CN1088261A - Use 3SR TRAP in situ detection nucleic acid - Google Patents

Abstract

Herein disclosed is the method for using the 3SR amplification technique to detect original position RNA molecule, wherein said molecule for example is the molecule that has been subjected to the intracellular leap transposition tie point of chromosome translocation.The improvement aspect that improves this method effect is also disclosed.

Description

Use 3SR TRAP in situ detection nucleic acid

The present invention relates to use nucleic acid probe to detect nucleic acid.

Can use specific dna probe, detect with the hybridization of its middle probe and RNA molecular reaction to be detected and cause cell and the viral RNA that infects other diseases and genetic disorder.A useful especially method is to use such in situ hybridization reaction method, analyzed cell or virus is kept perfectly and hybridization takes place in cell.Yet the copy number of detected RNA is very little usually, even may only have single copy in given cell.The interested RNA molecule of the copy more little detection of number is just difficult more.

A kind of means that solve little copy number problem are to use amplification method.3SR amplification method will increase at the RNA molecule in the acellular nucleic acid population of purifying (D.Y.Kwoh et al., Proc.Natl.Acad.Sci.USA, Vol.86,1173-1177, (1988) have been used.This reaction is to be the distrand DNA molecule with equivalent of the amplification land (being the promotor of polysaccharase) of enzyme and one this analyte molecule with sub-thread analyte RNA molecule Enzymatic transformation.RNA polymerase be attached on the promotor and and then produce one of dna molecular bar chain a plurality of rna transcriptions this.Use these a plurality of rna transcriptions this carries out the amplification of new round as parent material.

Reported use that 3SR comes amplification purification remove major part or whole RNA molecules of other cell materials.So the problem that this report waits to solve is, whether the 3SR amplification can be finished in position effectively, reality is that the 3SR reaction must occur in the complete basically cell, and usually is to handle with linking agent and/or precipitation stationary liquid pair cell for the morphology that keeps cell.The problem that in situ hybridization faced comprises that enzyme will enter in the cell, and enzyme still can be brought into play its function at cell, and avoids the non-specific background source in this RNA colony that is not present in purifying.Though proposed problem (the M.J.Embleton et al. of this class character to the pcr amplification method, Nucleic Acids Research, vol 20, pp3831-3837, (1992)), but because the employed enzyme of pcr amplification method all is different from the 3SR amplification with the target molecule that is detected, the problem that PCR can solve is a degree of predicting that limitedly 3SR succeeds.

In the interested RNA molecule, one type is which results from RNA in the cell that carries out chromosome translocation, and particularly which transcribes the RNA that initial point is in or approaches to be connected by the chromosome segment of two normal separation the juncture that is produced.Existing people use the nucleic acid technology to detect since nucleic acid that chromosome translocation produced (document is the same for M.J.Embleton, et al; Fritsch et al., US Patent 4,725,536; Stephenson et al., US Patent 4,681,840).

In a useful especially embodiment, use the 3SR in situ detection only to come across the cell that carries out chromosome translocation, particularly the RNA molecule in all kinds tumour cell.

In order to improve the overall rate and/or the efficient of original position 3SR reaction, the additional enhancement techniques invention that herein disclosed is and be used in combination with 3SR.An invention like this is to use 3SR probe or the primer special to the transposition engaging zones of analyte RNA molecule.Other schemes of the present invention relate to uses penetrating and signal toughener, uses the background depressant, and the probe that uses improvement.

A part of the present invention relates to the 3SR amplification method of in situ detection RNA molecule.The invention still further relates to and use one or more following inventions: the penetrating toughener that during hybridizing, uses to improve the speed of response and/or the susceptibility of original position 3SR method, strengthen the signal toughener of fluorescent probe signal, background depressant during the fluoroscopic examination of probe, be used to reduce the radical scavenger of background fluorescence, a plurality of reporter groups on each probe, and in order to reduce the reporter group analogue of hybridization background.The present invention has only also used and has crossed over to such an extent that oneself carry out the short probe of the order hybridization at transposition juncture on the RNA molecule in the cell of chromosome translocation.

" analyte RNA molecule " is meant the molecule that designed detection method will detect.

" cloning RNA molecule " is meant the RNA molecule that uses amplification method to produce.It has the nucleotide sequence that is complementary to all or part RNA analyte molecule or has the nucleotide sequence that is equal to all or part of analyte RNA molecule.

" probe " is meant and contains oligonucleotide and also comprise the molecule of reporting composition usually that it is detectable wherein reporting thing, oligonucleotide can with the cloning RNA molecular hybridization.Report thing part can be radioactivity material, fluorescent material, chemoluminescence agent, enzyme (as the enzyme of alkaline phosphatase, horseradish peroxidase or other catalysis color reactions), but or can be directly connected to ligand specificity's binding molecule (as streptavidin) on test section such as radioactivity material, fluorescent material, chemoluminescence agent or the enzyme part of specific reaction take place.

If the relation by two orders of " Watson-Crick " base pairing rules definition: promptly in an order guanine (G) is arranged, in another order cytosine(Cyt) is arranged just, and in an order VITAMIN B4 (A) is arranged, in another order thymus pyrimidine (T) or uridylic (U) are arranged just, think promptly that first nucleotide sequence is complementary to second nucleotide sequence this moment.

" crossbred " is meant bifilar (or part the is bifilar) molecule that is formed by two nucleic acid molecule, and one of them molecule has the nucleotide sequence that is complementary to the order in another molecule.

If two nucleotide sequences are identical, be that DNA sequence and another are when wherein replacing the RNA order two of thymus pyrimidine identical in proper order by uridylic, to think that then first Nucleotide is first nucleotide sequence " equivalent " in proper order perhaps except an order.

When two chromosome segments formed a new karyomit(e) because of transposition is bonded together, then this point that is connected together of two fragments was " chromosome translocation juncture ".

" nucleotide sequence " this term also comprises the order that some phosphorus atom (as sulphur) is in addition arranged on some position that wherein under normal circumstances has phosphorus between nucleosides.

The RNA molecule of juncture " cross over transposition " is meant the RNA molecule (as hnRNA or mRNA molecule) that comprises the nucleotide sequence that the chromosome dyad from the both sides, chromosome translocation juncture transcribes.For example, can in cell, produce the mRNA molecule of crossing over the transposition juncture by the hnRNA molecule at cell processing leap transposition juncture.

The RNA fragment of juncture " cross over transposition " is meant the RNA molecule fragment of the nucleotide sequence that any chromosome dyad that comprises from the both sides, chromosome translocation juncture is transcribed.

" cross over the cloning RNA molecule at transposition juncture " and be meant that its part or all of nucleotide sequence is complementary or be equal to RNA molecule or the segmental cloning RNA molecule of RNA of crossing over the juncture.

" primer " is meant the oligonucleotide that extends into longer molecule in the 3SR method by reverse transcriptase.

" cross over the primer at transposition juncture " and be meant the primer that has complementation or be equal to the nucleotide sequence of the RNA small segment of crossing over the juncture.

" original position " is one and is used for describing the term that betides complete basically cell or interior the process of virus (as hybridizing or 3SR); Cell or virus usually are with many but be not that name crosslinked of all this paper or precipitation fixing agent are handled.

" cross over the probe at transposition juncture "

This paper said " biological entities " is cell or virus.

The 3SR method is a kind of reverse transcriptase that utilizes, dna dependent rna polysaccharase, RN _AseH, Oligonucleolide primers, the triphosphoric acid dezyribonucleoside (5 '-Deoxy-ATP, 5 '-dCTP, 5 '-GTP (guanosine triphosphate) and deoxythymidine; DATP, dCTP, dGTP and dTTP), the triphosphoric acid ribonucleoside (5 '-Triphosaden, 5 '-cytidine, 5 '-GTP (guanosine triphosphate), 5 '-uridine triphosphate; ATP, CTP, GTP, UTP) and suitable reagent such as damping fluid, salt and divalent cation are so that produce the method for a copy more than part or all analyte RNA of analyte RNA molecule at least.A primer will be a part that is complementary to meaningful analyte RNA molecule, and other primers then will be equal to the part of meaningful analyte RNA molecule.At least one of primer have one not complementary or be equal to the part of the part of analyte RNA molecule, but be more preferably one of bifilar promotor of dna dependent rna polysaccharase.

It is because one of primer and analyte RNA molecular hybridization use reverse transcriptase to extend this primer then that this process goes on, thereby forms the cDNA copy of at least a portion analyte RNA molecule.Use RN then _AseH failure analysis thing RNA molecule.Second primer annealing extended primer to form the DNA chain that second is complementary to the cDNA molecule to the cDNA molecule and with reverse transcriptase.Second DNA chain will have the nucleotide sequence of a part that is equal to former analyte RNA molecule.After above-mentioned steps, promptly obtain bifilar template DNA molecule.

The bifilar template DNA molecule that forms through extending two primers continuously will have the promotor of one or two dna dependent rna polysaccharase.If first primer has a chain of such promotor, then when it extends second primer can by reverse transcriptase produce this promotor through two chains.If second primer has a chain of such promotor, then reverse transcriptase further prolongs the cDNA molecule until obtaining complete second and starts subchain when it extends second primer.

Continue this 3SR process with archaeal dna polymerase, can make every chain of cloning RNA molecule be complementary to the chain of template DNA molecule.By means of as the amplification amplifier molecule that used enzyme and primer come self amplification so to form during analyte molecule.

Original position 3SR method

Aspect total, the present invention relates to be used for detection of biological entity (cell and better be eukaryotic cell particularly; Especially people's cell) " the original position 3SR method " of analyte RNA molecule, this method may further comprise the steps:

1) at reverse transcriptase dna dependent rna polysaccharase (better being the prokaryotic organism sources), RN _AseH, first primer that each free oligonucleotide is formed and second primer (also can be reaction soln reagent such as triphosphoric acid dezyribonucleoside and triphosphoric acid ribonucleoside and damping fluid, salt, divalent cation in case of necessity) exist down, the insulation biological entities, thus the amplifier molecule that has complementation or be entirely identical to the nucleotide sequence of nucleotide sequence in the said analyte RNA molecule (amplification step) produced.

2) in said biological entities, form crossbred (" hybridization step ") between probe molecule and the said amplifier molecule, and

3) probe molecule (" detection step ") in the said crossbred of detection,

Wherein first primer comprises the nucleotide sequence of first nucleotide sequence that is complementary to analyte RNA molecule,

Wherein second primer comprises the nucleotide sequence of second nucleotide sequence that is equal to analyte RNA molecule,

In the analyte RNA molecule of wherein said first nucleotide sequence between the 3 ' end that is positioned at said second nucleotide sequence and analyte molecule,

Have a promotor nucleotide sequence that comprises said polysaccharase in wherein said two primers at least, and

Its middle probe comprises that nucleotide sequence is complementary to the oligonucleotide of the nucleotide sequence in one of said amplifier molecule.

Preceding method is particularly suitable for detecting the RNA molecule of crossing over the transposition juncture in the cell that carries out chromosome translocation.If this is based on the nucleotide sequence that analyte molecule contains the nucleotide sequence of the nucleotide sequence that is complementary to first primer and is equal to the nucleotide sequence of second primer, this fact of amplification of analyte molecule then will take place: if promptly select the nucleotide sequence of such two analyte molecules, make one on transposition juncture " 3 ' side ", and another is on " 5 ' side at this juncture ", normal cell does not have the molecule that can be amplified, in normal cell, have the molecule that some has the first analyte molecule nucleotide sequence really, and molecule, but can there be molecule with these two kinds of orders with second analyte molecule nucleotide sequence.Only under the situation that chromosome translocation has taken place, just can there be the molecule that has these two kinds of orders.

When analyte molecule has the transposition juncture, can be by selecting one of them probe (or report thing-probe) so that it nucleotide sequence that comprises is to cross over the order at transposition juncture and quite short, thereby improve the specificity of this method.If back one order is enough short, it will completely stably be hybridized: have only the cell that experiences chromosome translocation can produce the complete with it complementary analyte molecule of probe at leap transposition juncture concerning nucleotide sequence.

Also can use the primer of crossing over the transposition juncture to expand the strategy of using the probe of crossing over the juncture.

In a specified scheme of the present invention, make report thing-probe hybridization to the cloning RNA molecule that produces through step (1) with completing steps (2), each said report physical prospecting pin all comprises detectable report thing group and contains the oligonucleotide of the base sequence of the base sequence that is complementary to said cloning RNA molecule.

Primer is to use as the primer of reverse transcriptase.The promoter region of promotor nucleotide sequence, if present, will be as half of dna dependent rna polymerase promoter, second half then is the DNA that base sequence is complementary to this promoter region.Primer also can have the promoter region as half of dna dependent rna polymerase promoter.

Cross over the probe or the primer design at juncture

In the present invention, when the RNA molecular hybridization at leap juncture in the primer of crossing over the juncture or probe and the cell, hybridization is that probe with under the condition (temperature, time, ionic strength etc.) of the molecular hybridization of non-leap juncture molecule is not finished therein.This selectivity of hybridization is by suitably selecting the length of primer or probe, and suitably selects hybridization conditions to realize by following principle:

For any sub-thread molecule concerning, if one has the nucleotide sequence that is complementary to nucleotide sequence in second molecule in itself sequence, and these two orders all have N Nucleotide long (total length of each molecule can greater than N), and then these molecules will be only could form crossbred at N during greater than some threshold value.This threshold value will partly depend on hybridization conditions (temperature, choice of Solvent etc.), depend on that partly the Nucleotide of complementary order is formed.

