CN1084219A - The detection of nucleic acid - Google Patents

Abstract

The invention discloses and improve nucleic acid hybridization, the method and composition of the speed of in situ hybridization and/or susceptibility particularly, comprise penetrating toughener, be used to strengthen the signal toughener of fluorescent probe signal, the background depressant, have the probe of a plurality of report thing groups and at the probe populations of two target chains.

Description

The detection of nucleic acid

The present invention relates to detect nucleic acid by nucleic acid probe.

Use specific dna probe, detect the cell and the viral nucleic acid molecule of indication infection other diseases and genetic disorder by the hybridization of probe and related nucleic acid molecule reaction.A useful especially method is to use such hybridization in position, and promptly wherein analyzed cell or virus are kept perfectly, and hybridization occurs in the cell.But determined nucleic acid bulk of molecule or copy number are very little as a rule.

The present invention uses one or more following inventions to improve the speed and/or the susceptibility of hybridizing method (particularly original position): the background depressant during the fluoroscopic examination of the penetration enhancers during the hybridization, the signal toughener that strengthens the fluorescent probe signal, probe, the radical scavenger that reduces background fluorescence, many reports thing group of each probe, reduce the analogue of the reporter group of hybridization background, and probe is at the application of bifilar target.

" analyte molecule " is meant the molecule that designed detection method desire detects.

" amplifier molecule " is meant the nucleic acid molecule that uses amplification method to produce.It has the nucleotide sequence that is complementary to all or part of analyte molecule or has the nucleotide sequence that is equal to all or part of analyte molecule.

" probe " is meant the molecule that comprises oligonucleotide and usually report the thing part in addition, reports that wherein thing is detectable, and oligonucleotide can with making nucleic acid molecular hybridization.Report thing part can be radioactivity material, fluorescent material, chemoluminescence agent, enzyme (as other enzymes of alkaline phosphatase, sour jujube root peroxidase or catalysis color reaction) but or can be directly connected to test section such as radioactivity thing, fluorescent substance, the ligand specificity on chemoluminescence agent or the enzyme links molecule, and (for example the part (biological example element) of specific reaction takes place in streptavidin (streptavidin).

If define the relation of two sequences by " Watson-Crick " base pairing rules, then first nucleotide sequence is complementary to second nucleotide sequence: guanine (G) is arranged in the sequence, cytosine(Cyt) (C) is just arranged in another sequence, have VITAMIN B4 (A) then in another sequence thymus pyrimidine (T) or urine purine (U) to be arranged just in the sequence.

" crossbred " is meant bifilar (or part the is bifilar) molecule that is formed by two nucleic acid molecule, and one of them molecule has the nucleotide sequence that is complementary to the sequence in another molecule.

If two nucleotide sequences are identical, be dna sequence dna and another sequence is the RNA sequence perhaps except a sequence, wherein the uridylic in the RNA sequence has replaced the outer and sequence of thymus pyrimidine when identical, thinks that then first nucleotide sequence is second nucleotide sequence " equivalent ".

When two chromosome segments formed a new karyomit(e) because of transposition is bonded together, then this point that is connected together of two fragments was " chromosome translocation juncture ".

" nucleotide sequence " this term also comprises the sequence that some phosphorus atom (as sulphur) is in addition wherein arranged on the position that has phosphorus under some normal circumstances.

" primer " is meant the oligonucleotide that can extend into longer molecule by enzyme.

" original position " is one and is used for describing the term that betides complete basically cell or the interior process of virus; Cell or virus usually are with many but be not that name crosslinked of all this paper or precipitation fixing agent are handled.

This paper said " biological entities " is phalangeal cell or virus.

Probe at bifilar target

For any sub-thread molecule to, if an intramolecularly has the nucleotide sequence that is complementary to nucleotide sequence in second molecule, and these two sequences have N Nucleotide long (total length of each molecule can greater than N), and then two molecules only form crossbred when N is bigger than a certain threshold value.Threshold value partly depends on hybridization conditions (temperature, selected solvent etc.), depends on partly that again the Nucleotide of complementary sequence is formed.

In the experimental example of being lifted from the following example, threshold value is between 12 and 23 as can be seen.The length that makes probe molecule in these embodiments is about 24 Nucleotide, and the right N of any probe molecule is surpassed under 12 the situation, can obtain the effective probe populations with bifilar target sequence hybridization.Because can obtain the about twice signal with one probe gained, this probe group is effective.

Can change the threshold value of N by the base sequence that changes hybridization conditions and/or probe molecule.This point can be confirmed from the given embodiment of this paper.Yet, according to the normal experiment that is undertaken by following principle, can therefrom determine the threshold value under any one group of hybridization conditions, and and then finish method of the present invention.

On the one hand, the present invention relates to detect the method for bifilar Nucleotide target, this method may further comprise the steps:

(1) separate be enough to make each all with the target nucleotide chain of the nucleic acid probe hybridization of complementary nucleotide sequence;

(2) abundant isolating target chain and nucleic acid probe colony are incubated altogether, said probe populations comprises that nucleotide sequence is complementary to the molecule of a target chain and the molecule that nucleotide sequence is complementary to another target chain, and

(3) detect the nucleic acid probe molecules of hybridizing with target molecule;

The nucleic acid probe that so just can allow each target chain and nucleotide sequence to be complementary to this target chain forms completing steps (2) under the condition of crossbred;

Just existing for the nucleotide sequence of each nucleic acid probe like this has a total complementary sequence in the target chain;

Each nucleic acid probe molecules lists with at least one other nucleic acid probe molecules partly complementary at nucleotides sequence like this;

The nucleotide sequence that does not have two nucleic acid probe molecules like this is complete complementary mutually.

List when being complementary to another nucleic acid probe molecules at nucleotides sequence when the part of a nucleic acid probe molecules like this, this partly has the length that seems too short with another nucleic acid probe molecules hybridization under the condition of step (2) so.

The sequence that some phosphorus atom (as sulphur) is in addition arranged on some position that should have phosphorus in the Nucleotide under the normal circumstances desired to be included in term " nucleotide sequence ".In this case, people we can say that two molecules are complementary with regard to nucleotide sequence, because relevant nucleotide sequence is a complementary, can be complementary with regard to nucleotide sequence briefly perhaps.

