullary cell, and 10% formaldehyde/90% methyl alcohol is used for cardiac muscular tissue.These fixing agents make cellular form well to preserve, and good keeping quality of antigen and accessibility are provided, and high hybridization efficiency.

Simultaneously, fixing agent can contain cellular component crosslinked together and make its fixed compound, for example glutaraldehyde or formaldehyde.When this linking agent must satisfy above-mentioned whole requirements to precipitation agent, it generally was " glue ", and made cell and membrane component is fastened or seal, thereby kept above-mentioned characteristic.Linking agent is preferably in use less than 10%(v/v).

Linking agent usually reduces hybridization efficiency preserving the Ultrastructural while, and they form and hold back nucleic acid and antigenic net, and make them can not enter probe and antibody.Some is modification of nucleic acids covalently also, prevents that hybrid afterwards from forming.

The storage of biological entities/tissue

After fixing, the microslide that contains cell is at room temperature stored air-dry 3 weeks that reached, and stores 6-12 month in 70% aqueous ethanolic solution of cold (4 ℃), or storage reaches 2 years in paraplasm.If sample is handled under the condition of no RN enzyme, they can dewater in classified alcohol, and at room temperature preserve at least 5 months.

Each reagent can be bought by any a plurality of sources, comprises Aldrich Chemical CO., Milwaukee, Wisconsin, Sigma Chemical Co., St.Loulis, Missouri, Molecular Probes, Inc., Eugene, Oregon, Clontech, Palo Alto, California, Kodak, Rochester, NY, and Spectrum Chemical Manufacturing Corp., Gardenea, California.

Detect the oncogene in peripheral blood cell and the medullary cell

In an exemplary steps, with 10ml people's peripheral blood or 2ml people's medullary cell at 1.2%(215mOs) in the ammonium oxalate solution in 37 ℃ of cultivations, with the dissolving red blood cell.With white cell in clinical centrifuge with 3000rpm centrifugal treating 10 minutes.Amass sheet and this long-pending sheet is resuspended among the PBS with 10ml PBS washed cell subsequently.Through cell centrifugation with cell deposition on the slide glass that cleaned in advance and air-dry 5 minutes.Then at room temperature with cell fixation in 75% ethanol/20% acetate 20 minutes.Use the carcinogenic nature probe to carry out hybridization step then.

The hybridization of Solid State Structure

In a typical step, the frozen section of 4 micron thickness of the human breast tissue that is obtained by surgical excision vivisection sample is fixed on the slide glass that cleaned in advance, and at room temperature uses 50% methyl alcohol/50% acetone fixed 20 minutes.Use the described step in this paper other places to hybridize then.

The in situ hybridization test of one stage

Can be deposited on solid-state carrier such as the slide glass in brief, or with single-cell suspension liquid form or with the cell of tissue slice form.Selectively, cell is placed into about 10 ⁵-10 ⁶The single-cell suspension liquid of cell/ml.By selecting a kind of fixing agent to make cell fixation, this fixing agent has guaranteed space dissolving and the best hybridization efficiency that cell is best.

In the same solution that plays fixed action, hybridize then.This solution not only contains fixing agent but also contain chaotropic reagent such as methane amide.Also comprise hybrid stablizer such as dense lithium chloride or ammonium acetate solution in this solution, damping fluid, low-molecular-weight dna and/or ribosome-RNA(rRNA) (greatly to 50 bases) are used to reduce non-characteristic combination, and pore-forming agent is in order to promote that probe enters cell.Also can comprise for example vanadyl nucleosides title complex of nuclease retarding agent.A kind of probe (or multiple probe) is added hybridization solution, make it and the target multi-nucleotide hybrid.

This stage step is a kind of fixing, prehybridization, and the method for hybridization, and detecting stage is generally with all the in situ hybridization step is relevant in the stage.By regulating the component of being somebody's turn to do " stage " solution, available suitable temperature is carried out hybridization.In addition, this also provides the cross experiment that can finish with cell survival or non-survival in solution.Under the situation of the two, test all is rapidly with sensitivity.

The processing of one stage step sample

No matter cell sample is in suspension or on solid-state carrier, and hybridization step all uses the single crosses solution of going back fixed cell to carry out.Thisly fixedly in same solution, finish with hybridization.Fixing agent can be selected from following thing group: any precipitation agent or linking agent, they are independent or unite use, and can be aqueous or water-free.

The preparation of cell in a stage step

With physics, method chemistry or enzymolysis is torn tissue sample open and is broken into single-cell suspension liquid.With cell with 10 ⁵-10 ⁶The concentration of cell/ml is inserted PBS solution (osmolality that keeps cell with bovine serum albumin (BSA)).Cell fixation in the suspension and afterwards time can be handled, or fixing and handle immediately, or fixing and in situ hybridization of the present invention system, handle.

Single solution is added cell/tissue (hereinafter being called sample).This solution contains: soft fixing agent, chaotropic reagent, nucleic acid probe (RNA of preliminary making or dna probe) and/or antibody probe, salt, washing agent, buffer reagent, and blocker.Can for example in this solution, cultivate 20 minutes under the condition of following embodiment at 55 ℃ and other.