Can change the threshold value of N by the base sequence that changes hybridization conditions and/or probe molecule.Can determine the threshold value of any one group of hybridization conditions by normal experiment, thereby and finish method of the present invention.

N must surpass this fact of threshold value and comprise that for detecting the nucleic acid sequence at juncture provides the foundation.Normocellular nucleic acid will have this two portions order, but these two parts can not link together.Therefore, if probe is complementary to the order order of N-3 Nucleotide (or better be no more than) of a no more than N-1 Nucleotide on one side of juncture, and be complementary to the order (or order of better no more than N-3 Nucleotide) of a no more than N-1 Nucleotide on the opposite side of juncture, then it will be not and the normal cell nucleic acid hybridization.

Preferable is that probe or the primer of crossing over the transposition juncture have the nucleotide sequence that the length of being complementary to is the segmental order in leap transposition juncture of 20 to 50 Nucleotide (being more preferably 20 to 35 Nucleotide).Segmental half sequence of crossing over the juncture with probe or primer complementary is preferably at (this just mean second half will the opposite side at this juncture on) on the side at the transposition juncture that contains this fragment.

The enhancing of 3SR in-situ method

In the preferred embodiment of original position 3SR method of the present invention, the present invention also uses the following material of content of the present invention or speed and/or the susceptibility that method is improved the 3SR in-situ method of belonging to: the radical scavenger of the background depressant during the signal toughener of the penetrating toughener in the crossover process, enhancing fluorescent probe signal, the fluoroscopic examination of probe, reduction background fluorescence, a plurality of report thing groups of each probe, and the report group analogue that reduces the hybridization background.To make more detailed description to these enhancement factors respectively below.

The signal toughener of penetrating toughener

In another scheme of 3SR in-situ method, thereby use penetrating toughener to be selected from dimethyl sulfoxide (DMSO) (DMSO), alcohol, aliphatic alkanes, alkene containing, completing steps (2) in the cyclodextrin, the solution of the compound in this group of fatty acid ester, acid amides or lactan and organosilane.

Join this fact of enhancing that can finally observe signal in the detection solution as the compound that will organize, a kind of like this compound of prompting promptly is penetrating toughener forcefully.On these bases, foregoing invention promptly is referred to herein as " penetrating toughener is modified " method.This name can be used to this scheme of the present invention is modified with " hereinafter described " signal toughener " method distinguishes; wherein add and strengthen compound from detect solution, removing cell or virus back, particularly during fluoroscopic examination, exist to strengthen compound as the final step of this detection method.

In the preferred version of the method that penetrating toughener is modified, the detection solution that wherein is used for step (2) comprises nucleic acid probe and DMSO(2-20%) and one or more be selected from alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%), formula R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%), formula (SiR ₅R ₆R ₇) N(SiR ₈R ₉R ₁₀), (SiR ₅R ₆R ₇)-(SiR ₈R ₉R ₁₀), (SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) or (SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀) this group of organosilane (2-20%) in compound, and DMSO and the merging volume that is selected from the compound in this group are no more than the 30%(v/v of detection solution).

The combined aspects of the method for modifying at penetrating toughener, the detection solution that is used for step (2) comprises nucleic acid probe and DMSO(2-20%) and one or more be selected from by alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%), formula R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%), formula (SiR ₅R ₆R ₇) N(SiR ₈R ₉R ₁₀), (SiR ₅R ₆R ₇)-(SiR ₈R ₉R ₁₀), (SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) or (SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) compound in the group that organosilane (2-20%) is formed, DMSO is no more than the 30%(v/v that detects solution with the merging volume that is selected from the compound in this group).

In another version of the method that penetrating toughener is modified, except DMSO, at least also use alkane or (better) alkene that is selected from this group, and another kind of compound.Preferably be selected from the compound of above-mentioned preferred structure.

In a particular of the method that penetrating toughener is modified, detect solution and contain the 10%(v/v that has an appointment) Triton X-100.

In the particularly preferred embodiment of the method that penetrating toughener is modified, the volume that is selected from compound in this group and is DMSO and DMSO accounts for the 2-20%(v/v of detection solution); The volume of DMSO preferably accounts for the 10%(v/v that detects solution).

Compound concentration is preferably enough low, can not be precipitated out from solution making it, and other compounds in the solution also is unlikely and forms precipitation.When adding to 10% or during greater concn, alkane particularly on squalane and the structure similarly or greater than the alkane of squalane, and alcohol particularly on oleyl alcohol and the structure similarly or greater than the alcohol of oleyl alcohol, responsible existing other compositions, and from detect solution, being precipitated out.

Preferred compound comprises squalane, dodecanol, beta-cyclodextrin, Wickenol 111,1, and 2-propylene glycol, hexamethyldisiloxane, and oleyl alcohol, pyrrolidone (Pyr-rolidinone) and squalane.Preferred combination is to use about 10%DMSO to add about 10% pyrrolidone.Another preferably makes up is that about 10%DMSO adds about 5% squalane 5% pyrrolidone of being engaged in.

In another preferred embodiment of the method that the signal toughener is modified, the step of 3SR in-situ method (3) comprises at least three step 3A described as follows, 3B and 3C, must before step 3B, finish 3A for this reason, and before step 3C or similar completing steps 3B simultaneously:

(3A): from detect solution, remove cell,

(3B): add signal in the solution that is suspended with cell and strengthen compound,

(3C): detect the signal photon that directly or indirectly produces by target bonded probe molecule.

Signal strengthens compound and is selected from alcohol, aliphatic alkanes, sugar, fatty acid ester, acid amides or lactan and organosilane.

The photon of partly being launched by the fluorescence of probe molecule is counted as the photon that is directly produced by target bonded probe molecule.The light quantity of launching owing to the chemical bond in the report thing group (as different luminol,3-aminophthalic acid cyclic hydrazide) in the cracking chemiluminescent groups also is considered to directly by the photon of reporting the group emission.Be considered to the quantum that produces indirectly by reporter group as the result of radioactivity report group emission radiant and by the photon that scintillation solution is launched.

Be preferably in and carry out signal detection, promptly during the step (4) the signal toughener is added in the solution (" detection solution ") of suspension cell.

Compound joined to detect and can strengthen final this fact of observed signal in the solution and show that effectively said compound promptly is the signal toughener in should organizing.

In the preferred embodiment of the method that the signal toughener is modified, detection solution comprises one or more and is selected from alcohol (2-20%), aliphatics alkane (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%), formula R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%) and formula R ₅SiOSiR ₅Organosilane (2-20%), wherein DMSO and the merging volume that is selected from the compound in this group are no more than the 30%(v/v of detection solution).

Preferred compound comprises squalane, beta-cyclodextrin, hexamethyldisiloxane and oleyl alcohol, pyrrolidone, squalane, particularly Wickenol 111,1, and 2-propylene glycol and dodecanol.Use these preferred compounds, can make signal that target produces that the ratio increase of background signal is reached about 3 to 4 times.Combination is that about 10%DMSO adds about 10% pyrrolidone preferably.Another makes up preferably is that about 10%DMSO adds 5% squalane and 5% pyrrolidone.

The general structure that uses

General structure R ₁(COO) R ₂Representative has the compound of following array structure.

R ₃(NH) (CO) R ₄Representative has the compound of following structural:

Formula (SiR ₅R ₆R ₇) N(SiR ₈R ₉R ₁₀) representative has the compound of following structural:

Formula (SiR ₅R ₆R ₇)-(SiR ₈R ₉R ₁₀) representative has the compound of following structural:

Formula (SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) representative has the compound of following structural:

Formula (SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) representative has the compound of following structural:

The toughener that uses these compounds in the methods of the invention or share regulation like this also is a part of the present invention.

Therefore, for example according to this aspect of the invention medicine box should comprise probe molecule and be selected from compound in dimethyl sulfoxide (DMSO) (DMSO), alcohol, aliphatic alkanes, cyclodextrin, fatty acid ester, acid amides or lactan and this group of organosilane.In addition, for example another medicine box comprises probe molecule and contains one or more and be selected from DMSO, alcohol, aliphatic alkanes, cyclodextrin, fatty acid ester, acid amides or lactan, and the solution of the compound in this group of organosilane, wherein the cumulative volume of compound is no more than the 20%(v/v of solution).

At preceding method, in solution and the medicine box, R ₁, R ₂, R ₃, R ₄, R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀It is the alkane structure.

R ₁And R ₂Can covalent attachment form ring structure.

R ₃And R ₄Can covalent attachment form ring structure.

In preceding method, specified percentage ratio is meant the compound concentrations as per-cent (v/v) expression that detects solution in the bracket of compound back.

More preferably, alcohol has 2 to 40 carbon atoms; Aliphatic alkanes has 10 to 60 carbon atoms; Alkene has 10 to 60 carbon atoms; R ₁Extremely ₂3 to 20 carbon atoms, wherein R have been lumped together ₁And R ₂Not covalent attachment when forming ring, R ₁And R ₂At least 1 carbon atom is respectively arranged; R ₃Add R ₄2 to 20 carbon atoms are arranged together, and work as R ₃And R ₄When not being covalent attachment one-tenth ring, R ₃And R ₄At least 1 carbon atom is respectively arranged; And R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀At least 1 carbon atom is respectively arranged, like this alkyl carbon structure R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Have together and be no more than 20 carbon atoms.

In preferable methods embodiment more, alcohol has 3 to 30 carbon atoms, and aliphatic alkanes has 20 to 40 carbon atoms, R ₁Add R ₂3 to 10 carbon atoms are arranged together, and R wherein ₁And R ₂When not being covalent attachment one-tenth ring, R ₁And R ₂At least 3 carbon atoms are respectively arranged;

R ₃And R ₄Add has 3 to 10 carbon atoms together, as works as R ₃And R ₄When not being covalent attachment one-tenth ring, R ₃And R ₄At least 1 carbon atom is respectively arranged; And

R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀At least 1 carbon atom is respectively arranged, six alkyl carbon structures, R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Have together and be no more than 10 carbon atoms.

As the preferred alkenes of penetrating toughener be wherein carbon-to-carbon double bond to the ratio of carbon-to-carbon strand less than 1 to 3 alkene.Most preferred ratio is less than 1 to 10.

Reduce the background compound

In the particular of 3SR in-situ method, step 3 comprises 3A described as follows, 3B and these three steps of 3C at least, and wherein step 3A occurs in before the step 3B, and step 3B is as follows before step 3C or be to carry out simultaneously with step 3C basically:

(3A) from the solution of completing steps (2), remove cell (or virus),

(3B) make the light of cellular exposure in the absorbing wavelength that fluorescent probe molecule is arranged, and

(3C) detection is with the amount of the light of the emission wavelength emission of fluorescent probe;

Wherein the time before step (1) beginning back and step (3C) termination, in being suspended with the solution of cell, exist and reduce the background compound;

Reducing the background compound comprises and has the photoabsorption part that structure is different from the fluorescence dye part of fluorescent probe;

The absorbing wavelength scope (it absorbs the light of this wavelength region when this method is carried out) that reduction background compound has has covered the emission wavelength ranges part wavelength (by the light wavelength scope of probe emission) of fluorescent probe, detects light quantity in the step (3C) in this scope.

In step (3B) with (3C), reduce the background compound preferably in the solution that is suspended with cell (or virus).For making light-absorbing compound become effective background depressant with regard to wavelength region, its molar average optical extinction coefficient in this scope better be scope be 520nm to 560nm Trypan Blue the molar average optical extinction coefficient at least 2%; Be more preferably in this scope molar extinction coefficient and be scope at least 10% of the molar average optical extinction coefficient of 520 to 560nm Trypan Blues.

Because many cell fluorescence detection methods are carried out in promptly about 400nm to the 660nm scope of visible light, so effective background depressant is valuable especially in this wavelength region.But the cell fluorescence that has detects and need not carry out in visible-range, therefore also can use the background depressant that absorption is arranged in 250 to 1000nm scopes under specific circumstances.In fact principle of the present invention can be applicable to use any wavelength of cell fluorescence detector detection.

This paper said " light " is meant by flow-cytometer or uses the observer of fluorescent microscope or the light that photographic camera detects.For this reason, under normal circumstances, should be visible light, but for the special detection purpose, cell counter or microscope change into detected energy greater than or be lower than the photon of visible light, this photon also is counted as said term " light " for this purpose.

Partly have the structure different because reduce the photoabsorption of background compound with the fluorescence dye part of fluorescent probe, so under the normal circumstances desired characteristic should be arranged, if promptly it launches light (being that it is a kind of fluorescent chemicals) really, then will have and be different from fluorescence emmission spectrum partly (promptly for the specified rate of absorbed setted wavelength light, as the function of wavelength, radiative intensity is with different).