General available detectable marker such as radioactivity thing are (as using ³²P), dye molecule such as fluorescein, the part that maybe can enter chemiluminescence reaction is come the label probe molecule.

In a general scheme of present method, two target chains are positioned at cell or the virus as biological entities.Cell or virus can be suspended in the solution and not be fixed on the solid phase carrier.On the other hand, also can be on solid phase carrier with cell or viropexis.Cell or virus can be the parts of tissue slice (Histological section).

The cell that contains target nucleic acid molecule can be the cell of eukaryotic cell (as people's cell), prokaryotic cell prokaryocyte (as bacterium), vegetable cell or any other type.They can be simple eukaryotic cell such as yeast, or by the eukaryote of complexity as obtaining in the human body.

The target chain of nucleic acid can be in the virus of non-coating or in the virus (having non-film of sealing such as lipoprotein membrane) of coating.

In a scheme of present method, the most molecules in the probe populations directly or by the cross-linking agent molecule are connected on the luminescent dye molecule separately.

In the method, two nucleic acid that the target chain can be a purifying.It may extract from virus, cell or multicellular organisms.

In step (2), two target chains can be fixed on the solid phase carrier (as nitrocellulose filter paper or nylon membrane).In addition, they also can be in solution and be not fixed on the solid phase carrier.

In the method, the target chain can be the DNA chain.If the target chain that obtains from virus (for example human immunodeficiency virus) also can be RNA, the complementary RNA length that be complementary to another probe molecule this moment is not less than about 12 Nucleotide, but is not more than about 20 Nucleotide.In the method in the particularly preferred scheme, be about 12 Nucleotide with the length of another this part of probe molecule complementary probe molecule.

In the specific embodiments of aforesaid method, bifilar target molecule has the first target chain and the second target chain, and wherein the nucleotide sequence probe molecule that is complementary to article one target chain has detectable label, is different from the detectable label on the probe molecule that is complementary to second target chain on its detectable label structure.For example, the detectable label that nucleotide sequence is complementary on the probe molecule of article one target chain can be a fluorescence dye, and the detectable label that is complementary on the probe molecule of second target chain then also can be a fluorescence dye.In a particular, wherein bifilar target is the DNA target, and the probe molecule nucleotide sequence that nucleotide sequence is complementary to first strand of target chain also is complementary to the cell RNA molecule.A useful example of back one specified scheme is that distrand DNA viral genome (or the reverse transcription enzyme dna of rna virus cdna group copy) possible be arranged in useful target cell.If really there is such genome to exist, having so maybe to have the RNA that transcribes from this genome to exist.From clinical angle, understand not only whether the existence of DNA genome is useful, and understand whether genomic expression is that mRNA or genomic other RNA copy also are useful clinically.If there is not virus mRNA (or other RNA) to exist, then the nucleic acid amount that is gone out by the probe in detecting at antisense strand will equal the nucleic acid amount that gone out by the probe in detecting at sense strand.If also there is virus mRNA, then the nucleic acid amount that is gone out by the probe in detecting at meaningful DNA chain will be above the nucleic acid amount that is gone out by the probe in detecting at anti-meaning DNA chain.This unnecessary amount is owing to have mRNA.In fact calibrate probe at known quantity viral RNA and viral DNA, make that the fluorescence volume that is provided by specified rate hybridization probe is known, then can calculate the viral RNA that is present in the test sample and the amount (total mass) of viral DNA according to its result, and consider the molecular weight of RNA and DNA target, calculate the copy number of RNA molecule copy number and viral DNA in every part of sample and each cell thereof.

If using the cell that the 30mers of 4 fluorine is respectively arranged and be used on the slide in embodiment 4 and 7 strategies of being followed hybridizes, and use enough 30mers clad target two strandss, even then target sequence be as short as 750 base pairs and with the situation of microscope with visual inspection fluorescence under, or under the situation that target sequence is short to 75 to 150 base pairs and uses the image analysis system to detect, can both detect the single copy of the target in the individual cells.

Bifilar target can be cell DNA, cell RNA, viral DNA or viral RNA.

Except the whole bag of tricks of the present invention, this paper also discloses and has comprised all specific and nucleic acid probe colony application in these methods preferred embodiment.

Related invention is the probe populations that is used for the invention described above method.An example is a nucleic acid probe colony, wherein

1). the length of each probe molecule between about 15 to 100 Nucleotide,

2). there is not complete and another probe complementation of nucleotide sequence of probe molecule, and

3). each probe molecule lists at nucleotides sequence at least in part and is complementary at least one other probe molecule.

Penetrating toughener and signal toughener

One aspect of the present invention relates to the method that penetrating toughener is modified target molecule in the detection of biological entity (cell or virus), and this method may further comprise the steps:

(1) biological entities is contacted with the testing liquid that contains probe molecule, thereby make probe molecule combine with target molecule, and

(2) detection probes molecule after it is attached on the target molecule,

Said testing liquid contains probe molecule and is selected from dimethyl sulfoxide (DMSO) (" DMSO ") alcohol, aliphatic alkanes, alkene, cyclodextrin, fatty acid ester, acid amides or lactan.And this compounds of organosilane.Said probe molecule is nucleic acid probe or antibody probe.

If the compound in will organizing is added in the testing liquid, strengthen last observed signal greatly, this fact shows that such compound promptly is penetrating toughener.Based on this point, method mentioned above is called " penetrating toughener is modified " method.This title is used for itself and " the signal toughener is modified " method that describes below are distinguished, back one method, being remove cell or virus back adding enhancing compound from testing liquid, specifically is to add to strengthen compound during the final step of this detection method is fluoroscopic examination.

In the preferred embodiment of the method that penetrating toughener is modified, testing liquid contains nucleic acid probe and DMSO(2-20%) and one or more be selected from compound in following one group: alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%), formula R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%), and formula (SiR ₅R ₆R ₇) N(SiR ₈R ₉R ₁₀),

（SiR ₅R ₆R ₇）-（SiR ₈R ₉R ₁₀）、

(SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) or

(SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) organosilane (2-20%), and DMSO is no more than testing liquid 30%(V/V with the compound merging volume that is selected from this group).