Fixing agent is that being proved specific tested cell type is optimum the sort of fixing agent (for example for marrow and peripheral blood a kind of fixing agent of optimum being arranged, although be somebody's turn to do the cell type that " tissue " contains many uniquenesses).This fixing agent normally precipitates the associating of fixing agent (for example alcohol) and cross linking fixative (for example aldehyde), and the concentration of cross linking fixative remains on very low (less than 10%) simultaneously.This solution often contains 10-40% ethanol and 5% formalin.The concentration of precipitation agent and linking agent and type be according to the strict demand of probe and probe, and required hybridization temperature and changing.General precipitation agent that uses and linking agent illustrate in PCT application WO 90/02173 and WO90/02204.

Hybridization mixture contains denaturing agent, normally about 30%(v/v) methane amide, but other chaotropic reagent such as NaI, urea etc. also can use.In addition, several precipitations and/or cross linking fixative also have weak sex change performance, these performances can or supplementary form or cooperative form and former denaturing agent are used.Hybridization mixture can be configured so that and only preferentially form RNA-RNA or RNA-DNA hybrid.This is to adjust the concentration of salt (being mainly the monovalent cation of I family row metal and the ammonium ion that accompanies) simultaneously by adjusting denaturing agent concentration, and adjusts simultaneously that used hybridization temperature finishes.This with regard to allow with different probes it can optionally be hybridized to or cell RNA or DNA on, or hybridize to RNA and DNA simultaneously on the two.This so probe can be infeeded in the pre-blended solution, this solution has the top condition that produces signal and minimal noise, " fixes " the cell/tissue form simultaneously best.

The present invention can provide with the kit form that is suitable for a stage process.Thereby, another invention is a medicine box that detects nucleic acid molecule in biological entities, this medicine box comprises probe populations as herein described, and one or more reagent, this reagent is used for making said probe populations and the reaction of said biological entities at solution, makes to form hybrid molecule between biological entities middle probe colony's molecule and nucleic acid molecule.And on the other hand, medicine box of the present invention then is such medicine box, promptly biological entities wherein is a cell, and these one or more reagent comprise and are selected from fixing agent and chaotropic reagent (preferably specified fixing agent and the chaotropic reagent of the application).

For example, medicine box can comprise and contains the probe that fixing agent/hybridization mixture and one or more marks are crossed.This solution for example can contain 15-40% ethanol, the 25-40% methane amide, 0-10% formaldehyde, 0.1-1.5M LiCl, 0.05-0.5M triacetate (pH7-8), 0.05%-0.15%Triton X-100,20 μ g/ml-200 μ g/ml not with the non-characteristic nucleic acid of one and a plurality of probe reactions, and 0.1 μ g/ml-10 μ g/ml is directly with the single-stranded probe of report thing molecule marker.More specifically, for example this solution can contain 30% ethanol, 30% methane amide, 5% formaldehyde, 0.8M LiCl, 0.1M triacetate (pH7.4), 0.1%Triton-100, the non-characteristic nucleic acid of 50 μ g/ml, and 2.5 μ g/ml directly report each single-stranded probe that the thing molecule marker is crossed with fluorescence.In addition, the present invention carries out described in situ hybridization reaction and has preferred methods and rules.

In addition, medicine box also can comprise:

1. can detect report system system with second of probe or the reaction of probe target hybrid.

2. treat fully dilution and the dense liquid storage of formation washing soln.

3. implement essential to the invention or useful any mechanical component, such as solid carrier (as microslide), to as described in the device or the auxiliary any cultivation of sample or the equipment of carrying out washing treatment of carrying out of carrier attached cell.

4. invent the photographic film or the latex of the test-results of being carried out in order to minute book.

Embodiment 1

Under the hybridization conditions of present embodiment, confirm 25 base oligopolymer hybridization and 6-12 base oligopolymer is not hybridized

The preparation cell

Use H9 clone in the experiment below.With the washing of the phosphate buffered saline (PBS) (PBS) of nuclease free through cultivating cell and it is placed single cell suspension with the concentration that can produce obvious isolated cells.Cell is rotated sedimentation to be bead and to get rid of supernatant liquor.The cell resuspending was shelved 12-16 hour in the solution of 40% ethanol, 50%PBS and 10% Glacial acetic acid and under 4 ℃.After fixing, rotate this and contain enchylema removal fixing agent and cell is washed once resuspending in 2X SSC again in 1X PBS.This cell should use immediately.

The preparation probe

For positive contrast probe, design and utilize the preservation fragment of eucaryon 28SrRNA; Naming it is 28S-25-AL and the positive probe that is used as experiment described herein.The negative probe that is called NR25-AL is derived from the nitrogen reductase gene that is stored in the bacterium, known its in eukaryotic cell not with nucleic acid hybridization.The dna sequence dna of two kinds of probes of used this is shown in the following table 1.Also prepared by these 25 base oligopolymer deutero-, 12 bases, 10 bases, 8 bases and 6 base oligopolymer with the sequence shown in the following table 1.The all sequences of Zhan Shiing all has the left end of 5 ' end as this sequence in an embodiment.