Suppose that embodiment of the present invention especially effectively is part and is attached at least on some identical non-specific target because reduce the background compound as probe, and, will absorb the light of launching by probe so reduce the background compound because reduction background compound and probe are to be in very close position.In addition, reduce the background compound and will absorb the light of launching by the autofluorescence of non-probe molecule in the cell.After absorbing the light of being launched by the probe or the auto-fluorescence molecule of non-specific combination, the background compound can be at himself wavelength of transmitted light place emission light.Be lowered the background compound by the light of the probe molecule of specific combination emission and absorb less degree; Thereby improved the overall sensitivity of this analytical procedure.

Be preferably in 45 minutes that add behind the background depressant and detect fluorescence; If but the background depressant is in the solution that uses in step (38) and (36), then can wait 24 hours and carry out fluoroscopic examination again.

In of the present invention one particularly preferred scheme, this method also be included in above-mentioned steps (3A) and (3B) between add a washing step.Can be with cell or virus centrifugal come out from their solution of suspending, and then it is suspended in the washing soln, and come out to finish washing step cell or virus are centrifugal once more.Washing soln does not normally have probe solution, wherein can suspend to be with or without to reduce the background compound.

Cell should keep the sufficiently long time in the solution that contains the no probe that reduces the background compound, to make it to absorb reduction background compound.For this purpose, generally be to keep 5 minutes, but can there be very wide mobility scale this time.

Probe will comprise fluorescence dye.It also can comprise sub-thread nucleic acid (DNA or the RNA) part that is covalently bound on the dyestuff.Said part (moiety) is the part of molecule.For example, the probe portion by the nucleic acid contribution promptly is a nucleic acid moiety; Part by the fluorescence dye contribution is the fluorescence dye part.Can be undertaken covalently boundly by joint, wherein dyestuff and nucleic acid molecule (or antibody) are connected on the linkers in different loci.

The emission maximum or the absorbing wavelength data (as referring to Merck Index or Aldrich Chemical Company, Milwaukee, the goods catalogue of Wisconsin) of many other light-absorbing compounds of dye well are disclosed.These Notes of Key Datas but do not determine that what compound is suitable for.The scanning luminoscope provides complete emission or absorption spectrum.Listed some the reduction background compound that is applicable to some probe dye below.With regard to given probe dye, can test the effectiveness that reduces the background compound at an easy rate.

The maximum absorption wavelength that usually is used as fluorescent probe dye fluorescence element is about 488nm, and maximum emission wavelength is about 525nm.The light-absorbing compound that can be used as good background depressant comprises the azoic dyestuff derivative, and it has a poly aromatic hydrocarbons binding substances part, and one or more polar groups such as nitro (NO are arranged on this part ₂), sulfo group (SO ₃) or amino (NH ₂) group.Because their are inclined on the probe institute bonded same protein and film that is incorporated into as non-specific combination, so may be good background depressant.

In many probe dye, be applicable to that of the present invention a few is fluorescein, FITC, texas Red, tonka bean camphor, rhodamine, phycoerythrobilin and Perci-P.

Some the reduction background compound that uses with probe dye fluorescein (or fluorescein isothiocyanate (FITC)) is azocarmine B, azogeramine 14, Yi Fansishi indigo plant, palace fast black Wan, Trypan Blue, naphthol blue black and sulfo-rhodamine 101(Sulforho-damine 101).

Some the reduction background compound that share with the probe dye texas Red is naphthol blue black and palace fast black WAN.For the probe dye beyond the fluorescein, useful reduction background compound can be different from the reduction background compound that the probe of fluorescein or FITC mark share.In the emission wavelength ranges of the probe dye that detects with fluorimetric detector, fluorescent microscope or flow-cytometer, preferably reduce the 2%(at least preferably 10% that the background compound has the molar average optical extinction coefficient of the Trypan Blue of molar average optical extinction coefficient in 520nm to 560nm scope).

For any dye fluorescent probe, there is chemical compound lot to can be used as the background depressant.In general, the concentration that reduces of used background can 0.0002% and 0.10%(w/v) between.

Radical scavenger is as the background depressant

Aspect another of 3SR in-situ method, when particularly using fluorescence report thing group to detect the crossbred that forms during the step (3), radical scavenger is present in and is used for finishing in the reaction mixture of one or more steps in (1), (2) and (3).In this case, step (3) comprises that the probe that makes hybridization is exposed to the light of the fluorescent absorption wavelength of the probe with hybridization, and detects the light of the fluorescent emission wavelength of the probe that hybridization is arranged.Radical scavenger preferably is present in and is used in the reaction mixture of completing steps (2).

During step (3), preferably select suitable radical scavenger to measure this conditional request with the reduction that meets the light quantity that makes by scavenging agent emission and be no more than the autofluorescence that scavenging agent causes.Can be by once not adding scavenging agent, whether once adding twice such testing process of scavenging agent (in both cases, in detection can without probe), to detect certain scavenging agent suitable to given fluorescent absorption and fluorescent emission wavelength condition concurrent.

Radical scavenger comprises following four compounds:

1) hydrogen donor compound: better be to have the thiol group particularly to be connected to the compound of the thiol group on the aromatic group, as thiophenol.

2) not the compound that the hydrogen donor group has the radical that can combine with other radicals.Example comprises N-hydroxy derivatives such as dyestuff Tempo, hydrazine derivative and azo derivative, in the said azo derivative, be incorporated on another nitrogen by two bonds, and the nitrogen that is connected on the carbon atom by singly-bound carries radical.These compounds preferably have such structure, can cause that a kind of to prevent that them from reacting each other sterically hindered, thereby needn't remove radical.

3) contraposition hydroxy aromatic compound.Vitamin-E (a kind of preferred scavenging agent) promptly is the compound in this class.

4) compound of unsaturated carbon atom (Koelch group) is arranged.

Other people have identified many radical scavengers that comprise above-mentioned classes of compounds.

Can limit the radical radical scavengers according to its ability under prescribed condition as radical scavenger.If the FRS representative as the compound to be tried of radical scavenger, then can utilize following three step detection methods to confirm that FRS is a radical scavenger:

1) in the 5ml dimethyl formamide, sneaks into FRS and 10mg tribromo-acetyl superoxide, so that FRS is 2: 1 to the molar ratio of tribromo-acetyl superoxide.

2) reaction mixture being heated to 80 ℃ kept M minute.

3) with high performance liquid phase laminate method (HPLC) (if Cl ₃C-FSR is not volatile or vapor-phase chromatography (if Cl ₃C-FSR is volatile) analyze reaction mixture, and detect Cl ₃The amount of C-FSR.According to measured Cl ₃The amount of C-FRS limits removes activity.

Selected appropriate time M minute, if, make to change into Cl so that during with this method test vitamin-E ₃The percentage of the vitamin-E of C-vitamin-E is less than 100.In general, expection M was less than 10 minutes.

When testing two kinds of compounds (as vitamin-E and another kind of compound) under the same conditions, can be through more formed Cl ₃The amount of C-FRS is calculated the relative removing activity of these two kinds of compounds.If the formed Cl of certain compound ₃The amount of C-FRS is 20% of the amount that formed when adding vitamin-E in detection.Then this compound removing activity is the removing active 20% of VITAMIN.

Detect the active method of removing and be based on series reaction, cause 1 molecule tribromo-acetyl peroxide breakdown comprising handling down, and produce two molecule radicals, Cl at 80 ℃ ₃C* reacts to produce Cl with radical scavenger again ₃C-FRS.

The fluorescent absorption wavelength of probe or compound (as radical scavenger) is can be by the radiation wavelength (particularly ultraviolet or visible light) of probe or compound absorption, if and be absorbed, then can cause by this probe or compound emission light (particularly visible light) with the wavelength of being longer than the fluorescent absorption wavelength.Above-mentioned longer wavelength is meant " fluorescent emission wavelength ".The fluorescent absorption wavelength preferably at about 420nm in the 460nm scope.The fluorescent emission wavelength is preferably in about 450nm to 690nm scope.In practice, make probe populations be exposed to the absorbing wavelength scope, and light is launched in monitoring in emission wavelength ranges.

Fluorescent probe or compound are the materials with fluorescent absorption wavelength and fluorescent emission wavelength.

In fluorescence detection of the present invention, preferably selecting for use radical to remove active this radical scavenger of active 1% that is at least vitamin-E (is the removing activity of every mole of scavenging agent, if the scavenging agent molecule is that wherein each repeating unit all has the active polymkeric substance of removing, then the volumetric molar concentration of repeating unit can change thereupon); More preferably radical is removed active this scavenging agent of active 20% that is at least vitamin-E, and preferably selects for use at least and with vitamin-E the active scavenging agent of same major clean-up operation is arranged.

If find out from embodiment, generally this fluorescence detection can be used for a large amount of cells basically simultaneously.

In a preferred version of this method, step (5) comprises that detection is with about 520nm to 560nm(about 520nm particularly) the light of wavelength emission, the absorbing wavelength that step (4) is detected is preferably less than 520nm.

The preferred embodiment of fluorescence detection also is included in the washing step between step (2) and (3).Cell centrifugal come out from their solution of suspending can be suspended in the washing soln then again therefrom centrifugal more thereafter coming out to finish washing step.Washing soln does not normally have probe solution.

Radical scavenger preferably is not the fluorescence molecule of light of the fluorescent emission wavelength of emitting probe.Specifically, preferably radical scavenger neither absorbs the light of the fluorescence extinction wavelength of probe, also the light of the fluorescent emission wavelength of emitting probe not.

In the particular of this method, the solution that uses in the step (3) comprises fluorescent probe, radical scavenger and stationary liquid.As adding radical scavenger in mixture, its concentration better is 0.1% to 10%(v/v).

The probe of many report substance markers

In a preferred embodiment of the invention, probe comprises a sub-thread nucleic acid moiety and a plurality of report thing part, so that it is covalently bound to middle atom by shank respectively to report thing part, this centre atom then is connected between the nucleic acid of nucleic acid moiety on the phosphorus atom.Phosphorus atom is between nucleosides between nucleosides, rather than is adsorbed on the nucleosides of 3 of oligonucleotide ' or 5 ' end, and report thing part better is a dye molecule, and report thing part fluorescence dye part preferably.Available flow-cytometer or detect fluorescence dye at the microscopically that is being suitable for fluoroscopic examination.

For the dyestuff on the probe that is used for detecting target molecule in the nucleus (as nuclear DNA), the length of probe better is less than about 40 Nucleotide.If probe has 7 dye molecules, the molecular weight of each molecule is about between 500 to 600, and there are 7 molecular weight shank and 40 molecular-weight average close to be about 345 Nucleotide with kharophen part molecular weight (being about 60), the molecular weight of the probe that then is labeled should be about 20,000.In order to carry out specific hybrid, general probe length should have about 15 bases at least.

For the probe that is used for detecting nucleic acid in the cell cytosol, particularly RNA, better select for use length to be no more than the probe of 200 Nucleotide (molecular weight is not more than about 100,000), but also can use for example 1000 big oligonucleotide that Nucleotide is long.

For dyestuff, to open (promptly " separation length " is at least two atoms) by two atoms and phosphorus segregate at least near the dyestuff ring of shank.In general, preferably separating length is 3 to 30 atoms, is more preferably 3 to 10 atoms.

Influence in order to reduce anti-hybridization of potential and quenching as much as possible, the average core thuja acid that the phosphorus atom of combination dye and next phosphorus atom on the oligonucleotide skeleton are separated better is at least 4 atoms.Each phosphorus atom is preferably separated the next phosphorus atom on itself and the oligonucleotide by 6 atoms.

Between the atom between the phosphorus atom between shank and nucleosides for example can be Sauerstoffatom, sulphur atom or nitrogen-atoms.If middle intervention atom is a Sauerstoffatom, tricresyl phosphate ester bond between a nucleosides is arranged promptly; If middle intervention atom is a sulphur atom, tri o cresyl thiophosphate ester bond between a nucleosides is arranged then; If middle intervention atom is a nitrogen-atoms, then have between a nucleosides key between phosphoramidic acid three ester nucleosides (referring to Agrawal and Jamecnik, Nucleic Acids Research, vol18:5419, (1990)), for example phosphorothioate triesters and phosphoramidic acid three ester bonds.Three ester bonds comprise that the diester linkage that sees on the natural acid skeleton adds the 3rd ester bond that is arranged between phosphorus atom and the mesic atom (getting involved the atom between phosphorus atom and the shank).

If middle mesic atom is a sulphur atom, then shank can be the kharophen part.In the case, if dyestuff is a fluorescein, the atom number of then separating phosphorus atom between dye molecule ring and nucleosides will be the sulphur atom of getting involved in the middle of two carbon atoms of 4(nitrogen and kharophen part add).

If middle mesic atom is a nitrogen-atoms, then shank can be an ammonia hexyl part.In the case, if dyestuff is a fluorescein, the atom number of then separating near phosphorus atom between the dye molecule ring of joint and nucleosides will be 8, the nitrogen-atoms of getting involved in the middle of the carbon atom that promptly comprises nitrogen and 6 shanks adds.If dye molecule is a fluorescein isothiocyanate, then separates and also to comprise two other atom near the dye molecule ring of joint and the atom of phosphorus atom, promptly by the nitrogen and the carbon atom of lsothiocyanates partial contribution.

Should be clear and definite be, the nucleic acid chains of probe and the nucleic acid chains of target hybridization and to form hybrid molecule be because these two chains have the nucleosides order complimentary to one another (base of nucleosides for example, VITAMIN B4 is complementary to uridylic or the thymus pyrimidine in another nucleosides, guanine is complementary to cytosine(Cyt)), but might not be the whole nucleosides order that the whole nucleosides of probe is complementary to target in proper order.