Association schemes of the method that relevant penetrating toughener is modified, testing liquid contains nucleic acid probe and DMSO(2-20%) and one or more be selected from following one group compound: alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%), formula R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%), and formula (SiR ₅R ₆R ₇) N(SiR ₈R ₉R ₁₀),

（SiR ₅R ₆R ₇）-（SiR ₈R ₉R ₁₀）、

(SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) or

(SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) organosilane (2-20%), DMSO and the compound merging volume that is selected from this group are no more than testing liquid 30%(V/V).

In the method that the penetrating toughener of another change is modified, except DMSO, also have alkene or preferred alkane, and at least a other compounds that are selected from this group.Preferred construction is a preferred structure as indicated above.

In the particular of the method that penetrating toughener is modified, testing liquid contains the 10% Triton X-100(V/V that has an appointment).

Above each specific testing liquid also be an invention.

In a particular of the method that penetrating toughener is modified, be DMSO from the compound of this group selection, and the volume of DMSO is the 2-20%(V/V of testing liquid); Particularly preferred DMSO volume is the 10%(V/V of about testing liquid).Compound concentration preferably remains on enough low level, and they just can not be precipitated out from solution like this, and does not also have the throw out of other compounds in testing liquid.When with 10% or greater concn add fashionable, alkane particularly on squalane and the structure similarly or greater than the alkane of squalane, and alcohol particularly on oleyl alcohol and the structure similarly or greater than the alcohol of oleyl alcohol, according to the composition of other existence, and may partly from detect solution, be precipitated out.

Preferred compound comprises squalane, dodecanol, beta-cyclodextrin, Wickenol 111,1,2-propylene glycol, hexamethyldisiloxane, and oleyl alcohol, pyrrolidone (pyrrolidinone) and squalane.Preferred combination is that about 10%DMSO adds about 10% pyrrolidone.Another preferably makes up is that about 10%DMSO adds about 5% squalane and 5% pyrrolidone.

Detect the penetrating toughener modifying method of target molecule, a different embodiment is arranged, wherein cell (as immobilized cell) is prepared to at methods for cell expansion such as polymerase chain reaction method (PCR, referring to PCR Protocols:A guide to Methods and Applications, M.A.Innis et al., Eds., Academic Press, San Diego, California), to be transcribed into the amplification system (TAS on basis; Kwoh, D.Y.et al., Proc.Natl.Acad.Sci.USA, 86: 1173,1989), 3SR(Guatelli, J.C.et al., Proc.Natl.Acad.Sci.USA, 87: 1874,1990), ligation amplification reaction/to be connected to the amplification system (LAR/LAS on basis; Barringer, K.J.et al., Gene 89: 117,1990) and the rna replicon system (as the QB system; Lizardi, P.M.et al., Bio/Technology, 6,1197,1988) in sedimentary enzyme be easier to infiltration.

Used enzyme is respectively RNA polymerase (as the T7 RNA polymerase) and the reverse transcriptase (as the avian meloblastosis virus reverse transcriptase) in archaeal dna polymerase (particularly Taq polysaccharase), TAS and the 3SR system in the PCR method in these amplified reactions, RNAase H in the 3SR system, the rna replicon enzyme in dna ligase in the LAR/LAS system (as the E.coli dna ligase) and the rna replicon system (as RNA phage Q β replicative enzyme).

For this reason, be the method that comprises the steps as one of penetrating toughener modifying method different embodiment:

(1) biological entities is contacted with the testing liquid that contains the enzyme molecule, so that the enzyme molecule is attached on the target molecule, and

(2) make enzymic catalytic reaction,

Said testing liquid comprises enzyme and is selected from following one group compound: aliphatic alkanes, alkene, cyclodextrin, fatty acid ester, acid amides or lactan, and organosilane,

Said enzyme is selected from this group enzyme of archaeal dna polymerase, RNA polymerase, reverse transcriptase, RNase H, dna ligase and rna replicon enzyme.

Said biological entities is cell or virus.

In another scheme, the present invention relates to the method that the signal toughener is modified, this method may further comprise the steps:

(1) biological entities is contacted with the testing liquid that contains probe molecule, so that probe molecule is attached on the target molecule,

(2) from testing liquid, remove biological entities,

(3) signal is strengthened compound and has added and wherein be suspended with in the solution of biological entities,

(4) detect the signal photon that directly or indirectly produces by probe molecule in conjunction with target,

Said signal strengthens compound and is selected from alcohol, aliphatic alkanes, sugar, fatty acid ester, acid amides or lactan, and this compounds of organosilane.

The photon of partly being launched by the fluorescence of probe molecule is considered to the quantum that directly produced by the probe molecule in conjunction with target.The photon of launching as the result of the interior chemical bond of reporter group in the cracking chemiluminescent groups (as different luminol,3-aminophthalic acid cyclic hydrazide) also is counted as by the direct photon of emission of reporter group.As the result of the radiant of radioactivity group emission, and be considered to the photon that produces indirectly by reporter group by the photon that scintillation solution is launched.

Be easy to act as most when carrying out signal detection the signal toughener is joined (" detection solution ") in the solution that is suspended with cell, promptly during step (4).

If compound is added in the detection solution, can strengthen the said compound of this true expression of last observed signal greatly promptly is the signal toughener.

In the preferred embodiment of signal toughener modifying method, detection solution comprises one or more and is selected from alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%), formula R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%) and formula R ₅SiOSiR ₆This compounds of organosilane (2-20%), and DMSO and the compound that is selected from this group merge volume and are no more than testing liquid 30%(V/V).

Preferred compound comprises squalane, beta-cyclodextrin, hexamethyldisiloxane and oleyl alcohol, pyrrolidone, squalane, particularly Wickenol 111,1,2-propylene glycol and dodecanol.The signal that uses these preferred compounds that target is produced increases up to about 3 to 4 times background signal.Combination is that about 10%DMSO adds about 10% pyrrolidone preferably.Another makes up preferably is that about 10%DMSO adds 5% squalane and 5% pyrrolidone.