Table 1

Probe sequence

Name

28S-25-AL ATCAGAGTAGTGGTATTTCACCGGC

28S-21-AL ATCAGAGTAGTGGTATTTCAC

28S-18-AL ATCAGAGTAGTGGTATTT

28S-15-AL ATCAGAGTAGTGGTA

28S-12-AL ATCAGAGTAGTG

28S-10-AL ATCAGAGTAG

28S-8-AL ATCAGAGT

28S-6-AL ATCAGA

NR 25-AL TACGCTCGATCCAGCTATCAGCCGT

NR 121-AL TACGCTCGATCC

NR 10-AL TACGCTCGAT

NR 8-AL TACGCTCG

NR 6-AL TACGCT

Synthetic and the mark of probe

Synthetic oligodeoxynucleotidecombination (using the 380B type applicating biological system DNA synthesizer of the A.B.I. reagent of recommending), and in the end the stage is connected to ammonia hexyl linker on 5 ' terminal phosphate.Purifying 5 '-ammonia hexyl oligodeoxynucleotide and it is coupled to from the rhodamine of " molecular probe " derivative, again with the Waters HPLC method purifying that adopts baseline 810 chromatography operating gear it.

Hybridization

When hybridization, in the cell that becomes bead, add 50 μ l and contain DNA, the 3%(v/v that 30% methane amide, 5X SSC, 0.16M sodium phosphate buffer agent (pH7.4), 1 μ g/ μ l are sheared) alcohol derivate of Triton X-100(polyoxy alkene ether, see Aldrich Chemical Co.1990-91 catalogue), 5%PEG 4000(polyoxyethylene glycol), 25mM DTT(dithiothreitol (DTT)), the hybridization mixture of 0.4M isothiocyanic acid Guanidinium, 15X Ficoll/PVP, and add probe with the concentration of 2.5 μ g/ml.Hybridization was carried out under 42 ℃ 30 minutes.Above 15X Ficoll/PVP be water with the 500X Ficoll/PVP of 15/500 dilution, and the 5g Ficoll400 type (ficoll of molecular weight 400,000) that contains that 500X Ficoll/PVP is a cumulative volume soluble in water reaches 100ml adds 5g PVP(Polyvinylpyrolidone (PVP)) solution.

Washing

It is essential suitably washing the background that causes for the non-characteristic combination of eliminating by probe behind the hybridization.Cell after the hybridization is placed-15ml taper test tube and be preheated to 42 ℃, contain the washing soln of 0.1X SSC, 0.4M isothiocyanic acid Guanidinium and 0.1%Triton to wherein adding 10ml.Stirring this solution then separated 5 minutes with the 250Xg rotation until making this cell be the single-cell suspension body.Remove supernatant liquor and be preheated to 42 ℃ the washings that contains 0.1X SSC and 0.1% Triton to bead adding 10ml again.Stir this solution until making cell be the single-cell suspension body.With this cell of 250Xg rotation treatment 5 minutes.Get rid of supernatant liquor and with the cell pellet resuspending in the counterstain solution that 0.2ml is made of in 1X PBS 0.0025%Evans Blue.

The using and understanding of flow cytometer

The Profile II made from the Coulter instrument ^TMLast analysis of cells.This instrument 488nm argon laser beam, the FL1 wave filter of 525nm and the counterstain wave filter of 635nm.Concerning each analytical sample, analyze earlier and contain the sample of negative probe and establish the quadrant position and drop on right upper quadrant so that be less than 0.01% cell.The sample that has positive probe with the identical parameter analysis of the sample next one that contains negative probe with analysis.Because correct and these two samples of equivalent processes are established in the quadrant position, any number of the cell that then writes down in right upper quadrant (greater than 0.01%) is designated as the positive.

Sequence of steps

With pack into two test tubes and carry out foregoing fixedly processing of about 500,000 H9 cell five equilibriums.Contain the hybridization solution of positive probe (28S) and add the hybridization solution that contains negative probe (NR) to another sample to one of them aliquots containig adding, probe size is corresponding to the size of positive probe listed in the previous table 1.After hybridization and washing, carry out the flow cytometry numeration.

The result

Use flow cytometry, obtain following result: when adopting probe 28S-25-AL;＞99% cell is positive, and when adopting the 28S-21-AL probe, the cell of 0.01%-99% is positive; And when adopting other probe,＜0.01% cell is positive.And when measuring average LFL1, the result is as shown in table 2.

Table 2

Signal (average LFLI)

Length N R 28S is folding poor

6 .322 .370 1.1

8 6.4 .441 are negative

10 .422 .3 .70

12 .321 .231 .72

15 .327 .373 1.1

18 .407 .339 .83

21 .281 .616 2.2

25 .3 50.0 168

Embodiment 2

Confirm to prepare the DNA that is used in " overlapping " has improved the line style signal to the 25 base oligopolymer of giving birth to chain intensity.

Cell preparation

Make and have addition chromosome 18(XX+18) cell line growth use tryptic digestion after for the monolayer of joining, make nearly 5,000 cell settlements to clean slide glass with the cell rotational method again.

The probe preparation

The sequence that is used for being listed in the 25 base synthetic oligonucleotide probes of following table 3 and Fig. 1 is obtained from the open sequence of the α kinetochore reiterated DNA sequences that is used on the karyomit(e) 18.

Table 3

Probe sequence

Name

H18-10 ACTCTACACACATGAGTGTGATTCT

H18-11 CTTAACTTGGTGGCAAAACTTCCTC

H18-10-OL CTCAGAACTTATTTGAGATGTGTGT

H18-10-OR ACTCACACTAAGAGAATTGTTCCAC

H18-11-OR CGTTTTGAAGGAGCAGTTTTGAAAC

Synthetic and the mark of probe

Synthetic oligodeoxynucleotidecombination (carrying out) with 380B type applicating biological system DNA synthesizer with the A.B.I. reagent of recommending, and in the end the stage is connected to ammonia hexyl linker on the phosphoric acid salt of 5 ' end.Subsequently with 5 '-ammonia hexyl oligodeoxynucleotide is coupled on the rhodamine dyestuff that comes from Clontech and with the Waters HPLC method that adopts baseline 810 chromatography operating gear and is purified.