Can select fluorescence dye on demand.Fluorescence dye (attention has shank easily) commonly used is the 5-(2-iodacetyl) amino) ethyl) amino) naphthalene-1-sulfonic acid, 5-sulphur acetylaminofluorene, the amino fluorescein of 6-iodacetyl, tetramethylrhodamin-5-iodo-acid amide, tetramethylrhodamin-6-iodo-acid amide, the monobromo diimine, tetraiodofluorescein-5-iodo-acid amide, 7-diethylin-3-((4 '-iodacetyl amino) phenyl)-the 4-methylcoumarin, 4 '-((iodacetyl amino) methyl) fluorescein, tetraiodofluorescein-5-iodo-acid amide, the vitamin H iodo-acid amide, the N-(1-pyrene) iodoacetic acid ester, the vitamin H iodo-acid amide, the N-(1-pyrene) iodoacetic acid ester, N-((2-(iodacetyl oxygen base) ethyl)-and the N-methyl) amino-7-oil of mirbane-2-Bing Evil-1, the 3-diazole.

One of many Res fungibiles of iodo-acid amide are maleimides.

Purpose for the present invention, preferred dyestuff is 7-diethylin-3-((4 '-iodacetyl amino) phenyl)-the 4-methylcoumarin, the particularly amino fluorescein of 5-iodacetyl, the amino fluorescein of 6-iodacetyl, tetramethylrhodamin-5-iodo-acid amide, tetramethylrhodamin-6-iodo-acid amide and N-((2-(iodacetyl oxygen base) ethyl)-the N-methyl) amino-7-oil of mirbane-2-Bing Evil-1, the 3-diazole.

For eukaryotic in situ hybridization, the efficient of monobromo diimine is relatively poor, and this may be because it can not pass through cytolemma effectively.

Importantly, under the cross experiment condition, report thing part can stably be connected on the nucleic acid probe part, provides enough signals, and if it be a kind of fluorescence dye, also have suitable exciting and emission wavelength.

In another embodiment of the 3SR in-situ method that detects intracellular analyses thing RNA molecule, aromatics report thing group is the part of probe molecule during step (2), and before the analog of cell with report thing group is incubated at completing steps (3).Preferably, during step (2), this analogue is present in the same solution that is used for making amplifier molecule hybridization in probe molecule and the cell: step (3) is (have report the thing group with causing detecting but do not detect exciting and/or the fluorescent probe of absorbing wavelength of analogue as the use) that will detect report thing group but not detect that the mode of analogue finishes with a kind of in addition.

Of the present invention one accidental, report thing group is a ring compound.Another is accidental of the present invention, and ring includes unsaturated link(age) with group.Of the present invention one narrower accidental, cyclic group is aromatic substance (one or more phenyl ring).

Be preferably, surpass the amount of report thing group, be more preferably analogue and be equivalent to report at least 10 times of thing group in the molar weight analogue.

Can suppose that method of the present invention is based on analogue and report thing group competition nonspecific binding site.When using the aurin or derivatives thereof to combine with nucleic acid probe, another mechanism may comprise that aurin is attached to should be in conjunction with on the avtive spot of reporting the thing group in the protein.

Better be to select suitable analogue, to make it to keep the constitutional features of great majority or all report thing groups.Analogue can have unexistent other constitutional featuress of probe.

Analogue should be able to penetration cell or virus.At analogue is under the situation of aurin derivative (rosolic acid derivative), better is that analogue has on its aromatic group-CO ₂,-NH ₂,-OH or-SO ₃Base isopolarity functional group; Its example is chromogen cyanine R(chromoxane cyanine R) and chrome azurol S.The subunit group of preferred analogue is NH on the sealing Methionin ₂The subunit group of group.Make report thing group absorb energy, launch the energy of some absorption then, and detect the energy of being launched, thereby detected fluorescence report thing group.

Make chemoluminescence report thing group enter reaction, cause energy to emit, thereby detected chemoluminescence report thing group with the form of light as in the enzymatic reaction.

Other report thing group such as vitamin Hs are because they can combine with the streptavidin on for example directly or indirectly being attached to enzyme (alkaline phosphatase or the horseradish peroxidase of the reaction that if can catalysis can detect) and be able to detected.

The spendable fluorescein base group of the present invention comprises fluorescein (or FITC), texas Red, tonka bean camphor, rhodamine, rhodamine derivative, phycoerythrobilin and Perci-P.

The spendable chemiluminescent groups of the present invention comprises different luminol,3-aminophthalic acid cyclic hydrazide (or the amino phthalyl of 4-; Referring to Aldrich Chemical Co., the 1990-91 catalogue, or referring to Molecular Probes, Inc., catalogue).

In a preferred version of the present invention, when report thing group was fluorescein, step (4) comprised and detects wavelength at the about emission light of (particularly about 520nm) between 520nm and the 560nm that the absorbing wavelength of step (3) is preferably less than 520nm.

The preferred version of fluorescence detection further comprises the washing step between step (2) and (3).Can be with cell centrifugal come out from their solution of suspending, and then be suspended in the washing soln, thus and centrifugally from washing soln come out to finish washing step.Washing soln does not normally have probe solution.

In the particular of present method, the solution that uses in the step (2) comprises the analogue and the fixing agent of probe (comprising report thing group), report thing group.Itself also constitutes a part of the present invention such probe solution.

If add analogue in step (2) solutions employed, then its concentration is preferably 0.01 to 0.5%(particularly about 0.05 to 0.01%) (w/v).

The preferably combination mode is that fluorescein or rhodamine derivative and aurin, its derivative or Napa-chrome Green share.

Probe

Nucleic acid probe can be DNA, RNA or comprise DNA or the oligonucleotide of RNA or polynucleotide.DNA or RNA can be by base urea purine, uridylic, and thymus pyrimidine, guanine, cytosine(Cyt) or its any natural or artificial chemical derivative are formed.Probe can normally be attached on complementation or the mirror image target cell gene order by hydrogen bond formation by the chemical bond of one or more types.

Before in joining hybridization solution, can carry out the detectability mark to nucleic acid probe.In addition, can select can be incorporated into the detectable label of hybridizing on the product.Can will be applicable to that detection moiety of the present invention comes label probe with any.But detection moiety like this can be any the have physics that can detect or material of chemical property.Useful especially enzymatic activity group, as enzyme (referring to Clin.Chem., 22:1243,1976), enzyme substrates (is examined and is seen british patent specification 1,548,741), synthase (referring to United States Patent(USP) Nos. 4,230,797 and 4,238,565) and enzyme inhibitor (referring to U.S. Patent No. 4,134,792), fluorescent substance is (referring to Clin.Chem., 25:353,1979), chromophoric group, luminophore such as chemiluminescent substance and noclilucence material (referring to Clin.Chem., 25:512,1979), particularly combinative part, near-end interaction partners and radio isotope as ³H, ³⁵S, ³²P, ¹²⁵I and ¹⁴C.

Can biotin labeled Nucleotide be incorporated among DNA or the RNA by nick translation, zymetology or chemical process.Use the probe of avidin/strepto-antibiont albumen, fluorescence, enzyme or Radioactive colloidal gold binding substances hybridization back detection of biological elementization.Also can use other fluorescent chemicalses, the fluorescent derivative that can carry out immunodetection or vitamin H analogue labeling nucleic acid.Also can be by being connected to come labeling nucleic acid with protein.Also can use the nucleic acid that combines (ssB) protein cross with radioactivity material or fluorescence histone HI, enzyme (alkaline phosphatase and peroxidase) or strand.In order to increase the susceptibility that detects Radioactive colloidal gold or peroxidase product, the enhancing or the amplification method that can use the silver-colored solution of multiple utilization to finish.

Also can use indirect immuno fluorescent cytochemical methods (Rudkin and Stollar, Nature 265:472,1977; Van Prooijen et al., Exp.Cell Res., 141:397,1982).Through to animal injection poly(rA)-poly(dT) produce the polyclonal antibody of anti-RNA-DNA crossbred.The hybridization of dna probe and cell in-situ, and be incubated and detect crossbred with the antibody of anti-RNA-DNA crossbred.

The luminous organism element ^TM(Photobiotin ^TM) label probe is better than biotin labeling.

Target in cell, tissue and the body fluid

Analyte RNA can be positioned in cell or the viral organism entity.Cell or virus can be suspended in the solution and not be fixed on the solid phase carrier.On the other hand, also can be on solid phase carrier with cell or viropexis.Cell or virus can be the parts of tissue slice (Histological section).

In an embodiment of present method, during hybridizing, target cell is fixed on the solid phase surface.In another embodiment, target cell all is suspended in the liquid and is not fixed on the solid phase surface in the entire operation process.Be particularly suitable for using conventional streaming cell counter among the present invention.

The cell that contains the analyte nucleic acid molecule can be eukaryotic cell (as people's cell), prokaryotic cell prokaryocyte (as bacterium), the cell of vegetable cell or other types.They can be simple eukaryotic cell such as enzyme mother, or the cell that is obtained by complicated eucaryotic organism such as human body.

Analyte RNA can be at no tunicle or have in the virus of tunicle (having non-wrap film such as lipoprotein membrane).

Analyte RNA can be a viral RNA.For some virus (as the human immunodeficiency virus), in single cell, can there be complementary analyte RNA chain simultaneously.

The viral nucleic acid target can be the part of virus, and this moment, virus can be in or be not in the cell.In addition, the viral nucleic acid target also may not be the part of virus, but may be in cell.

Can to be present on biological entities in the liquid suspension, the slide glass or in the cell on other solid phase carriers, in the tissue culture cells and the target in the tissue slice carry out hybridization analysis.When biological entities is cell, it can be from solid tissue (as nerve, muscle, heart, skin, lung, kidney, pancreas, spleen, lymphoglandula, testis, uterine cervix and brain), or is present in the cell in various lining form pipelines, conduit and chamber (as gi tract, urethra, vas deferens, uterine cavity, uterus pipe, vagina, respiratory tract, nasal cavity, oral cavity, pharynx, larynx, tracheae, segmental bronchus and lung) or body fluid (as urine, gastric juice, spinal fluid, blood and lymph liquid) or the ight soil.

Hybridization fixing agent and solution

The fixing agent and the hybridizing method of immobilized cell have been discussed in PCT application WO90/02173 and WO90/02204.Fixing agent should be able to keep the accessibility and the hybridization ability (also should keep antigenic accessibility and immunoreactivity in case of necessity) of the morphology and the hybridization target of cell well.The precipitation fixing agent comprises the combination of ethanol, acetate, methyl alcohol, acetone and these materials.Cross linking fixative comprises Paraformaldehyde 96, glutaraldehyde and formaldehyde.Must capture the network of nucleic acid or it is caused covalent modification so that destroy under the condition of its crossability and use cross linking fixative being unlikely to form.

Fixing agent can be selected from separately or unite any precipitation agent or the linking agent of use, and can be moisture or water-free.Fixing agent can be selected from one group of material that comprises formaldehyde solution, alcohol, salts solution, mercury chloride, sodium-chlor, sodium sulfate, potassium bichromate, potassiumphosphate, brometo de amonio, calcium chloride, sodium acetate, lithium chloride, cesium acetate, lime acetate or magnesium, saltpetre, potassium bichromate, Sodium chromate, potassiumiodide, sodium sulfonate, Sulfothiorine, picric acid, acetate, Paraformaldehyde 96, sodium hydroxide, acetone, chloroform, glycerine, thymol.Fixing agent preferably comprises by precipitating action fixed cell composition and reagent with following feature: effect is a reversible, can keep cell (or virus) form, keep required cellular constituent antigenicity, make nucleic acid in cell, keep suitable location, can not modify it in a kind of mode that makes nucleic acid can not form two or three strands of crossbreds, and do not make nucleic acid and all already present target sequences hybridize the mode that is suppressed to influence cellular constituent with a kind of.

Employed linking agent is better than 10%(v/v most).The hybridization solution of step (2) that is used for the method for check and analysis thing nucleic acid molecule generally can contain high from liquid sequence denaturing agent, damping fluid, pore former, crossbred stablizer.High from liquid sequence denaturing agent (Robinson, D.W.and Grant, M.E.(1966), J.Biol.Chem., 241:4030; Hama-guchi, K.and Geiduscheck, E.P.(1962), J.Am.Chem.Soc. 84:1329) comprises methane amide, urea, guanidine thiocyanate, trichloroacetate, tetramethylammonium, perchlorate and sodium iodide.Can be preferred any pH that can make remains on damping fluid between at least 7.0 to 8.0.Pore former can be stain remover such as Brij 35, Brij 58, sodium lauryl sulphate, CHAPS or Triton X-100.As if 0.05% Brij 35 or 0.1% Triton X-100 can make probe by the endochylema film but can not pass through nuclear membrane.Sodium desoxycholate will make probe pass nuclear membrane, therefore in order to limit and the biological polymer target hybridization of endochylema, should avoid using the nuclear membrane pore former.In the time of in target biopolymer is positioned endochylema, thereby this selectivity Subcellular Localization can be by reducing or stoping probe and complementary nuclear to hybridize specificity and the susceptibility that improves this method in proper order.The crossbred stablizer as one or divalent cation salt be contained in the hybridization solution, be used to promote the complementation order of probe and the hydrogen bond between its target biopolymer to form.Used sodium chloride concentration is 0.15M to 1M preferably.In order to prevent the non-specific binding of nucleic acid probe, can in hybridization solution, add and the irrelevant nucleic acid of biological polymer.