The use of symbol

Symbol R ₁(COO) R ₂Representative has the compound of following structural:

R ₃(NH(CO) R ₄Representative has the compound of following structural:

(SiR ₅R ₆R ₇) N(SiE ₈R ₉R ₁₀) representative has the compound of following structural:

(SiR ₅R ₆R ₇)-(SiR ₈R ₉R ₁₀) representative has the compound of following structural:

(SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) representative has the compound of following structural:

(SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) representative has the compound of following structural:

Therefore, the medicine box that for example this designs on the one hand according to the present invention should comprise probe molecule and the one group of compound that is selected from dimethyl sulfoxide (DMSO) (DMSO), alcohol, aliphatic alkanes, cyclodextrin, fatty acid ester, acid amides or lactan and organosilane.In addition, for example another medicine box comprises probe molecule and contains one or more and be selected from DMSO, alcohol, aliphatic alkanes, cyclodextrin, fatty acid ester, acid amides or lactan, and the solution of one group of compound of organosilane, wherein the cumulative volume of compound is no more than the 20%(V/V of solution).

At preceding method, in solution and the medicine box, R ₁, R ₂, R ₃, R ₄, R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Has the paraffinic hydrocarbons structure.

R ₁And R ₂But covalent attachment forms ring structure.

R ₃And R ₄But covalent attachment forms ring structure.

In preceding method, the percentage ratio that provides in the bracket behind compound is the compound concentrations with the per-cent that accounts for testing liquid (V/V) expression.

Further preferred alcohols has 2 to 40 carbon atoms; Aliphatic alkanes has 10 to 60 carbon atoms; Alkene has 10 to 60 carbon atoms; R ₁And R ₂Add has 3 to 20 carbon atoms together, and if R ₁And R ₂Covalent attachment does not form ring, then R ₁And R ₂At least 1 carbon atom is respectively arranged; R ₃Add R ₄2 to 20 carbon atoms are arranged, if R ₃And R ₄Covalent attachment does not form ring, then R ₃And R ₄At least 1 carbon atom is respectively arranged; And R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀At least 1 carbon atom is respectively arranged, such six alkyl carbon structure R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Have together and be no more than 20 carbon atoms.

In preferable methods embodiment more, alcohol has 3 to 30 carbon atoms, and aliphatic alkanes has 20 to 40 carbon atoms, R ₁Add R ₂3 to 10 carbon atoms are arranged together, and R wherein ₁And R ₂When not being covalent attachment one-tenth ring, R ₁And R ₂Each and at least 3 carbon atoms;

R ₃And R ₄Add 3 to 10 carbon atoms, wherein R are arranged together ₃And R ₄When not being covalent attachment one-tenth ring, R ₃And R ₄At least 1 carbon atom is respectively arranged; And R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀At least 1 carbon atom is respectively arranged, six alkyl carbon structure R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Have together and be no more than 10 carbon atoms.

As the preferred alkenes of penetrating toughener be wherein carbon-to-carbon double bond to the ratio of carbon-to-carbon singly-bound less than 1 to 3 alkene.Most preferred ratio is less than 1: 10.

Reduce the compound of background

Total aspect the present invention relates to a kind of analytical procedure, and the number that promptly utilizes the probe molecule combine with biological entities (being cell or virus) is as the hit tolerance of molecule number of this entity, and this method comprises the steps:

(1) biological entities fluorescent probe in solution is incubated,

(2) from solution, remove biological entities,

(3) make biological entities also to the light exposure of the absorbing wavelength of fluorescent probe

(4) measure the light quantity that launch in fluorescent probe emission wavelength place;

Wherein afterwards and the time of step (4) before stopping, be suspended with to have in the solution of biological entities and reduce the background compound at completing steps (1);

Said reduction background compound comprises and has the photoabsorption part that structure is different from the fluorescence dye part of fluorescent probe;

The absorbing wavelength scope that said reduction background compound has (when detecting in this wavelength region its absorb light) comprises the emission wavelength ranges (by probe wavelength of light emitted scope) of fluorescent probe, measures the light quantity of this wavelength region in step (4).

Reduce the background compound preferably in step (3) and (4) in the used solution that is suspended with cell (or viral).For making light-absorbing compound become effective background depressant with regard to a wavelength region, its molar average optical extinction coefficient in this scope better be scope be 520nm to 560nm Trypan Blue the molar average optical extinction coefficient at least 2%; Being more preferably molar extinction coefficient in this scope is equivalent at 10% of the molar average optical extinction coefficient of 520nm to 560 Trypan Blue at least.

Because many cell fluorescence detection methods are carried out in promptly about 400nm to the 660nm scope of visible light, so effective background depressant is valuable especially in this wavelength region.But the cell fluorescence that has detects and need not carry out in visible-range, therefore also can use the background depressant that absorption is arranged in 250 to 1000nm scopes under specific circumstances.In fact principle of the present invention can be applicable to use any wavelength of cell fluorescence detector detection.

Said herein " light " is meant observer or the detected light of photographic camera by wandering cells counter or use fluorescent microscope.For this reason, should be visible light under normal circumstances, but for special detection, cell counter or microscope change into detected energy greater than or be lower than the photon of visible light, this photon also is counted as " light " for this purpose.

Partly have the structure different because reduce the photoabsorption of background compound with the fluorescence dye part of fluorescent probe, so under the normal circumstances desired characteristic should be arranged, if promptly it launches light (being that it is a kind of fluorescent chemicals) really, then will have and be different from fluorescence emmission spectrum partly (promptly for the specified rate of absorbed setted wavelength light, as the function of wavelength, radiative intensity is with different).

Suppose that embodiment of the present invention especially effectively is part and is attached at least on some identical non-specific target (as probe institute bonded) because reduce the background compound, and, will absorb the light of launching by probe so reduce the background compound because reduction background compound and probe are to be in very close position.In addition, reduce the background compound and will absorb the light of launching by the autofluorescence of non-probe molecule in the cell.After the light that absorbs by the probe of non-specific combination or auto-fluorescence molecule emission, reducing the background compound can himself wavelength of transmitted light emission light.And less by reducing the degree that the background compound absorbs, thereby improved the overall sensitivity of this analytical procedure by the light of specificity bonded probe molecule emission.

Be preferably in 45 minutes that add to reduce after the background agent and detect fluorescence; If but the background depressant is in the solution that uses in step (3) and (4), can wait until that then as many as carried out fluoroscopic examination in 24 hours.