Hybridization

Concerning crossover process, adding 20-25 μ l by 30% methane amide, 5X SSC, 0.1M sodium phosphate buffer agent (pH7.4), 100 μ g/ml lower molecular weight sex change salmon sperms or Pacific herring sperm DNA, 5%(v/v to the cell that is deposited on the slide glass) Triton X-100,15X Ficoll/PVP, 0.4M isothiocyanic acid Guanidinium, 10mMDTT and 0.025M EDTA constitute hybridization mixture, and add probe with the concentration of 2.5 μ g/ml.This slide glass was carried out sex change and hybridization in 15 minutes simultaneously in 85 ℃ of following placements in a thermostat container.

Washing

Suitably washing for the non-characteristic of eliminating by probe behind the hybridization is necessary in conjunction with the background that causes.After the hybridization, slide glass is placed a Ke Pulin cylinder and consists of the washings of 0.1X SSC.0.4M isothiocyanic acid Guanidinium and 0.1%TritonX-100 to wherein adding 100ml.Stir this solution and kept this solution 2 minutes.Remove this washings and add second washings that it consists of 0.1X SSC and 0.1% Triton X-100.With solution stirring 5 minutes and pour out.Use 15 μ l to contain then to be dissolved in 50% glycerine 0.1% 1, anti-decolourant of 4-phenylenediamine and 1 μ g/ml Hoechst(33258) sealing solution.

Fluoroscopic examination

Have on the Olympus BH10 microscope of fluorescence ability with Kodak Ektachrome EES-135(PS 800/1600 one) the film photomicrograph, exposure, and advance with 1600ASA.All the time use 20 seconds time shutter, so that whole Photomicrographs of being clapped can directly be compared mutually.

The result

Look and survey this slide as can be seen, the strength of signal that obtains with all probes is about single with sense strand probe or single twice with antisense strand strength of signal that probe obtains.

Embodiment 3

This embodiment shows, as second 25 joint oligopolymer hybridize in DNA when giving birth to chain, 25 base oligopolymer can effectively be hybridized a chain in DNA.Designing probe feasible makes is used for detecting the overlapping 12-13 base of probe of probe and another chain that is designed to detect DNA of the chain of DNA.See Fig. 2, probe structure and the probe mode to its target hybridization has been described.

Cell preparation

This embodiment adopts two clones.

1.HTB31 " C-33A " for taking from the bioptic human body neck of neck cancer cancer derived cell system (J.National Cancer Institute 32:135-148,1964) and not containing the human body papillomavirus, it is as negative comparison.

Substratum: the Eagles MEM that has non-essential amino acid, Sodium.alpha.-ketopropionate, 10% foetal calf serum.

2.CCL1550 " CAski " for containing the human body neck cancerous cell line (Science196:1456-1458,1977) of 400-500 the replica that is incorporated into its genomic HPV16, it is as positive comparison.

Substratum: the RPMI 1640 that has L-glutaminate and 10% foetal calf serum.

Make the cell of two clones contain 5%CO ₂The 100ml culture flask in growth join.Rinsing is once in 1X PBS with it.Add 2ml contains 0.25%Trypsin in 0.02EDTA solution to this cell.Make it be incubated 5 minutes down at 37 ℃, light and slow discharge opeing is with deposition of cells.Add 10ml substratum separately to these cells.Make 5 * 10 then ³Individual cell rotates under 700rpms and placed on the clean glass slide in 7 minutes and shelve to air-dry.Add 20 μ l ethanol/methyl alcohol (3: 1) to these cells.Make it air-dry then.

The probe preparation

The 25 base synthetic oligonucleotide probes of listed called after HPV16-426-436 and HPV16-501-512 are obtained from the open sequence of HPV16 type and can pass through Genetic Sequence Data Bank(GenBank in the subsequent figures 1, and Version 69.0) introducing.

Synthetic and the mark of probe

Synthetic oligodeoxynucleotidecombination (carrying out) with 380B type applicating biological system DNA synthesizer with the A.B.I. reagent of recommending, and in the end the stage is connected in 5 ' terminal phosphate with an ammonia hexyl linker.Then with 5 '-ammonia hexyl oligodeoxynucleotide is coupled to the rhodamine dyestuff that comes from Clontech, and is purified with the Waters HPLC method that adopts baseline 810 chromatography operating gear.

Hybridization

In crossover process, add 20 μ l to this slide glass and consist of 21%PEG, 25% methane amide, 5X SSC, 1mg/ml salmon sperm DNA, 15X Ficoll/PVP, 0.4M isothiocyanic acid Guanidinium, 50mM DTT, 5%Triton X-100,50mM EDTA, 50mM Na ₂PO ₄Hybridization mixture and concentration be the probe of 0.06 μ g/ μ l.Add cover glass and with slide glass heat to 95 ℃ 5 minutes, make it be chilled to 42 ℃ and insulation 25 minutes under this temperature.

Washing

After the hybridization, slide is placed in the Ke Pulin cylinder, and consist of the washings of 0.1X SSC, 0.4M isothiocyanic acid Guanidinium and 1% Triton X100 to wherein adding 100ml.Stir this solution and kept this solution 2 minutes.Remove this washings and add second washings that consists of 0.1X SSC and 0.1% Triton X100.Stir this solution 1 minute and washings inclined and remove, and repeat last washing process 2 times.After the washing, add 8 μ l Antifade/Hoechst counterstains.Cover slide glass with cover glass, under fluorescent microscope, observe again.