Available solid phase carrier comprises but is not only limited to glass, Scotch bar (3M), nylon, Gene Screen Plus(Neu England Nuclear) and nitrocellulose.Preferably use microslide.

In order to make up the medicine box that is used to finish the whole bag of tricks of the present invention, can put into packing box and/or bottle with being used for all cpds of the present invention and reagent, and put in the single container, and how best additional disclosure finishes the specification sheets of the inventive method.Basic medicine box should contain the reagent of the method that is useful on 3SR, also preferably also contains dezyribonucleoside and ribonucleoside as necessary enzyme, wherein should comprise the reagent that is used to hybridize, as contain the damping fluid of methane amide.Hybridizing reagent preferably includes one or more following penetrating tougheners of the present invention, radical scavenger and report thing group analogue.More preferably medicine box should have the Yi Fansishi indigo plant of using during background depressant such as the fluoroscopic examination.Another embodiment of medicine box then comprises the signal toughener.Specific medicine box should contain and is useful on probe and the primer that the particular diagnosis purpose infects as diagnosis transposition or viral RNA.

Reagent

Can buy reagent from a plurality of different sourcess, comprise Aldrich Chemical Co., Mil-waukee, Wisconsin; Sigma Chemical Co., St.Louis, Missouri; Molecular Probes, Inc., Eugene, Oregon; Clontech, Palo Alto, California; Kodak, Rochester, NY and Spectrum Chemical Manu-facturing Corp., Gardenea, California.

Other information of some material that relevant this paper relates to can referring under show table 1.

The abbreviation of table 1. compound and dyestuff and common name

The abbreviation or

The common name compound

Tempo 2,2,6,6-tetramethyl piperidine-N-oxygen base { CAS#

2564-83-2}

The EDTA ethylenediamine tetraacetic acid (EDTA)

The DMSO dimethyl sulfoxide (DMSO)

The DTT dithiothreitol (DTT)

The PVP polyvinylpyrrolidone

PEG4000 polyoxyethylene glycol (molecular weight about 4000)

The PBS phosphate buffered saline (PBS)

CHAPS 3-((3-courage amido propyl group)-dimethylamino)-1-third

Alkane-sulfonate { CAS#75621-03-3}

The plain N-(4-azido--2-nitrophenyl) of luminous organism-N'-(3-

The biotinyl aminopropyl)-and the N'-methyl isophthalic acid, the 3-propylene diamine

{CAS#96087-37-5}

Ficoll nonionic ficoll (Pharmacia)

Silicon { the CAS#65455-52 of Percoll colloid PVP coated

-9}

Hot phenoxy group polyoxyethylene glycol (a kind of Soxylat A 25-7) { CAS# of Triton X-100

900293-1; Referring to Aldrich Chem. Co.,

1998-91 catalogue }

Brij35 polyoxyethylene 23 dodecyl ether { CAS#9002-92

-0}

Brij58 polyoxyethylene 20 hexadecyl ether { CAS#9004-95

-9}

Hoechst 33258 2'-[4-hydroxyphenyl]-5-[4-methyl isophthalic acid-piperazine

The piperazine base]-2,5'-pair-1H-benzene carbon amide pyrroles three

Hydrochloride { CAS#23491-52-3}

The dyestuff abbreviation

The abbreviation of dyestuff numbering dyestuff actual name

12 naphthol blue black naphthols B1, B1K,

13 palace fast black WAN palace F-B WAN

20 sulfo group rhodamines, 101 hydrate sulfo group rhodamines 101

Fluorescein isothiocyanate FITC

Solution

SSC has following component: 0.15M NaCl, 0.15M Trisodium Citrate, pH7.0.Be made into 2X SSC so that after water was with dilution in 1: 1, will obtain SSC; Be made into 10X SSC so that after water was with dilution in 1: 10, obtain SSC.0.1X being water, SSC obtains with 1: 10 dilution SSC.

The fixed solution F that uses in the flow cytometry contains following ingredients: 4 volumes (vol) ethanol adds 5 volume 1X PBS solution and adds 1 volume Glacial acetic acid again.

No. 1 washing soln (#1) has following composition: the 0.4M guanidinium isothiocyanate, and 0.1%Triton X-100,0.1X SSC is dissolved in the deionized water.No. 2 washing solns (#2) have following composition: 0.1%Triton X-100,0.1% SSC is dissolved in the deionized water.

PBS is a phosphate buffered saline (PBS), fills a prescription to be 0.136M NaCl, 0.003M KCl, 0.008M Na ₂HPO ₄7H ₂O, 0.001MKH ₂PO ₄

With the disease of the inventive method detection and the example of transposition

Table 2 has listed the polytype disease that can use the inventive method to detect for example, but it is not meant to limit the disease of available the inventive method detection or the type of transposition.

Table 2

The example of known transposition

T (2; 8) (p11; Q24) Burkitt lymphoma (Fujino et al., Jpn.J.

Cancer Res.,vol77;pp24-77(1986);

T (11; 14) (q13; Q32) chronic lymphocytic leukemia (Y.Tsujimoto et al.,

Nature vol 315;pp340-343(1985));

T (7; 9) (q34; Q34.3) acute T cell lymphocytoblast lymphoma (T.C.Reynolds

et al.,Cell vol 50,pp107-117(1987));

T (14; 14) (q11; Q32) T cell chronic lymphocytic leukemia (M.P.Davey et al.,

Proc.Natl.Acad.Sci.USA,vol85;pp9287

-9291(1988));

T (8; 14) (q24; Q32) Burkitt lymphoma (F.G.Haluska et al., Proc.

Natl.Acad.Sci.USA,vol84,pp6835-6839

(1987));

T (10; 14) (q24; Q11) acute lymphocytoblast leukemia (the M.Zutter et of T cell

al.,Proc.Natl.Acad.Sci.USA,vol87

pp3161:3165(1990));

T (9; 14) (p13; Q32) the dispersivity large celllymphoma (H.Ohno et al., Proc,

Natl.Acad.Sci.USA,vol87,pp628-632

(1990));

T (1; 14) (p33; Q11) leukemia cell (8) (C.G.Begley et al.,

Proc.Natl.Acad.Sci.USA,vol86;pp2031

-2035(1989));

T (X; 18) (p11.2; Q11.2) synovial sarcoma

The recessive dyschondroplasia perforation that (X-Y transposition) X is chain

(47, XY ,+del (5) (q12, q34), t (15; 21) (q21; Q22) the white blood of acute myeloblast

Sick (AML)

47, XY ,+del (5) (q12, q34) acute nonlymphocytic leukemia (ANLL)

T (8; 14) (q24; Q11) acute lymphocytoblast leukemia (T-All)

T (8; 14) (q24; Q11) leukemia/lymphoma

Other acute lymphocytoblast leukemia of 13 (q11)

(proximal del15q) Prader-Willi syndromes

T (1; 15) (p36.2; P11.2) the ubiquity muscle tone goes down

(X; 5) (p11.2; Q35.2) incontinentia pigmenti

(2q13) rhabdosarcoma

T (16; 21) (q11; P11) trisomy 16p

T (1; 19) the acute lymphocytoblast leukemia of pre B cell

T (15; 17) acute promyelocyte leukemia (APL)

T (1; 7) (p11; P11) acute myeloid leukemia or myelodysplasia

(8q24 14q32) Burkitt lymphoma

Bcl-2

t(11;14)(q13;q32) Bcl-1

T (14; 18) (q32; Q21) Hodgkin lymphoma (NHL)

T (8; 14) (q24; Q32) folliculus tissue-type

T (3; 22) (q27; Q11) Burkitt sample lymphoma

T (11; 14) (q13; Q32) dispersivity large celllymphoma

T (9; 22) (q34; Q11) MLC W/ (Ph)

T (4; 6) (p15; P12) MLC W/ (Ph)

Inv (3) (q21 q26) refractory anemia

t(3;3)(q21;q26) RAEB-T

Inv (3) (q21 q26) has the myelofibrosis (MMM) of myeloid metaplasia

Damage nephrocyte sarcoma (RCC) on the 3p

(3; 21) (q26; Q22) Secondary cases leukemia

T (3; 21) (q26.3; Q22) acute marrow sample leukemia

5q35 children's malignant histocytosis

t(5;6)(q35;p21)

T (2; 13) (q37; Q14) rhabdosarcoma (RMS)

(Y; 11) (q11.2; Q24) Jacobsen Cotard

T (X; 18) (p11; Q11) two-phase and single phase property synovial sarcoma

t(X;15;18)(p11;q15;q11) "

t(X;7)(q11-12;q32) "

14q32 (28%) or 14q11 (14%) adult T cell leukemia/lymphoma

T (19; 22) (q13.3; P11.2) distally 19q

Transposition neuroepithelioma between the karyomit(e) * 11 and 22

The disorder of tder (1q9p) bone marrow proliferation

Breakdown point equilibrated X euchromosome on Xp22 and the Xq28

The 11q23 acute myeloid leukemia of being grown up

13q or trisomy 13

The distortion of 7q and 1q

Trisomy 11q

T (8; 14) (q24; Q32) Burkitt type leukemia

T (9; 22) (q34; Q11) the positive All (Phl+All) of Philadelphia

X; The congenital acute lymphocytoblast leukemia of 6 q15-16 (ALL)

(8; 21) refractory anemia

46, XY, der (5) t (5; 11) (p15.2; P14) [11p15] Beckwith-WiedemannShi

Syndromes (BWS)

11p15, fus (14p; 21p), and fus (15p; 21p) the giant cell knurl (GCT) of bone

The multiple I type of 11q13 endocrine tumors generates (MENI)

T (7; 22) (p22; Q13) with (p13q22) acute non-lymphocyte of inv (16)

Leukemia (M4) is associated

46, XY/46, XY, t (7; 19) (q22; P13.3) acute myelomonocyte leukemia

(FAB M4)

46, XY/46, XY, t (7; 19) (q11; Q13) children ALL

46,XY,t(3q;11q),t(7q;19p),t(15;17)(q26;q22)?ANLL(FAB?M3)'2

Embodiment 1

Original position transposition 3SR detects

Counting 3 * 10 ⁷The individual chronic bone marrow derived of K562 people that grows in the substratum that contains 10% foetal calf serum becomes leukemia crisis cell line cell, with 250xg centrifugal 5 minutes.Place under the room temperature to inhale after 3 minutes and remove supernatant liquor and cell is suspended in the phosphate buffered saline (PBS) again.Cell suspension inhaled after centrifugal 5 minutes remove supernatant liquor, and cell is suspended in 4% Paraformaldehyde 96 again.Insulation made cell by the classification dehydration of alcohols after 3 minutes under the room temperature.

With cell centrifugation 5 minutes, inhale and remove 4% Paraformaldehyde 96, and cell is suspended in 30% ethanol that 1mlDEPC handles (DEPC is a diethylpyrocarbonate) again.The room temperature placement adds 0.8ml 100% ethanol alcohol concn is transferred to 60% after 3 minutes.After 3 minutes, add 1.8ml 100% ethanol and make alcohol concn reach 80%.At last, placed again 3 minutes and add 11.4ml 100% ethanol to make alcohol concn be 95%.Then with cell centrifugation 5 minutes, inhale and remove ethanol and cell is suspended in 4.5ml 100% ethanol again.Room temperature was placed after 3 minutes, and pair cell carries out progressively rehydration processing.

The water that adds 250 μ l DEPC processing makes alcohol concn reach 95%; The water that adds 1.15ml DEPC processing after 3 minutes reaches 80% alcohol concn.The water that adds 1.9ml DEPC processing after 3 minutes again reaches 60% alcohol concn.At last, adding water that 7.5ml DEPC handles, to make alcohol concn be 30%.With cell centrifugation 5 minutes, inhale and remove supernatant liquor and cell is suspended in the 2XSCC solution that 1ml DEPC handles again.With cell transfer in the 1.5ml Eppendorf tube and be incubated 3 minutes, then with protease K digesting and carry out the 3SR reaction.

In Eppendorf tube,, inhale and remove supernatant liquor and cell is suspended in again to be dissolved in the 2mM CaCl that DEPC handles cell centrifugal 2 minutes with 1500rpm ₂, 20mM Tris-HCl, the Proteinase K among the pH7 (ml) (10 μ g/ml)., cell centrifugation also was suspended among the PBS of 1ml DEPC processing in 2 minutes again after 15 minutes in 42 ℃ of digestion with 1500rpm.With cell suspending liquid centrifugal 2 minutes, inhale and remove supernatant and be suspended in once more among the PBS that 1ml DEPC handles with 1500rpm.With 1500rpm centrifugal 2 minutes, inhale and remove supernatant, in cell, add the 3SR solution that 100 μ l contain bcr-and abl-3SR primer (each 250ng/100 μ l) and enzyme and 3SR reaction buffer.