In of the present invention one special preferred version, this method also is included between above-mentioned steps (2) and (3) and adds washing step.Can be with cell or virus centrifugal come out from their solution of suspending, then with its resuspending in washing soln, go out washing soln with cell or virus are centrifugal then.Washing soln does not normally have probe solution, wherein can have not reduce the background compound yet.

Cell should keep the sufficiently long time in containing the no probe solution that reduces the background compound, to make it to absorb reduction background compound.For this purpose, generally be to keep 5 minutes, but can there be very wide mobility scale this time.

Probe will comprise fluorescence dye.It also can comprise sub-thread nucleic acid (DNA or the RNA) part that is covalently bound on the dyestuff, and partly (moiety) is the part of molecule.For example, the probe portion by the nucleic acid contribution is called nucleic acid moiety; Part by the fluorescence dye contribution is called the fluorescence dye part.Can be undertaken covalently boundly by joint, wherein dyestuff and nucleic acid molecule (or antibody) are connected on the linkers in different loci.

The emission maximum and the absorbing wavelength data (as referring to Merck Index or Aldrich Chemical Company, the catalogue of Milwaukee Wisconsin) of many other light-absorbing compounds of dye well are disclosed.These Notes of Key Datas (but not determining) are suitable for any compound.The scanning luminoscope will provide complete emission or absorption spectrum.Some reduction background compounds of some probe dye have been listed below.With regard to given probe dye, relatively easily test out the effect that reduces the background compound.

Usually the fluorescein as the fluorescent probe dyestuff has maximum absorption wavelength at about 488nm place, and at about 525nm place maximum emission wavelength is arranged.

The absorb light compound that can be used as good background depressant comprises the azoic dyestuff derivative, and it has the polyaromatic conjugate moiety, and one or more polar groups such as nitro (NO are arranged on this part ₂), alkylsulfonyl (SO ₃) or amino (NH ₂).Because their trends are attached on the same protein and film as non-specific combination probe.

In many probe dye, be applicable to that of the present invention a few is fluorescein, FITC, texas Red, tonka bean camphor, rhodamine, phycoerythrobilin and Perci-P.

Some the reduction background compound that uses with probe dye fluorescein (or fluorescein isothiocyanate (FITC)) is azocarmine B, azogeramine 14, Yi Fansishi indigo plant, the hard black Wan in imperial palace, Trypan Blue, naphthol blue black and sulfo-rhodamine 101

（Sulforhodamine 101）。

Some the reduction background compound that share with the probe dye texas Red is the hard black WAN in naphthol blue black and palace.For the probe dye beyond the fluorescein, useful reduction background compound can be different from the reduction background compound that the probe with fluorescein or FITC mark share.Using fluorimetric detector, in the emission wavelength ranges of the probe dye that fluorescent microscope or wandering cells counter detect, preferably reduce molar average optical extinction coefficient that the background compound has and be the 2%(at least of the molar average optical extinction coefficient of Trypan Blue in 520nm to 560nm scope more preferably 10%).

For any dye fluorescent probe, there is chemical compound lot to can be used as the background depressant.In general, the concentration of used background depressant can 0.0002% and 0.10%(W/V) between.

Radical scavenger is as the background depressant

Total aspect, the invention provides can detection of biological entity (cell or virus) in or the fluorescence detection of the target molecule on it, this method may further comprise the steps:

(1) make biological entities with comprise can with said biological entities in or the solution of the fluorescent probe of target molecule combination on it contact, said contact is finished in a kind of fluorescent probe and said target molecule bonded mode of making, thereby make this probe become probe in conjunction with biological entities

(2) biological entities is contacted with the solution that contains radical scavenger,

(3) make the light that absorbs the fluorescent absorption wavelength of said probe in conjunction with biological entities in conjunction with the probe of biological entities, and

(4) detect the light of the fluorescent emission wavelength of said probe in conjunction with biological entities;

Wherein step (1) is in step (2) before, and step (2) or takes place during the step (2) afterwards.

If fluorescent probe and radical scavenger in same solution, think then that step (1) and (2) are simultaneous.

Better carry out step (1) and (2) simultaneously by in same solution, comprising fluorescent probe and free group scavenging agent.

During step (4), preferably select suitable radical scavenger to measure this conditional request with the reduction that adapts to the amount that makes by the light of scavenging agent emission and be no more than the autofluorescence that scavenging agent causes.Can be by once not adding scavenging agent, whether once adding twice such testing process of scavenging agent (in both cases, can detect in without probe), to detect certain scavenging agent suitable to given fluorescent absorption and fluorescent emission wavelength condition concurrent.

The free group scavenging agent comprises following four compounds:

1) hydrogen donor compound better is to have the thiol group particularly to be connected to the compound of the thiol group on the aromatic group, as thiophenol.

2) not hydrogen donor but the compound of the radical that can combine with other radicals is arranged.Example comprises N-hydroxy derivatives such as dyestuff Tempo, hydrazine derivative and azo derivative, is connected on another nitrogen-atoms by two keys in this azo-compound and the nitrogen that is connected on the carbon atom by singly-bound carries radical.These compounds preferably have a kind of like this structure: it can cause sterically hindered, avoids it to react to each other, and saves the trouble of having to remove radical.

3) contraposition hydroxy aromatic compound.Vitamin-E (preferred scavenging agent) is this compounds.

4) compound of unsaturated carbon atom (koelch group) is arranged.

Other people have identified many radical scavengers that comprise above-mentioned multiclass compound.

Can define the free group scavenging agent according to its ability under prescribed condition as the free group scavenging agent.If the FRS representative as the compound to be tried of radical scavenger, then can utilize following three step detection methods to confirm that FRS is a radical scavenger:

1) in the 5ml dimethyl formamide, sneaks into FRS and 10mg tribromo-acetyl superoxide, so that FRS is 2: 1 to the molar ratio of tribromo-acetyl superoxide.

2) reaction mixture is heated to 80 ℃ and kept M minute,

3) with high performance liquid chromatography (HPLC) (if Cl ₃C-FRS is not volatile) or gas-chromatography (if Cl ₃C-FRS is volatile) the method analyze reaction mixture, detect Cl ₃The amount of C-FRS.According to measured Cl ₃The amount definition of C-FRS is removed active.