Fluoroscopic examination

Have on the Olympus BH10 microscope of fluorescence ability with Kodak Ektachrome EES-135(PS 800/1000) the film photographic Photomicrograph, expose, and advance with 1600ASA.All the time use 20 second time shutter, so that whole Photomicrographs of being clapped can directly compare each other.

With clone C-33A and Caski measure with the probe of the chain of guiding DNA with the intensity difference that leads between two strands (" juxtaposition " probe) gained signal.

Result in the table 4 shows that in hybridization solution, when using 12 oligopolymer of one of sense strand or antisense strand probe, strength of signal is half of employing double-chain probe gained intensity.

Table 4

Cell probe mark # oligopolymer result (intensity)

The meaningful FITC 12 of C-33A-

The meaningful FITC 12 of Caski ++

The anti-meaning FITC 12 of C-33A-

The anti-meaning FITC 12 of Caski ++

Meaningful and the anti-meaning FITC 24 of C-33A-

Meaningful and the anti-meaning FITC 24 of Caski ++ ++

Embodiment 4

Confirmation under used hybridization conditions, 25 base oligopolymer hybridization and 6-12 base oligopolymer is not hybridized.

Cell preparation

Be deposited on the slide glass with feasible nearly 5000 white cells of rotation cell method from normal male people donor.

The probe preparation

Below the sequence that is used for 25 base synthetic oligonucleotide probes of listed called after HYR7 take from the open sequence that is used for α on the Y chromosome-kinetochore reiterated DNA sequences.Also prepared by these 25 base oligopolymer deutero-, 12 bases, 10 bases, 8 bases and 6 base oligopolymer, as shown in following table 5.

Table 5

Probe

The name sequence

HYR-7-25 GAGTCGATTTTATTGCATTAGATTC

HYR-7-15 GAGTCGATTTTATTG

HYR-7-12 GAGTCGATTTTA

HYR-7-10 GAGTCGATTT

HYR-7-8 GAGTCGAT

HYR-7-6 GAGTCG

Synthetic and the mark of probe

Synthetic oligodeoxynucleotidecombination (carrying out) with 380B type applicating biological system DNA synthesizer with the A.B.I reagent of recommending, and in the end the stage is connected in 5 ' terminal phosphate with an ammonia hexyl linker.Then with 5 '-ammonia hexyl oligodeoxynucleotide is coupled to the rhodamine dyestuff that derives from Clontech and is purified by the Waters HPLC method that adopts baseline 810 chromatography operating gear.

Hybridization

In crossover process, add 20-25 μ l and consist of 30% methane amide, 5X SSC, 0.1M sodium phosphate buffer agent (pH7.4), 100 μ g/ml lower molecular weight sex change salmon sperms or Pacific herring sperm DNA, 5%(v/v to being deposited in cell on the slide glass) hybridization mixture of Triton X-100,15XFicoll/PVP, 0.4M isothiocyanic acid Guanidinium, 10mM DTT and 0.025M EDTA and add probe with the concentration of 2.5 μ g/ml.By this slide glass being placed a thermostat container carried out sex change and hybridization in 10 minutes simultaneously in 85 ℃ of insulations.

Washing

Because the non-characteristic combination of probe, be necessary for removing the washing that background suits behind the hybridization.After the hybridization, slide is placed in one to be added with in the Coplin jar of 100ml washing soln, this solution consist of 0.1X SSC and 0.4M isothiocyanic acid Guanidinium and 0.1%Triton X-100.Stirring also kept this solution 2 minutes.Remove this washing soln, add second washing soln of forming by 0.1X SSC and 0.1%Triton X-100 again.Stirred this solution 5 minutes and pour out.Use then 15 μ l contain 0.1% in 50% glycerine 1, anti-stripping agent of 4-phenylenediamine and 1 μ g/ml Hoechst(33258) sealing solution.

Fluoroscopic examination

Having on the Olympus BH10 type microscope of fluorescence ability, using Kodak Ektachrome EES-135(PS800/1600) film carries out photomicrography, and exposure is also pressed processing with 1600ASA.All the time use 20 second time shutter, so that can directly compare between whole Photomicrographs being shot.

The result

The result shows, do not use any other probe HYR-7-12 with HYR-7-15 and HYR-7-25 probe, HYR-7-10, and HYR7-8, and find to have detectable hybridization (for example referring to Fig. 3 a and 3b) during HYR-7-6.

Embodiment 5

Under used hybridization conditions, checking 25-base oligopolymer hybridization and 6-12-base oligopolymer is not hybridized

Preparation cell and DNA and southern-blot

Cell strain (GM02504G, Coriell Inst.of Med.Research, Camden NJ) is with the form growth of monolayer and by tryptic digestion.DNA separates (Molecular Cloning substantially with people's such as Maniatis method, T.Maniatis, E.F.Fritsch and J.Sambrook, eds., Cold Spring Harbor Laboratory, NY, 1982), and under the described condition of people such as Maniatis, use restriction enzyme Bam H1 and EcoR1 digestion to complete.The five equilibrium sample of the DNA that per then 10 μ g are digested passes through 1.25% agarose gel electrophoresis by the wide line of rabbet joint of 2mm.Use southern step to be fixed on (described) on the nitrocellulose filter paper through electrophoresis fractionated DNA then referring to people such as Maniatis.