The 3SR reaction soln contains Tris-HCl(40mM, pH8.1), MgCl ₂(30mM), KCl(20mM), DTT(10mM), spermidine (4mM), ATP(7mM), CTP(7mM), GTP(7mM), UTP(7mM), dATP(1mM), dCTP(1mM), dGTP(1mM), TTP(1mM).

5 ': the bcr primer has following nucleotide sequence:

AATTTAATACGACTCACTATAGGGATCAGGTGCACAGCCGCAACGGC

3 ': the abl primer has following nucleotide sequence:

AATTTAATACGACTCACTATAGGGATCGGCTTCACTCAGACCCTGAGG

Enzyme in the 3SR reaction mixture is AMV reverse transcriptase (30 units/100 μ l) and T7 RNA polymerase (100 units/100 μ l), and E.coliRNase H(3 unit/100 μ l).42 ℃ of reactions added the PBS that 1.4mlDEPC handles after 2 hours, and the reaction soln of each 0.5ml five equilibrium is transferred to respectively in 3 Eppendorf tubes.With cell centrifugal 2 minutes, absorb solution and also add hybridization probe with 1500rpm.

The negative probe of naming to NR is to be derived by the nitrogen reductase gene that is present in the bacterium, and known not with eukaryotic cell in nucleic acid hybridization.

The L6-26 probe has order:

CGCTGAAGGGCTTCTTCCTTATTGAT

The K28-26 probe has order:

CGCTGAAGGGCTTTTGAACTCTGCTT

Synthetic oligonucleotide is used Biosystems 380B type dna synthesizer; It recommends to use A.B.I. reagent), and in last step, phosphorylated amino hexyl joint is connected on 5 ' end.Then with 5 '-amino hexyl oligonucleotide is coupled on the fluorescein(e) dye as herein described (FITC), and with the Waters HPCL purifying that uses baseline 810 chromatography working positions it.

For finishing hybridization step, in centrifugal cell precipitation agglomerate, add 50 μ l hybridization mixtures, DNA, 3%(v/v that this mixture is sheared by 30% methane amide, 5X SSC, 0.16M sodium phosphate buffer (pH7.4), 1 μ g/ μ l) Triton X-100,5%PEG4000,25mM DTT, 4M isothiocyanic acid Guanidinium, 15X Ficoll/PVP and the probe (NR that adds with 2.5 μ g/ml concentration, 28S, or share K28-26 and L6-26, promptly said K28+L6 probe herein) form.With cell in 95 ℃ of insulations 1 minute so that 3SR product sex change and made probe annealing 30 minutes in 42 ℃.Washing suitable behind the hybridization is very necessary for the background of eliminating because of probe that non-specific binding caused.In the washing soln A that 1ml is made up of 0.1X SSC.0.4 isothiocyanic acid Guanidinium and 0.1% Triton X-100, be incubated cell down in 42 ℃.On turbine mixer, mix and respectively manage content, and in Eppendorf centrifuge with 1500rpm centrifugal 2 minutes.Remove supernatant, and in the cell precipitation thing, add washing soln B(42 ℃ that 1ml is made up of 0.1X SSC, 0.2%Triton X-100).Mixing and centrifugal 2 minutes on turbine mixer with 1500rpm.After absorbing washing soln B, cell suspension is dissolved in the 0.0025% Yi Wensi basket (adding as the background depressant) of PBS at 250 μ l, analyzes it mixed being incorporated on the Coulter Profile flow-cytometer on the turbine mixer.

With the Coulter device in the Profile II ^TMLast analysis of cells.This device uses the 488nm argon laser, 252nm band-pass filter mating plate is arranged and for counterstain 635nm band-pass filter mating plate is arranged then for FL1.For each analyzed sample, at first analyze and contain the sample of negative probe and set four fens quadrant states, so that the cell of little percentage falls in upper right 1/4th scopes.Analyze the sample to be analyzed that contains positive probe under the identical parameter of sample of negative probe containing then with analysis.Because set four fens quadrants exactly and two samples all done identical processing, so all be as positive record at any cell numbers (more than the control level) of upper right 1/4th records.

Comprise all cells and get rid of under the situation of No. 2 scattered gratings of most of cell debris that in use 88% particle is among histogrammic zone, lower-left.Log fluorescence 1(FITC during with the NR probe) mean fluorecence radio frequency channel is 0.899, and during with the K28+L6 probe in 36526 100% particle be 8.7 this just represented about 10 times of signal to noise ratios.This ratio is more much higher than not carrying out 3SR when diffusion.

In addition, used LISTVIEW software and adjust to the scattered grating that comprises 100% cell granulations and again listed representative data is analyzed afterwards again.Select vernier so that 93.5% when using the NR probe selected level low, and make 99% when using the K28+L6 probe selected level height.

Embodiment 2

Proof present embodiment 25 base oligomer hybridisations and 6 to 12 base oligomer are not hybridized under hybridization conditions.

Use the H9 cell in the following experiment.(PBS) washes cultured cells with the nuclease free phosphate buffered saline (PBS), puts into certain density single cell suspension and obtains knowing isolated cells.Eccentric cell obtains the cell precipitation agglomerate, and absorbs supernatant liquor.Cell is suspended in 40% ethanol, 50%PBS and 10% Glacial acetic acid and in 4 ℃ to descend to place 12-16 hour again.After fixing, eccentric cell to be to remove fixing agent, washes cell and is suspended among the 2X SSC at 1X PBS then.Cell should be used immediately.

For the positive control probe, design and utilize the conservative fragments of eukaryotic cell 28S rRNA; It is named for 28s-25-AL and as the positive probe that carries out above-mentioned experiment.Name negative probe for NR25-AL be derived from the nitrogen reductase gene that sees in the bacterium and known not with eukaryotic cell in nucleic acid hybridization.Tabulate down and listed the DNA sequence of employed these two kinds of probes in 4.Also be derived from 12 bases, 10 bases, 8 bases and the 6 base oligomer of 25 base oligomer with the order preparation shown in 4 of tabulating down.All orders of showing among the embodiment all have 5 ' end as the left distal end of each order.

Table 4

The probe order

28S-25-AL ATCAGAGTAGTGGTATTTCACCGGC

28S-21-AL ATCAGAGTAGTGGTATTTCAC

28S-18-AL ATCAGAGTAGTGGTATTT

28S-15-AL ATCAGAGTAGTGGTA

28S-12-AL ATCAGAGTAGTG

28S-10-AL ATCAGAGTAG

28S-8-AL ATCAGAGT

28S-6-AL ATCAGA

NR25-AL TACGCTCGATCCAGCTATCAGCCGT

NR 12-AL TACGCTCGATCC

NR 10-AL TACGCTCGAT

NR 8-AL TACGCTCG

NR 6-AL ATCGCT

(in all orders as herein described, 5 ' end is all in the left side),

Synthetic few nuclear deoxynucleotide (Applied Biosystems dna synthesizer, 380B type, A.B.I. reagent), and in the end the stage is added to ammonia hexyl joint on 5 ' terminal phosphate.Then purifying 5 '-amino hexyl oligodeoxynucleotide, with its be coupled to from the rhodamine derivative of Molecular Probes and use baseline 810 chromatography equipments with Waters HPLC purifying it.

In order to carry out crossover process, DNA, the 3%(v/v that will shear by 30% methane amide, 5X SSC, 0.16M sodium phosphate buffer (pH7.4), 1 μ g/ μ l) alcohol derivate of Triton X-100(Soxylat A 25-7, referring to Aldrich ChemicalCo.1990-91 catalogue), the 5%PEG4000(polyoxyethylene glycol), the 25mMDTT(dithiothreitol (DTT)), 0.4M isothiocyanic acid Guanidinium, 15X Ficoll/PVP and the 50 μ l hybridization mixtures formed with the probe that 2.5 μ g/ml concentration add are added on the cell precipitation cake.Hybridize and under 42 ℃, carried out 30 minutes.Above said 500X Ficoll/PVP is that 5g Ficoll 400 types (molecular weight is 400,000 ficoll) add 5g PVP(polyvinylpyrrolidone) soluble in water to final volume be 100ml; 15X Ficoll/PVP is the 500X Ficoll/PVP of water with the dilution of 15/500 Dilution ratio.

Behind the hybridization, suitable washing is very necessary to the background pollution that the non-specific binding of eliminating because of probe causes.After the hybridization cell is placed on be added with 10ml preheat to the 15ml taper of 42 ℃ of washing solns of forming by 0.1X SSC, 0.4M isothiocyanic acid Guanidinium and 0.1%Triton in vitro.Stirred solution becomes single cell suspension up to cell, with 250xg centrifugal 5 minutes then.Remove supernatant liquor, adding preheats 42 ℃ of 10ml washing solns of being made up of 0.1X SSC and 0.1% Triton in cell mass.Stirred solution becomes single cell suspension up to cell.Centrifugal 5 minutes then with 250xg.Remove supernatant liquor and cell mass is suspended in 0.2ml once more by in the blue solution of forming of 0.0025% Yi Fansishi that is dissolved among the 1X PBS.

Profile II with Coulter Instruments manufacturing ^TMAnalysis of cells.This device uses the 488nm argon laser, at the 525nm band-pass filter mating plate of FL1, and at the 635nm band-pass filter mating plate of counterstain.In each detected sample, at first analysis contains the sample of negative probe, and sets four fens states so that the cell that falls in upper right 1/4th scopes is less than 0.01%.Under the identical parameter of the negative probe sample of analytic band, analyze the sample that contains positive probe then.Because set four fens states exactly, and two samples have all been done identical processing, write down so be that conduct is positive at upper right 1/4th cell numbers (more than 0.01%) that write down.

Be distributed in two test tubes about 500,000 H9 cells also fixing as stated above.In a copy of it aliquot sample, add the hybridization solution that contains positive probe (28S).And in another part, add and contain the hybridization solution that is equivalent to the onesize negative probe (NR) of listed positive probe in the table 4.Hybridize washing and flow cytometry then.

The following result who uses the flow cytometry method to record is: when using the 28S-25-AL probe, the cell more than 99% is positive; When using the 28S-21-AL probe, the cell of 0.01-99% is positive: when using other probes, positive less than 0.01% cell.In addition, for detecting average LFL1, then obtain result as shown in table 5.

Table 5

Signal (on average)

Length N R 28S Fold Diff.

6 .322 .370 1.1

8 6.4 .441 Neg

10 .422 .3 .70

12 .321 .231 .72

15 .327 .373 1.1

18 .407 .339 .83

21 .281 .616 2.2

25 .3 50.0 168

Embodiment 3

Penetrating toughener and signal toughener

Flow cytometry

Use Coulter Profile II flow cytometer to carry out flow cytometry.When making probe dye with FIFC, the spectral filter of LFL3 is that the long spectral filter by spectral filter and LFL1 of 635nm is the 540bp spectral filter, and excitation wavelength is 488nm, sets the correction parameter of PMT1 and PMT3 as required.Typical useful correction parameter is that PMT1 is located at 1100 when fluorescein is the dyestuff part, and PMT3 is located at 900, and color compensating (PMT1 is 15% PMT3).

Hybridization mixture " HC " is the solution that contains following composition: salmon sperm DNA, 10% Triton X-100,0.4M isothiocyanic acid Guanidinium, 30%(v/v that 5X SSC, 15X Ficoll/PVP, 0.16M sodium phosphate buffer (pH6), 1mg/ml shear) methane amide, 10mM ethylenediamine tetraacetic acid (EDTA) (" EDTA "), 1.5% polyoxyethylene glycol (" PEG "), 25mM DTT(dithiothreitol (DTT)) and 5-10 μ g/ml(mcg/ml) probe.

Hybridization mixture " HC-DMSO " is the solution that contains following component: salmon sperm DNA, 10% Triton X-100,0.4M isothiocyanic acid Guanidinium, 30%(v/v that 5X SSC, 15X Ficoll/PVP, 0.16M sodium phosphate buffer (pH6), 1mg/ml shear) methane amide, 10mM ethylenediamine tetraacetic acid (EDTA) " EDTA ", 1.5% polyoxyethylene glycol " PEG ", 25mM DTT(dithiothreitol (DTT)) 10%(v/v) DMSO and 5-10 μ g/ml probe.Above, 500X Ficoll/PVP is that 5g Ficoll 400 types (molecular weight is 400,000 ficoll) add 5g PVP and are diluted with water to cumulative volume 100ml; 15X Ficol/PVP be 500X Ficoll/PVP water carry out 15/500 the dilution obtain.

Detect in flow cytometer, carrying out fluidic cell, with cell suspension in 1X PBS solution.

The 28S rna probe is special to ribosome-RNA(rRNA), and has the nucleotide sequence of 28S-25-AL as herein described.The NR probe is special to the nitrogen reductase gene that sees in the bacterium (rather than eukaryotic cell), and it has the nucleotide sequence of NR-25-AL described herein.

" slide glass in-situ preparing and hybridization program "

1) with cell suspension in stationary liquid (3 volume ethanol add 1 volumes methanol) and use that the Cytospin device is centrifugal to be transferred on the slide glass.

2) the detection solution (25 μ l) (only contain hybridization miscellany HC or with one or more tested compound as toughener) that will contain dna probe is added on the cell and covered.

3) slide glass was heated 5 minutes down so that the DNA sex change was hybridized in 46 ℃ of insulations then in 30 minutes in 90 ℃.