Selected appropriate time M minute, so that, make to change into Cl if during with this method test vitamin-E ₃The percentage of the vitamin-E of C-vitamin-E is less than 100.In general, expection M was less than 10 minutes.

When testing two kinds of compounds under the same conditions, can be through more formed Cl ₃C-FRS measures the relative removing activity of calculating these two kinds of compounds (as vitamin-E and another kind of compound).If the formed Cl of certain compound ₃The amount of C-FRS is 20% of the amount that formed when adding vitamin-E in detection, and then this compound removing activity is the removing active 20% of vitamin-E.

Detect the active method of removing and be based on series reaction, wherein be included in 80 ℃ of following processing and cause a part tribromo-acetyl peroxide breakdown, and produce two molecule radicals, Cl ₃C* reacts to produce Cl with radical scavenger again ₃C-FRS.

The fluorescent absorption wavelength of probe or compound (as radical scavenger), be can be by the radiation wavelength (particularly ultraviolet ray or visible light) of probe or compound absorption, and, then can cause the gamma ray emission light (particularly visible light) to be longer than the fluorescent absorption wavelength by this probe or compound if be absorbed.Above-mentioned longer wavelength is meant " fluorescent emission wavelength ".The fluorescent absorption wavelength better is in about 420nm to 460nm scope.The fluorescent emission wavelength better is in about 450nm to 690nm scope.In practice, make probe populations, and light is launched in monitoring in emission wavelength ranges in absorbing wavelength scope exposure.

Fluorescent probe or compound are the materials with fluorescent absorption wavelength and fluorescent emission wavelength.

In fluorescence detection of the present invention, better select for use radical to remove active this radical scavenger of active 1% (eliminate activity of every mole of scavenging agent) that is at least vitamin-E, if the scavenging agent molecule is wherein multiple multiple unit the active polymkeric substance of removing is arranged all, but the volumetric molar concentration respective change of repeating unit then; More preferably radical is removed active active 20% the scavenging agent that is at least vitamin-E, and most preferably with vitamin-E the active scavenging agent of same major clean-up operation is arranged at least.

As finding out from embodiment, generally this fluorescence detection can be used for a large amount of cells basically simultaneously.

In a preferred version of this method, step (5) comprises that detection is with about 520nm to 560nm(about 520nm particularly) the light of wavelength emission, the absorbing wavelength that step (4) is surveyed is preferably less than 520nm.

The preferred embodiment of fluorescence detection also is included in the washing step between step (2) and (3).Cell centrifugal come out from their solution of suspending can be suspended in the washing soln then again therefrom centrifugal more thereafter coming out to finish washing step.Washing soln does not normally have probe solution.

Radical scavenger preferably is not the fluorescence molecule of light of the fluorescent emission wavelength of emitting probe.Specifically, preferably radical scavenger neither absorbs the light of the fluorescent absorption wavelength of probe, also the light of the fluorescent emission wavelength of emitting probe not.

In this method one specified scheme, the solution that uses in the step (2) comprises fluorescent probe, radical scavenger and fixing agent.For adding radical scavenger in mixture, its concentration better is 0.1% to 10%(V/V).

Multiple labeling report physical prospecting pin

In a preferred embodiment of the invention, probe comprises a sub-thread nucleic acid moiety and a plurality of report thing part, so that report that thing part is covalently bound to middle atom by shank, this centre atom is connected between the nucleosides of nucleic acid moiety on the phosphorus atom more.Phosphorus atom is to be located at 5 of oligonucleotide ' or 3 ' end place between nucleosides, only is connected to phosphorus atom between two nucleosides on 1 nucleosides with relative direction.Report thing part better is a dye molecule; Report that especially preferably thing partly is the fluorescence dye part.Available stream kinetocyte counter or detect fluorescence dye at the microscopically that is suitable for detecting fluorescence.

For the dyestuff on the probe that is used for detecting target molecule in the nucleus (as nuclear DNA), the length of probe better is less than about 40 Nucleotide.If probe has seven dye molecules, polymolecular molecular weight is about between 500 and 600, and there are seven molecular weight shank and 40 molecular-weight average close to be about 345 Nucleotide with kharophen part molecular weight (being about 60), then the molecular weight through the probe of mark should be about 20,000.In order to carry out specific hybrid, general probe length should have about 15 bases at least.

For being used for detecting in the cell cytosol the particularly probe of RNA of nucleic acid, better select for use length to be no more than the probe of 200 Nucleotide (molecular weight is not more than about 100,000), but also can use for example 1000 big oligonucleotide that Nucleotide is long.

For dyestuff, to open (promptly " separate length and be at least two atoms) at least by two phosphorus segregates near the dyestuff ring of joint.In general, separate length and be preferably 3 to 30 atoms, the separation length of preferred especially 3 to 10 atoms.

Influence in order to reduce anti-hybridization of potential and quenching as much as possible, the average nucleosides number that the phosphorus atom of next combination dye on the phosphorus atom of combination dye and the oligonucleotide skeleton is separated preferably is at least 4.The phosphorus atom of each combination dye is more preferably separated it and the phosphorus atom of next combination dye on the oligonucleotide by at least 6.

The atom of getting involved between the interior phosphorus atom of shank and nucleosides for example can be Sauerstoffatom, sulphur atom or nitrogen-atoms.If middle intervention atom is a Sauerstoffatom, tricresyl phosphate ester bond between a nucleosides is then arranged, if middle intervention atom is a sulphur atom, tri o cresyl thiophosphate ester bond between a nucleosides is then arranged,, key is then arranged between a Nucleotide between phosphoramidic acid three ester nucleosides (referring to Agrawal and Jamecnik if middle to get involved atom be nitrogen-atoms, Nucleic Acids Research, Vol 18: 5419,1990), for example phosphorothioate triesters and phosphoramidic acid three ester bonds.Three ester bonds comprise that the diester linkage that sees on the natural acid skeleton adds the 3rd ester bond between phosphorus atom and the middle mesic atom (getting involved the atom between phosphorus atom and the shank).