The preparation probe

The sequence of the 25 base synthetic oligonucleotide probes of the following HYR7 of being named as derives from the open sequence of alpha kinetochore reiterated DNA sequences on the Y chromosome.By these 25 base oligopolymer deutero-, 12 bases, 10 bases, 8 bases and 6 base oligopolymer are also as shown in table 6 below and prepare.

Table 6

Probe

The name sequence

HYR-7-25 GAGTCGATTTTATTGCATTAGATTC

HYR-7-12 GAGTCGATTTTA

HYR-7-10 GAGTCGATTT

HYR-7-8 GAGTCGAT

HYR-7-6 GAGTCG

Synthetic and the mark of probe

Above-mentioned oligodeoxynucleotide uses Applied Biosystems DNA Synthesizer Model 380B, and uses the A.B.I. reagent of recommending synthetic, and use baseline 810 chromatography equipments by Waters HPLC method purifying it.

Use Biochemical(BMB then available from Boehringer Mannheim) the end mark medicine box, and use step that BMB recommends 3 ' terminally probe is made end mark with digoxigenin.

Hybridization

Filter paper is cut into the about 10cm * 2cm of size, and in prehybridization solution, cultivated 3 hours in 65 ℃, in containing the hybridization solution of end-labelled oligonucleotide probe, spend the night then in 56 ℃ of cultivations.

Consisting of of hybridization mixture: 30% methane amide, 5X SSC, 0.1M sodium phosphate buffer (pH7.4), low-molecular-weight sex change salmon of 100 μ g/ml or Pacific herring sperm DNA, 5%(v/v) Triton X-100,15X Ficoll/PVP, 0.4M isothiocyanic acid Guanidinium, 10mM DTT, and 0.025M EDTA are with 2.4 μ g/ml(mcg/ml) concentration add probe.

Washing

After the hybridization, with filter paper washing, blocking-up, balance also press the BMB source recording and is reacted with anti-digoxigenin/alkaline phosphatase combination, and floods in matrix that (Iumipos 530, BMB).Then filter paper is exposed to X-ray film, and make film development.

The result

The result shows, uses the HYR-7-25 probe, and need not any other probe HYP-7-12, and HYR-7-10 when HYR-7-8 and HYR-7-6, finds to have detectable hybridization.

Embodiment 6

Use the probe of synthetic oligonucleotide as hybridization target dna double chain

Present embodiment has confirmed oligopolymer is prepared on the two strands of DNA target, and its result can control by flow cytometry.It has confirmed that also hybridization ability to two DNA chains makes people can estimate the amount of DNA and RNA in the individual cells simultaneously.

The preparation cell

In following test, use the H9 cell strain.To be washed by the salt solution (PBS) of cultured cells, and place single-cell suspension liquid with the concentration that causes obvious isolated cell with the nuclease free phosphate buffered.The cell centrifugation sedimentation is discharged for long-pending sheet and with supernatant liquor.This cell is suspended in 40% ethanol again, placed 12-16 hour in 50%PBS and 10% Glacial acetic acid and at 4 ℃.After fixing, centrifugal this cell once and again is suspended among the 2X SSC to remove fixing agent, to wash in 1X PBS then, and this cell should use immediately.

The preparation probe

HIV sequence as probe is passed through GenBank, and duplicate 69.0 receives, and it is prepared into probe by Fig. 2 to the described 30mers of being cut into of HPV sequence.This design causes 15 bases " overlapping " zone.

Probe title GenBank location name fluorescent tag molecule probe, Inc.Cat#

HIV-sense strand HUMHB 102 FITC 1-3

HIV-antisense strand HUMHB 102 rhodamines

Derivative T488

Synthetic and the mark of probe

Above-mentioned sequence is cut into 30 base oligonucleotide, and use the ABI reagent of DNA synthesizer (Applied Biosystem DNA Synthesizer, Model 380B) and recommendation to synthesize the thiophosphate oligonucleotide.Make many sulfurized oligonucleotide be coupled on the fluorescence dye then and by column chromatography and HPLC method purifying.Use 30 base NR oligonucleotide (30mers) as negative contrast probe.

Use Applied Biosystem(ABI) DNA Synthesizer, the ABI reagent of Model 380B and recommendation is made the thiophosphate oligonucleotide that every 30mer has 4 sulphur atoms with probe.The configuration of sulphur atom is as follows: the 1st at 5 extreme ' end of probe, the 2nd between the 7th and the 8th nucleosides (by 5 ' terminal counting), the 3rd between the 22nd and the 23rd nucleosides, and the 4th between the 29th and the 30th nucleosides.Then the sulphur atom of many sulfurized oligonucleotide is coupled to as follows on fluorescence dye iodo-acid amide-fluorescein and (can synthesizes less amount): the anhydrous oligonucleotide of 200 μ g is dissolved in 100 μ l250mM Tris damping fluids (pH7.4), to form the 1st solution by adjusting volume.1mg iodo-acid amide-fluorescein and 100 μ l anhydrous dimethyl formamides (being 100%DMF) are combined into the 2nd solution.Two kinds of solution are mixed and shaken over night.After the cultivation of spending the night, the oligonucleotide that is labeled makes its precipitation with ethanol and 3M sodium acetate.Should be placed on the PD-10 post to remove free dye by thick material then.Collect required level part then.Under vacuum, remove liquid phase again.Use HPLC(high-performance liquid chromatography then) this thick material of purifying.