4), and be used in No. 2 washing solns of 42 ℃ of following equilibrated and wash cell 10 times with washing cell 1 time at No. 1 washing soln of 42 ℃ of following equilibrated.

5) on cell, place substrate solution and (be dissolved in 50% glycerine (v/v) and nuclear staining agent Hoechst(#33258 among the 1X PBS; 1 μ g/ml) and covered.

6) using rhodamine derivative spectral filter (excitation wavelength 567nm, emission wavelength are 584nm) to have Olympus BH 10 microscopicallies of capabilities of fluorescence detection to observe hybridization signal.

" liquid original position cell preparation and hybridization program " (step 1-6):

1. fixed cell in solution F is suspended in cell among the 2X SSC then again.

2. centrifugation goes out cell and is suspended in again to detect in the solution (only contain hybridization mixture HC or merge with one or more tested compounds as toughener) from solution.

When also adding other additional compounds, measure its influence to probe signals intensity.With flow cytometry method analytical data.

Liquid original position cell preparation and crossing scheme are as described below.Used cell is the Hela cell.Used probe is 28S rna probe and NR probe.Each probe has all that (the ammonia hexyl available from Applied Biosystems, Inc.) is connected to FITC part on its 5 ' end by Aminolink cross linker molecule.

The 28S rna probe is the target-specific probe special to ribosome-RNA(rRNA); With the representative of its fluorescence that records from the fluorescence of the probe of the probe of target combination, non-specific binding and from the summation of the autofluorescence of cellular elements.The NR probe is special to the plant nucleic acid order, and in the present embodiment, with its fluorescence that records representative from the fluorescence of the probe of specificity combination and the summation of autofluorescence.In the present embodiment, hybridization mixture adds the upper volume additional compound by 9 volume HC-DMSO and forms.In control sample, replace 1 volume water to replace 1 volume additional compound with 1 volume water.As a result, the concentration of DMSO all is 9%(v/v in all samples).

Table 6

In the hybridization mixture

The ratio of additional compound 28SRNA probe NR probe 28SRNA/NR

Water 6.070 0.137 44

10% pyrrolidone 10.19 0.133 77

10% beta-cyclodextrin 9.593 0.135 71

10% hexamethyldisiloxane 7.426 0.126 59

10% Wickenol 111 8.057 0.140 58

10% propylene glycol 8.227 0.148 56

10% lauryl alcohol 4.804 0.142 34

3.42 ℃ place after 30 minutes down, centrifugation goes out cell from testing liquid, washes cell preheating to 42 ℃ washings.

4. wash cell preheating to 42 ℃ No. 2 washingss then.

5. cell is suspended in again in the 1X PBS solution that contains as 0.002% Trypan Blue of counterstain.

6. make cell pass through the histogram (" counting " is meant cell counting) of flow cytometer and making " counting is to LFL1 ".With the basis of this histogram as definite average LEL1.

Can use probe and the cell (RNA amplification and hybridization back) of embodiment 1, or any enough cells of RNA to be checked has the probe of similar resolving power to carry out following four accidental (a) and (b), (c) of present embodiment, the analysis of (d) (if cell has enough RNA without amplification the time, so also can be carried out these analyses (as referring to (b)) to having.

(a) influence of proof adding alkali (squalane) and other compounds as follows:

In-situ preparing cell slide glass is hybridized then.Hybridization mixture is made up of 8 volume HC-DMSO, 1 volume squalane and 1 volume squalane and other compounds of 1 volume.Other compounds are one of following compounds: lauryl alcohol (alcohol), beta-cyclodextrin (sugar), Wickenol 111 (fatty acid ester), 1,2-propylene glycol (alcohol), pyrrolidone (lactan), hexamethyldisiloxane (organosilane) or oleyl alcohol (alcohol).In the control sample, replace other compounds of 1 volume with 1 volume water.The result be in all samples concentration of DMSO and squalane be respectively 8% and 10%(v/v).With regard to control sample, observe that strength of signal is 2 on the slide glass.Compare with the contrast slide glass, whether be respectively 0.5,1.0,1.5 and 2 times of control sample slide glass and the rank value of estimating every other slide glass is 1,2,3 or 4 according to intensity.

(b) during liquid hybridization is tested in position, except that in detecting solution, adding the DMSO

10% oleic acid 3.643 0.142 26

10% oleyl alcohol 0.731 0.136-

10% different triacontanol 0.611 0.123-

The ratio of 28S/NR is the ratio with 28S rna probe and the observed average LFLI of NR probe.Result shown in " 28S rna probe " and " NR probe " hurdle is respectively with 28S RNA and the observed average LEL1 of NR probe.

These results are the mean value of four independent experiments.Result in the table 6 shows and singly compares with the measured result of 9%DMSO, increased luminance signals when pyrrolidone, beta-cyclodextrin, hexamethyldisiloxane, Wickenol 111 and propylene glycol and 9%DMSO are share.If list is used DMSO, with regard to luminance signals, the 9%th, best or approaching best DMSO concentration.

Use 10% squalane or 10% oleyl alcohol that it is precipitated out from solution, and all produce biphase mixture in both cases.All reduced strength of signal significantly under two kinds of situations of result.

(c) carry out liquid original position cell preparation and to finish hybridization step as follows:

Share on DMSO and the basis of squalane in detection, detect again and further improve reinforced effects with the back with the third compounds to the influence of fluorescent probe signal.

Almost hybridization mixture is all by 9 volume HC-DMSO in both cases, and long-pending squalane of halfbody and the long-pending additional compound of halfbody are formed.Additional compound is one of following compounds: lauryl alcohol (alcohol), beta-cyclodextrin (sugar), Wickenol 111 (fatty acid ester), 1,2-propylene glycol (alcohol), pyrrolidone (lactan), hexamethyldisiloxane (organosilicon) or oleyl alcohol (alcohol).Thereby a kind of situation is a water replaces the additional compound hybridization mixture just to be made up of 9 volume HC-DMSO, 0.5 volume squalane and 0.5 volume water.In control sample, mixture is made up of 9 volume HC-DMSO and 1 volume water.The result has 9%DMSO(v/v in all samples).When having squalane, its ratio is 5%; If any additional compound also is 5%.

The average LFL1 that measures the signal that operational analysis thing RNA molecular specificity probe records is to the ratio of the average LFL1 of the signal that uses the NR probe and record.

(d) when will being included in the stationary liquid as all cpds of signal toughener, rather than be included in be suspended in it in stationary liquid before with in its aaerosol solution, so as to proving the validity of these compounds.In position behind the hybridization step, wash that cell adds the fixed solution of change then and in the fluorescent signal of microscopically observation of cell.The fixed solution of changing comprises 9 volume fixed solutions and 1 volume additional compound, and wherein additional compound is the detected compound that whether has as the ability of signal toughener.Additional compound is selected from water (contrast), and 1,2-propylene glycol, hydroxypropyl cyclodextrin, hexamethyldisiloxane, lauryl alcohol, pyrrolidone, Wickenol 111, oleyl alcohol, squalane and squalene (alkene).Fixed solution is by being added in 0.1%1 in 50% glycerine, 4-pentanoic (anatrophic) and nuclear tinting material Hoechst(#35258; 1 μ g/ml) forms.

Embodiment 4

The example of background depressant

The purpose of present embodiment is to determine whether certain compound has background depressant function, be whether it can reduce by the probe molecule of non-specific binding and the light quantity of auto-fluorescence molecule emission, and do not reduce light quantity equally by the probe molecule emission of specificity combination.

The dyestuff abbreviation title that table 1. is used

Dye item number dyestuff actual name abbreviation title

12 naphthol blue black naphthols B1, B1K.

13 palace fast black WAN palace F-B WAN

20 sulfo group rhodamines, 101 hydrate sulfo group rhodamines 101

Fluorescein isothiocyanate FITC

The NR probe is a part of bonded DNA25 aggressiveness with bacterium nitrogen reductase gene; Its nucleic acid moiety has the nucleotide sequence of probe NR-25-AL described herein.The 28S rna probe is and 28S ribosome-RNA(rRNA) bonded DNA25 aggressiveness that its nucleic acid moiety has the nucleotide sequence of probe 28S-25-AL described herein.Also in the end the stage is connected to an ammonia hexyl joint on 5 ' terminal phosphate synthesising probing needle.Then 5 ' ammonia hexyl oligodeoxynucleotide is coupled to that FITC dye molecule (deriving from Molecular Probes) is gone up and with the HPLC purifying it.

The method described in the embodiment 3 of pressing is used Coulter Profile II flow cytometry.

The composition of hybridization mixture HC is with described in the embodiment 3, but wherein uses 3%TritonX-100(v/v instead) and 5%PEG.

Illuminating colour solution contains following composition: the illuminating colour 0.002%(W/V in 1X PBS).In general, if use illuminating colour and used as the background depressant, then its concentration be 0.0002% and 0.10%(w/v) between.Preferably cell and reduction background compound are incubated 2 minutes to 8 hours down in 20 ℃ to 46 ℃.Some illuminating colour also is to reduce the background compound.Wherein great majority are also as counterstain.

Illuminating colour solution has the composition identical with the mobile damping fluid of FAScan.

The H9 cell is the lymphoma cell line (ATCC No.CRL 8543) that derives from human body.

For carrying out nonspecific binding test, use " NR " probe.

For carrying out specificity, use " 28S " probe in conjunction with test.

When using the NR probe, radiative amount will be the total amount by the light of two light emitted: the probe molecule of non-specific combination and the molecule of autofluorescence.In other words, this radiative amount promptly is a bias light.

When using the 28S probe, radiative amount is the summation of the light of three light emitted: the molecule of the probe of specific combination, the probe of non-specific combination and autofluorescence.In other words, this radiative amount is that target-specific light adds bias light.

Therefore, find a kind of compound that can reduce bias light, will find the compound that maximum A/B ratio is arranged, said here A is the light quantity of being launched when using the 28S probe, and B is the light quantity of launching when using the NR probe.As a criterion, when the compound that does not add as the background depressant, measure the A/B ratio.

Yet it is not enough that maximum A/B ratio is arranged, and in addition, sufficiently high probe specificity light quantity must be arranged also.The amount of the special light of probe promptly is (A-B).As can be seen, when using reduction background compound, the amount of probe specificity light is still the level that can reach suitable.

Experimentize as follows.

1. fixing not infected H9 cell in solution F is suspended among the 2X SSC then again.

2. with cell centrifugal come out from solution, and be suspended in once more among the hybridization mixture HC.With regard to employed probe, the HC mixture is only different with the difference of sample.Used three types probe is: NR probe, HIV probe and 28S rna probe.Each probe all has the fluorescein that is connected on the probe oligonucleotides.

3.42 ℃ down hybridization is after 30 minutes, with 250xg centrifugal 5 minutes, cell separated from hybridization mixture, and respectively washed cell at No. 1 washing soln that preheats 42 ℃.

4. in preheating 42 ℃ No. 2 washing solns, wash cell then.

5. cell is suspended in again 1X PBS solution or contains in the PBS solution of its compound to be tried to be detected (this compound also is counted as illuminating colour in the present embodiment) as the validity of background depressant.

6. use the flow cytometry counting cells, and obtain that an axle is represented illuminating colour fluorescence (LFL2 and LFL3) and the histogram of another axle expression fluorescence probe (LFL1).

What make in the step (6) is " total number is to LFL1 " histogram (" total number " is meant cell count).Based on this histogram, determine whether wait to try compound can be used as effective background depressant.Also make other histograms and FS/SS graphic representation, but not as the basis of determining background reduction effect; Do not provide herein or summarize these figure.

Use sulfo group rhodamine 101 hydrates (as illuminating colour) and NR probe or 28S probe to make a series of total numbers to the histogrammic example of LFT1.It the results are summarized in table 8 and 9.

Table 8: counting is to the result's of LFL1 histogram summary shown in Fig. 1

The average LFL1 of group cell counting cell Pct

1 4917 100.0 0.1560

2 4587 93.3 0.126

3 309 6.3 2.966

4 4 0.1 41.66

Table 9: counting is to the result's of LFL1 histogram summary

The average LFL1 of group cell counting cell Pct

1 5034 100.0 101.0

2 2 0 0.218

3 31 0.6 6.535

4 4999 99.3 103.0

In the table 8 and 9, " Pct cell count " hurdle provides the per-cent that accounts for total cell count; " LFL " representative " Log fluorescence ".

Summed up detected result in the following table to each tested tinting pigment.

Table 10. result's summary

The mean value 28S/NR of each probe

Dye item number illuminating colour NR HIV 28S mean value ratio

12 naphthols B1.B1K. 1.159 1.301 73.43 63.66

13 palace F-B WA. 0.726 1.030 63.76 87.82

14 Trypan Blues 0.266 0.259 77.56 291.6

20 sulfo group rhodamines 101 0.156 0.143 101.0 647.4

PBS phosphate buffered saline (PBS) 64.5 38.73 246.1 3.82

" mean value ratio, 28S/NR " is the ratio of the mean value of NR probe to the mean value of 28S probe.

From the right-hand column (wherein providing the tolerance of above-mentioned A/B ratio) of table 10 as can be seen, all four kinds of tested dyestuffs have all increased the A/B ratio.In addition, the amount of probe specificity light (A-B) is still significantly.Therefore all dyestuffs of listing in the table 4 all can be used as the background depressant.