If middle mesic atom is a sulphur atom, then shank can be the kharophen part.In the case, if dyestuff is a fluorescein, the number of then separating the atom of phosphorus atom between dye molecule ring and nucleosides will be the sulphur atom of getting involved in the middle of two carbon atoms of 4(nitrogen and kharophen part add).

If middle mesic atom is a nitrogen-atoms, then shank can be an ammonia hexyl part.In the case, if dyestuff is a fluorescein, the number of then separating near the atom of phosphorus atom between the dye molecule ring of joint and nucleosides will be 8, the nitrogen-atoms of getting involved in the middle of the carbon atom that promptly comprises nitrogen and 6 shanks adds.If dye molecule is a fluorescein isothiocyanate, then separates and also to comprise two other atom near the dye molecule ring of joint and the atom of phosphorus atom, promptly by the nitrogen and the carbon atom of lsothiocyanates partial contribution.

Can think, because of the nucleic acid chains hybridization of the nucleic acid chains of probe and target forms hybrid molecule, being based on the nucleotide sequence of these two strands of chains, complimentary to one another (for example the bases adenine of nucleosides is complementary to the uridylic or the thymus pyrimidine of another nucleosides, guanine is complementary to cytosine(Cyt)) this phenomenon, yet, the whole nucleotide sequences that might not probe and the whole nucleotide sequences complementation of target.

Can select fluorescence dye on demand.Fluorescence dye (attention has shank easily) commonly used is the 5-(2-iodacetyl) amino) ethyl) amino) naphthalene-1-acid iodide, the amino fluorescein of 5-iodacetyl, the amino fluorescein of 6-iodacetyl, tetramethylrhodamin-5-iodo-acid amide, tetramethylrhodamin-6-iodo-acid amide, the monobromo diimine, tetraiodofluorescein-5-iodo-acid amide, 7-diethylin-3-((4 '-iodacetyl amino) phenyl)-the 4-methylcoumarin, 4 ' ((iodacetyl amino) methyl) fluoresceins, tetraiodofluorescein-5-iodo-acid amide, the vitamin H iodo-acid amide, the N-(1-pyrene) iodoacetic acid ester, the vitamin H iodo-acid amide, the N-(1-pyrene) iodoacetic acid ester, N-((2-(iodacetyl amino) ethyl)-and the N-methyl) amino-7-nitro benzo-2-Evil-1, the 3-diazole.

One of many Res fungibiles of iodo-acid amide are maleimides.

Purpose for the present invention, preferred dyestuff is 7-diethylin-3-((4 '-sulphur kharophen) phenyl)-the 4-methylcoumarin, the particularly amino fluorescein of 5-iodacetyl, the amino fluorescein of 6-iodacetyl, tetramethylrhodamin-5-iodo-acid amide, tetramethylrhodamin-6-iodo-acid amide and N-((2-iodacetyl amino) ethyl)-the N-methyl) amino-7-nitro benzo-2-Evil-1, the 3-diazole.

For eukaryotic in situ hybridization, the effect of monobromo diimine is relatively poor, and this may be because it can not pass through cytolemma effectively.

Importantly, under the condition of cross experiment, report thing part can stably be connected on the nucleic acid probe part, provides enough signals, and if it be a kind of fluorescence dye, also have exciting and emission wavelength of being convenient to utilize.

Promptly 30 Nucleotide are long at a 30mer(who is used for detecting nuclear DNA) particular, have that phosphorus atom is connected on the sulphur atom between four nucleosides, this sulphur atom then is connected with on the dyestuff shank partly being connected in.These four phosphorus atom appear between nucleosides 1 and 2,7 and 8,23 and 24 and 29 and 30 (nucleosides counting according to 5 ' carry out to 3 ' direction) respectively.

Be used for detecting the particular preferred embodiment of the 39mer of endochylema RNA at another, also there is phosphorus atom between four nucleosides to be connected to and is connected on sulphur-joint-dyestuff sulphur atom partly, these phosphorus atom come across nucleosides 1 and 2,9 and 10,30 and 31 respectively, and between 38 and 39.

From 30mer above-mentioned and 39mer sequence, as can be seen, occur nucleosides at the middle part of probe and stretch, thus the sulphur atom that is not connected with phosphorus atom.For 30mer, wherein having length is the long no sulphur zones of 16 nucleosides.For 39mer, one the 21 long no sulphur zone of nucleosides is arranged wherein.Therefore why comprise these no sulphur districts (and and do not have sulphur-joint-dyestuff), because the influence of sulphur-joint-dye complex and the zone that reduces the hybridization ability are can't help in its existence.

For the cell single copy of gene in people's cell particularly, having necessary utilization has the probe populations of about 800 different 30mer, if the order according to their hybridization is lined up end-to-end along single target molecule, then will be along the unnotched sequence that molecule is stayed long 24,000 nucleosides.Be still reasonably with regard to probe of the present invention and a kind of like this strategy of method.For example, not necessarily according to removing to use crossover probe (promptly 3 ' terminal sequence of a probe is entirely identical to 5 ' terminal sequence of other probes) because have one or more theories that are connected to the phosphorus atom on sulphur-dye complex and the part of each probe molecule can not be hybridized above it.

The molecular weight of dye molecule is mostly in 400 to 700 scopes.But also can use big dye molecule as molecular weight 700 to 1500.

For the dyestuff on the probe that is used for detecting target molecule in the nucleus (as nuclear DNA), the length of probe is preferably less than about 40 Nucleotide.If there are seven molecular weight respectively to be about dye molecule of 500 to 600 on the probe, have and the shank of the similar molecular weight of kharophen part (being about 60) and the Nucleotide of 40 molecular-weight average about 345 with seven, molecular weight through label probe should be about 20,000 so.For specific hybrid takes place, it is long that probe generally should be at least 15 bases.

For being used for detecting the particularly probe of RNA of cell cytosol amplifying nucleic acid, it is better that its length is not more than 200 Nucleotide (molecular weight is not more than about 100,000), but also can use the bigger oligonucleotide as 1000 Nucleotide.