Hybridization

For carrying out hybridization step.In deposition sheet cell, add 50 μ l hybridization mixtures, it consists of 30% methane amide, 5X SSC, 0.16M sodium phosphate buffer (pH7.4), the DNA that 1 μ g/ μ l shears, 3%(v/v) Triton X-100,5%PEG4000,25mM DTT, 4M isothiocyanic acid Guanidinium, 15X Ficol/PVP, and add probe with the concentration of 2.5 μ g/ml.Hybridize in 42 ℃ and carried out 30 minutes.

Washing

Be to remove behind the hybridization because the non-characteristic of probe is necessary in conjunction with the washing that the background that causes suits.After the hybridization, at 42 ℃ cell being placed in one adds in the 15ml tapered tube of 10ml washing soln, this solution consist of 0.1X SSC, 0.4M isothiocyanic acid metal plate, and 0.1% Triton.Stirring this solution becomes single-cell suspension liquid until cell, then with 250Xg rotation 5 minutes.Remove supernatant liquor and at 42 ℃ of washing solns that in the deposition sheet, add 10ml, this solution consist of 0.1X SSC, 0.1%Triton.Stir this solution and become single-cell suspension liquid until cell.With this cell of the centrifugal rotation of 250Xg 5 minutes.Remove supernatant liquor and the cell deposition sheet is resuspended in the 0.2ml counterstaining solution, this solution is for containing the solution of 0.0025%Evans Blue in 1X PBS.

The using and illustrating of flow cytometry

With the FACSTAR of this cell in Beckon Dickinson system ^TMOn analyze.This instrument uses 5 watts of argon lasers that are coupled on the dyestuff head, for the belt wave filter of FL1 with 525nm, and for the belt wave filter of rhodamine with 584nm.For each analyzed sample, at first analyze the sample that contains negative probe, and the location four-quadrant, feasible cell less than 0.01% falls into right quadrant or bottom right quadrant.Next sample with the HIV probe analysis with the identical parameter of the sample strictness of negative probe analysis under analyze.Owing to correctly be provided with and resemble the position, and two samples coverlet reason of staying alone, so any cell count (about 0.01%) that is recorded in for two strands and/or mRNA in the right quadrant is all counted the positive.And only for DNA, any cell count (more than 0.01%) that is recorded in the bottom right quadrant is counted the positive.

Constitute histogram, making FL-3 is Y-axis, and FL-1 is an X-axis.

Embodiment 7

The alternative program of hybridization

Embodiment 4 or 6 program can continue one or multinomial following change:

1) hybridization mixture additionally contains 10%DMSO(v/v) and 5%(v/v) vitamin-E;

2) not that 50 μ l hybridization mixtures are added deposition sheet cell, but 45 μ l hybridization mixtures are added 2.5 μ l squalanes and 2.5 μ l pyrrolidone (Pyrrolidinone), and gained 50 μ l are added long-pending sheet cell; And

3) for the flow cytometry analysis, with 10%(v/v) the pure solution that wherein is suspended with cell that adds of dodecyl,

4) with 5 μ l 1M(1 moles) DTT and 5 μ l Proteinase K (1mg/ml) solution add 100 μ l hybridization mixtures, and for example carried out hybridization 5 minutes at 42 ℃, and carried out 5 minutes at 95 ℃ then, carried out 2 minutes at 42 ℃ again, and

5) 0.05% or 0.10% aurin tricarboxylic acid is added in the hybridization mixture.

Embodiment 8

An example crossing over the probe at juncture is the probe that is known as L6-40 at this, and it has a base sequence (get 5 ' to 3 ' direction, left-to-right):

TACTGGCCGCTGAAGGGCTTCTTCCTTATTGATGGTCAGC

The L6-40 probe of a shortening is the L6-26 probe, and the base sequence that it has is

CGCTGAAGGGCTTCTTCCTTATTGAT

Another example of crossing over the probe at juncture is the K28-40 probe, and the base sequence that it has is

TACTGGCCGCTGAAGGGCTTTTGAACTCTGCTTAAATCCA

The K28-40 probe of a shortening is the K28-26 probe, and it has following base sequence:

CGCTGAAGGGCTTTTGAACTCTGCTT

The L6-26 of fluorochrome label and K28-26 probe, use Applied Biosystems, the A.B.I. reagent that Inc.DNA Synthesizer Model 380 B(use to recommend), and in the end the stage is connected to an ammonia hexyl linker on 5 ' phosphoric acid salt and is made.With 5 '-ammonia hexyl oligodeoxynucleotide purifying, and be coupled on the fluorescein derivative (fluorescein isothiocyanate) by molecular probe, and use baseline 810 chromatography equipments by Waters HPLC method purifying it.Gained be the colony of the probe molecule of a basic homogeneous.The quantity of making surpasses 10ng.

This L6-26, L6-40, K28-26, and the K28-40 probe will hybridize on the mRNA molecule by K-562 cell (ATCC No.CCL243), this molecule is obtained on one's body by the chronic lymphocytic leukemia patient.

Claims (30)

1, a kind of molecule, it comprises and or the nucleus fragment at the leap juncture of transposition or the nucleotide sequence complementary nucleotide sequence of the duplicate of its amplification.

2, the homogeneous colony of the described molecule of claim 1.