Embodiment 5

Radical scavenger

The abbreviation of table 11. compound

The compound abbreviation

Vitamin-E (alpha-tocopherol) Vit.E.

2,2-phenylbenzene-1-picrylhydrazyl hydrate 2,2, DIPH

2,2,6,6-tetramethyl piperidine-N-oxygen base Tempo

Fluorescein isothiocyanate FITC

Diethylamine tetraacethyl EDTA

Dimethyl sulfoxide (DMSO) DMSO

Dithiothreitol (DTT) DTT

Polyvinylpyrrolidone PVP

Polyoxyethylene glycol (molecular weight about 4000) PEG4000

Use Coulter Profile II flow cytometry by methods described herein, but it should be noted, carry out using when LFL1 detects 540bp(40) spectral filter, the spectral filter that promptly only allows the light of wavelength 520nm to 560nm to pass through.The spectral filter of LFL3 is the spectral filter that the 635nm wavelength can pass through, and promptly allows the above light of all 635nm wavelength to pass through.

Use following solution in the present embodiment:

Hybridization mixture HC has the composition that this paper has addressed, and has done following change: use 3%Triton X-100(v/v; Tviton X-100 is the alcohol derivate of Soxylat A 25-7, referring to the 1990-91 catalogue of Aldrich Chemical Co.) and 5%PEG 4000.

If add radical scavenger in mixture, its preferred concentration is 0.1% to 10%(v/v).

When use was added with the hybridization mixture of nucleic acid probe, preferred hybridization temperature was 30 ° to 46 ℃; The preferred reaction time is 5 minutes to 16 hours.

The ALEX cell is the human cell line.

The NR probe is the fluorescein-labeled NR-25-AL probe that this paper has addressed.The 28S rna probe is the fluorescein-labelled DNA oligomer special to people 28S RNA nucleotide sequence that this paper has addressed.Two kinds of probes all have the ammonia hexyl joint that is connected on 5 ' terminal phosphate, and this joint is coupled to again on the FITC molecule then.

Carry out the experiment first time as follows:

1. fixed cell in solution F, then with the cell resuspending in 2X SSC.

2. centrifugation goes out cell and it is suspended among the hybridization mixture HC again from solution.Only with regard to existing radical scavenger (if adding really), this HC mixture will change with the change of sample.

3.42 ℃ down hybridization is after 30 minutes, with 250xg centrifugal 5 minutes, isolates cell and wash cell from hybridization mixture in preheating 42 ℃ No. 1 washing soln.

4. in preheating 42 ℃ No. 2 washing solns, wash cell again.

5. cell is suspended in the 1X PBS solution again.

6. counting cells on flow cytometry, and obtain that an axle is represented autofluorescence (LFL3) and the histogram of another axle expression fluorescence probe (LFL1).

What obtain in the step (6) is " total number is to LFL1 " histogram (" total number " is meant cell counting).Whether is the basis of effective autofluorescence depressant with this histogram as definite compound to be checked.Also produced other histogram and FS/SS graphic representation, but not with they bases as definite autofluorescence reduction effect; This paper does not show these figure.

Table 11. uses the average LFL1 and the LFL3 of radical scavenger

The average LFL3 of the average LFL1 of compound that adds

Do not have 7.92 0.22

Vit.E 0.501 0.119

2,2,DIPH 17.27 0.863

Tempo 3.23 0.181

Thiophenol 1.69 0.138

In the table 11, " compound of adding " is to add (class I liquid I as vitamin-E is 5%(v/v) concentration; Solid is the compounds in the test mixture of 5 grams/100ml).

Because of the index that adds the autofluorescence reduction effect that radical scavenger causes is to use the average LFL1 intensity that aforementioned mixture records and uses mixture to add difference between the LFL1 intensity that free scavenging agent records.Another index is to use the average LFL3 intensity that this mixture records and uses difference between the average LFL3 intensity that mixture records with radical scavenger.The result shows that Tempo, thiophenol and vitamin-E are radical scavengers, also is effective autofluorescence depressant during in conjunction with used fluorescent absorption one emission wavelength of present embodiment.On the other hand, the result shows 2, and 2DIPH then can not be used as the autofluorescence absorption agent under these conditions.2,2, DIPH is invalid may not to be because it does not reduce autofluorescence, but because it is the fluorescent chemicals that emission is in the light at the wavelength place that present embodiment monitors.Free radical scavenging agent Vit.K also observes similar situation.

In second experiment, experimental arrangement is identical with first experiment basically, but replaces the ALEX cell with not infected H9 cell, and is added in NR probe in the HC mixture or the concentration of 28S rna probe is 10 μ g/ml.The NR probe is special to the bacterium nitrogen reductase gene that is not present in people's cell.This probe is used as negative control.

The 28S rna probe is sequence-specific to people 28S RNA.

The results are shown in the table 13.

Table 13

Have or not Vit.E LEL1 in the probe HC mixture

NR does not have 13.27

NR has 8.86

28S does not have 251

28S has 231

The result shows, exists vitamin-E can make undesirable background level (NR causes) reduction about 33% in the hybridization mixture, and only causes the signal level reduction by 8% that records with target-specific probe (28S RNA).

Can carry out following one or more changes to the method for embodiment described herein: in 100 μ l mixtures, add i.e. 1 volumetric molar concentration of 5 μ l 1M() DTT and 5 μ l Proteinase K (1mg/ml) solution, and for example 42 ℃ of following hybridizations 5 minutes, hybridized 5 minutes down in 95 ℃ then, hybridized 2 minutes down in 42 ℃ again.

Claims (29)

1, the method for analyte RNA molecule in the detection of biological entity, this method may further comprise the steps:

1) at reverse transcriptase, dna dependent rna polysaccharase, RNaseH with all be to be incubated biological entities in the presence of first primer of DNA oligonucleotide and second primer separately, thereby produce the amplifier molecule that has complementation or be same as the nucleotide sequence of nucleotide sequence in the said analyte RNA molecule

2) between said biological entities middle probe molecule and said amplifier molecule, form crossbred, and

3) probe molecule in the said crossbred of detection,

Wherein first primer comprises the nucleotide sequence of first nucleotide sequence that is complementary to analyte RNA molecule,

Wherein second primer comprises the nucleotide sequence of second nucleotide sequence that is equal to analyte RNA molecule,

On the position between 3 ' end of the wherein said first nucleotide sequence position said second nucleotide sequence and analyte molecule in analyte RNA molecule,

At least one comprises the promotor nucleotide sequence of said polysaccharase in wherein said two primers, and

Its middle probe includes the oligonucleotide that is complementary to the nucleotide sequence of nucleotide sequence in one of said amplifier molecule, and said biological entities is cell or virus.

2, the process of claim 1 wherein that biological entities is a cell.

3, the method for claim 2, wherein cell is the cell that has the abnormal chromosome of being made up of first chromosome segment that connects at junction point and second chromosome segment, said first and second fragments do not link together in normal cell, and analyte RNA molecule wherein is a RNA molecule of crossing over the transposition juncture.

4, the method for claim 2, wherein first primer comprises the promotor nucleotide sequence and second primer comprises a promotor nucleotide sequence.

5, the method for claim 3, wherein primer or probe, or they both are the molecules of crossing over the juncture with regard to cell RNA molecule or cloning RNA molecule.

6, the method for claim 5 is wherein crossed over the primer at transposition juncture or probe length between 20 and 50 Nucleotide.

7, the method for claim 6, its middle probe or primer with it complementary cross over the juncture segmental half be on a side that contains this segmental transposition juncture, and wherein said segmental second half is on the opposite side at this juncture.

8, the method for claim 6, its middle probe are to cross over the probe at transposition juncture.

9, the method for claim 7, its middle probe are to cross over the probe at transposition juncture.

10, the method for claim 3, wherein the transposition juncture of analyte RNA molecule is in said analyte molecule, is complementary to the nucleotide sequence of part or all of first primer and is equal between the nucleotide sequence of part or all of second primer.

11, the method for claim 2, its middle probe comprise report thing group, and this report thing group is the fluorescence part and is based on by the energy light of said part emission and can detects.

12, the method for claim 11, wherein step (3) be used in the solution and not the cell on slide glass finish.

13, the method for claim 2, wherein step (2) is to carry out in comprising the solution that is selected from the mixture in dimethyl sulfoxide (DMSO) (DMSO), alcohol, aliphatic alkanes, alkene, cyclodextrin, fatty acid ester, acid amides or lactan and this group of organosilane.

14, the method for claim 13, the detection solution that wherein is used for step (2) comprises nucleic acid probe and DMSO(2-20% and one or more and is selected from alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%) and formula (SiR ₅R ₆R ₇) N(SiR ₈R ₉R ₁₀), (SiR ₅R ₆R ₇)-(SiR ₈R ₉R ₁₀), (SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) or (SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) compound in this group, and wherein DMSO is not more than the 30%(v/v that detects solution with the volume that is selected from the merging of the compound in this group).

15, the method for claim 13, the detection solution that wherein is used for step (2) comprises nucleic acid probe and DMSO(2-20%) and one or more be selected from alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%), formula R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%) and formula (SiR ₅R ₆R ₇) N(SiR ₈R ₉R ₁₀), (SiR ₅R ₆R ₇)-(SiR ₈R ₉R ₁₀), (SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) or (SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) compound in this group of organosilane (2-20%), and wherein DMSO is no more than the 30%(v/v that detects solution with the volume that is selected from the merging of the compound in this group).

16, the method for claim 13 wherein also contains a kind of alkene or a kind of alkane and at least a other compounds that are selected from this group except that DMSO./

17, the method for claim 2, wherein step (3) comprises 3A as described below, 3B and these three steps of 3C, and finishes 3A before step 3B, and finishes 3B simultaneously before step 3C or with step 3C:

(3A) from detect solution, remove cell,

(3B) in the solution of suspension cell, add signal and strengthen compound,

(3C) detect signal by with target bonded probe molecule directly or with practicing midwifery living photon,

The signal toughener is selected from alcohol, aliphatic alkanes, sugar, fatty acid ester, acid amides or lactan and this group compound of organosilane.

18, the method for claim 3, wherein step 3 comprises 3A as described below, 3B and these three steps of 3C at least, wherein 3A carried out before 3B, and step 3B finishes simultaneously with step 3C before step 3C or basically:

(3A) from the solution of completing steps (2), remove cell,

(3B) make cellular exposure in the light that this absorbing wavelength of fluorescent probe molecule is arranged, and

(3C) measure the light quantity of launching with the emission wavelength of fluorescent probe;

Wherein beginning step (1) afterwards with stop step (3C) time before, reduce the background compound and be present in the solution that wherein is suspended with cell;

Reduce the background compound and comprise the photoabsorption part that different structure is partly arranged with the fluorescence dye of fluorescent probe;

Reduce the background compound and have this partly overlapping absorbing wavelength scope (it absorbs the light of this wavelength region when this method is carried out) with the emission wavelength ranges (probe wavelength of light emitted scope) of fluorescent probe, the wherein light quantity of this part emission wavelength ranges of detection fluorescent probe in step (3C).

19, the method for claim 18, wherein step (3B) and (3C) to reduce the background compound be to be suspended with therein in the solution of cell.

20, the method for claim 2, wherein fluorescence report thing group is used for detecting the probe molecule of the crossbred that forms during the step (3), and radical scavenger is present in and is used in the reaction mixture of one or more steps in completing steps (1), (2) and (3).

21, the method for claim 20, wherein radical scavenger is present in and is used in the reaction mixture of completing steps (2).

22, the method for claim 2, wherein radical scavenger is selected from vitamin-E, thiophenol and 2,2,6, in 6-tetramethyl piperidine-this group of N-oxygen base.

23, the method for claim 2, wherein aromatics report thing group is the part of probe molecule during step (2), and before the analog of cell with report thing group is incubated at completing steps (3).

24, the method for claim 23, wherein analogue is present in the same solution that is used for making the hybridization of amplifier molecule in probe molecule and the cell during step (2), and step (3) is to finish with a kind of method of reporting the thing group but not detecting analog compounds that will detect in addition.

25, the method for claim 2, its middle probe comprise sub-thread nucleic acid moiety and great majority reports thing parts, and each report thing part is covalently bound to middle mesic atom by a shank like this, and the latter then is connected between the nucleosides of nucleoside moiety on the phosphorus atom.

26, comprise the medicine box that reverse transcriptase, RNA polymerase and RNAse H and being used to finishes the instrument of 3SR reaction in.

27, the method for claim 1, its middle probe comprises report thing group, this report thing group is fluorescence part and is can be based on being detected by the energy light of said part emission, and wherein step (3) comprises with cell in the solution rather than on slide glass and carries out fluoroscopic examination.

28, the method for claim 8, its middle probe comprises it being to be the fluorescence part and the report thing group that can be detected based on the energy light by said part emission, and wherein step (3) comprises with the cell in the solution rather than on slide glass and carries out fluoroscopic examination.

29, the method for claim 9, its middle probe comprises it being to be fluorescence part and can be based on the report thing group that is detected by the luminous energy light of said part, and wherein step (3) comprises with the cell in the solution rather than on slide glass and carries out fluoroscopic examination.