3, the described molecule of claim 1, it comprise with or the nucleus fragment at the leap juncture of transposition or the nucleotide sequence of the duplicate of its amplification 20 to 50 Nucleotide, but be not more than 20 to 50 Nucleotide complementary nucleotide sequences.

4, the homogeneous colony of the described molecule of claim 3.

5, the described molecule of claim 3, it comprise with or the nucleus fragment at the leap juncture of transposition or the nucleotide sequence of the duplicate of its amplification 20 to 50 Nucleotide, but be not more than 20 to 50 Nucleotide complementary nucleotide sequences, described 20 to 50 Nucleotide only about half of on a side at described transposition juncture, and second half is on the opposite side at described juncture.

6, the homogeneous colony of the described molecule of claim 5.

7, the described molecule of claim 3, it comprise with or about 26 Nucleotide of the nucleus fragment at the leap juncture of transposition or its amplification duplicate, but be not more than the Nucleotide complementary nucleotide sequence of 26 Nucleotide.

8, the homogeneous colony of the described molecule of claim 7.

9, the described molecule of claim 7, it comprise with or about 26 Nucleotide of the nucleic acid fragment at the leap juncture of transposition or its amplification duplicate, but be not more than the nucleotide sequence complementary nucleotide sequence of 26 Nucleotide, half side of the pact of institute's art 26 Nucleotide at described transposition juncture, and second half is at the opposite side at described juncture.

10, the homogeneous colony of the described molecule of claim 9.

11, the described molecule of claim 1, its nucleotide sequence and or the nucleotide sequence complementation fully of the nucleus fragment at the leap juncture of transposition or its amplification duplicate.

12, the homogeneous colony of the described molecule of claim 11.

13, the described molecule of claim 11, its nucleotide sequence with or nucleotide sequence 20 to 50 Nucleotide of the nucleus fragment at the leap juncture of transposition or its amplification duplicate, but it is complementary fully to be not more than 20 to 50 Nucleotide.

14, the homogeneous colony of the described molecule of claim 13.

15, the described molecule of claim 13, its nucleotide sequence with or the nucleus fragment at the leap juncture of transposition or the nucleotide sequence of the duplicate of its amplification 20 to 50 Nucleotide, but it is complementary fully to be not more than 20 to 50 Nucleotide, described 20 to 50 Nucleotide only about half of on a side at described transposition juncture, and second half is on the opposite side at said juncture.

16, the homogeneous colony of the described molecule of claim 15.

17, the described molecule of claim 13, its nucleotide sequence with or the nucleus fragment at the leap juncture of transposition or about 26 Nucleotide of the duplicate of its amplification, but it is complementary fully to be not more than 26 nucleotide sequences.

18, the homogeneous colony of the described molecule of claim 17.

19, the described molecule of claim 17, its nucleotide sequence with or about 26 Nucleotide of the nucleus fragment at the leap juncture of transposition or its amplification duplicate, but the nucleotide sequence that is not more than 26 Nucleotide is complementary fully, an only about half of side of described 26 Nucleotide at described transposition juncture, and second half is at the opposite side at described juncture.

20, the homogeneous colony of the described molecule of claim 19.

21, the described molecule of claim 1, wherein the nucleus fragment at the leap juncture of transposition is taken from the down cell of one of epidemy type: leukemia, lymphoma, sarcoma, dyschondroplasia, Prader-Willi syndrome, muscle tone go down, incontinentia pigmenti, rhabdosarcoma, trisomy, myelodysplasia, refractoriness anaemia, cancer, malignant histiocytosis, Jacobsen syndrome, neuroepithelioma, myelosis disorder, equilibrated X-euchromosome, Beckwith-Wiedermann syndrome, osteoma, and internal secretion heteroplasia.

22, the described molecule of claim 15, wherein the nucleus fragment at the leap juncture of transposition is taken from the cell of one of epidemy type down: leukemia, lymphoma, sarcoma, dyschondroplasia, Prader-Willi syndrome, intramuscular hypotony, incontinentia pigmenti, rhabdosarcoma, trisomy, myelodysplasia, refractoriness anaemia, cancer, malignant histiocytosis, Jacobsen syndrome, neuroepithelioma, myelosis disorder, equilibrated X-euchromosome, Beckwith-Wiedermann syndrome, osteoma, and internal secretion heteroplasia.

23, the described molecule of claim 19, wherein the nucleus fragment at the leap juncture of transposition is taken from the down cell of one of epidemy type: leukemia, lymphoma, sarcoma, dyschondroplasia, Prader-Willi syndrome, muscle tone go down, incontinentia pigmenti, rhabdosarcoma, trisomy, myelodysplasia, refractoriness anaemia, cancer, malignant histiocytosis, Jacobsen syndrome, neuroepithelioma, myelosis disorder, equilibrated X-euchromosome, Beckwith-Wiedermann syndrome, osteoma and internal secretion heteroplasia.

24, the colony of claim 12, wherein each molecule also comprises the report thing partly.

25, the colony of claim 14, wherein each molecule also comprises the report thing partly.

26, the colony of claim 16, wherein each molecule also comprises the report thing partly.

27, the colony of claim 26, wherein reporting thing partly is the fluorescence part.

28, the colony of claim 18, wherein each molecule also comprises the report thing partly.

29, the colony of claim 20, wherein each molecule also comprises the report thing partly.

30, the molecule of claim 29, wherein reporting thing partly is the fluorescence part.