If be desirably in fluorescein and with sulphur that phosphorus is connected between have only two atoms, can buy commercial compound and 5-brooethyl fluorescein.Can make the joint that is separated with 5 to 20 atoms between dyestuff ring and phosphorus atom be: 1-pyrene methyl-iodide acetic ester (4 atom joints, do not comprise and get involved the sulphur atom between phosphorus atom between joint and nucleosides), N-((2-(iodacetyl oxygen base) amino-7-nitro benzo-2-Evil-1 ethyl-N-methyl), 3-diazole (6 atom joint), and 6-(6-(((iodacetyl) amino) hexanoyl) amino) caproic acid succinimide ester (16 atom joint).Using compound 6-(6-(((iodacetyl) amino) hexanoyl) amino) during caproic acid succinimide ester, at first by its NH ₂Group is connected to dye molecule (for example it has 6 above atoms to contribute to the dyestuff of joint) on this compound, makes the reaction of this product and sulfurized nucleic acid moiety then.

Generally speaking, the present invention relates to can detection of biological entity (bacterium or virus) in or the detection method of the target molecule on it analytical procedure in other words, this method may further comprise the steps:

(1) make biological entities with contain can with said biological entities in or the solution of target molecule bonded probe on it contact, said contact is to combine with said target molecule with a kind of probe that makes, thereby this probe is become carry out in conjunction with the mode of the probe of biological entities, said probe contains report thing group

(2) biological entities is contacted with the solution of the analog that contains aromatics report thing group,

(3) only carry out detecting with probe that biological entities combines on report thing group, but do not detect one or more steps of the analogue that combines with biological entities,

Wherein step (1) is in step (2) before, and step (2) takes place afterwards or during the step (2),

If probe and analogue are in same solution, then step (1) and (2) are considered to simultaneous.

Be preferably in and be added with probe and analogue in the same solution, with while completing steps (1) and (2).

Step (3) is with a kind of examining report thing group but (as for fluorescent probe, use can cause examining report thing group but not detect exciting and/or emission wavelength of analogue) of not detecting that the mode of analogue carries out.

Of the present invention one accidental, report thing group is a ring compound.Of the present invention another is accidental, and cyclic group includes unsaturated link(age).Of the present invention one narrower accidental, cyclic group is aromatic substance (one or more phenyl ring).

The amount that surpasses report thing group in the mole analogue is better: more preferably analogue is equivalent to report at least 10 times of thing group.

Can suppose that method of the present invention is based on analogue and report thing group competition nonspecific binding site.When using the aurin or derivatives thereof to combine with nucleic acid probe, another mechanism may comprise that aurin is attached to should be in conjunction with on the avtive spot of reporting the thing group in the protein.

Select suitable analogue, to make it to keep the constitutional features of great majority or all report thing groups.Analogue can have unexistent other constitutional featuress of probe.

Analogue should be able to penetration cell or virus.At analogue is under the situation of aurin derivative (rosolic acid derivative), and preferred analogue has on aromatic group-CO ₂,-NH ₂,-OH or-SO ₃Base stage sexual function group: its example is chromogen cyanine R(chromoxane cyanine R) and chrome azurol S.The subunit group of preferred analogue is NH on the sealing Methionin ₂The subunit group of group.Make report thing group absorb energy, launch the energy of some absorption then, detect the energy of being launched, thereby detected fluorescence report thing group.

Make chemoluminescence report thing group enter reaction, reported the thing group thereby detect chemoluminescence as causing energy to emit in the enzymatic reaction with the form of light.

Other report thing group such as vitamin Hs are because they can combine with streptavidin on directly or indirectly being attached to enzyme (alkaline phosphatase or the horseradish peroxidase of the reaction that if can catalysis can detect) and so on and be able to detected.

The spendable fluorophor of the present invention comprises fluorescein (or FITC), texas Red, tonka bean camphor, rhodamine, rhodamine derivative, phycoerythrobilin and Perci-P.

The spendable chemiluminescent groups of the present invention comprises different luminol,3-aminophthalic acid cyclic hydrazide (or the amino Phthalocyclohydrazide of 4-; Referring to Aldrich Chemical Co., the 1990-91 catalogue, or referring to Molecular Probes Inc. catalogue).

Following compounds is carboxylic tetramethylrhodamin 5-and 6-succinimide ester (excitation wavelength (ex): 550nm; Emission wavelength (em): analogue 576nm):

1) 5-and 6-carboxyl-X-rhodamine (ex:576nm, em:597nm);

2) xanthene-9-carboxylic acid;

3) the blue A sodium salt of homogeneous (ex:596nm; Em:724nm);

4) thionine (ex:598nm);

5) eosin-5-lsothiocyanates (ex:522nm, em:543nm);

6) α-iron utmost point lactone (Tougalactone);

7) Eluetherin; With

8) fluorescein (2(3,6-dihydroxy xanthenyl) phenylformic acid).

Following compounds be 7-diethylin coumarin-3-carboxy acid succinimide ester (ex:432nm, analogue em:472nm):

1) 7-amino-4-methylcoumarin-3-acetate succinimide ester (ex:351nm, em:441/nm);

2) 1,2,3,4-tetrahydrochysene-naphthalidine HCl;

3) 1, the 2-dihydroxy naphthalene;

4) 4,8-dihydroxy quinaldic acid and

5) 1,5-sodium catchol disulfonate, 2,3,4-naphthane.

Following compounds is the analogue of different luminol,3-aminophthalic acid cyclic hydrazide (the amino Phthalocyclohydrazide of 4-):

1) 1,4,5, the 8-naphthalene tetracarboxylic acid;

2) oxindole;

3) 1,2,3,4-tetrahydrochysene-β naphthoic acid and

4) 1,3-naphthalene disulfonic acid-7-hydroxyl.

Following protein be alkaline phosphatase (calf intestinal, analogue 39KD):

1) catalase, 57.5KD;

2) Protalbinic acid, 45KD;

3) zymohexase, 40KD; With

4) beta-galactosidase enzymes, 116KD.

In a preferred version of present method, when report thing group was fluorescein, step (4) comprised and detects wavelength at the about emission light of (particularly about 520nm) between 520nm and the 560nm that the absorbing wavelength of step (3) is preferably less than 520nm.

The preferred version of fluorescence detection further comprises the washing step between step (2) and (3).Washing step can be performed as follows, and from the solution that is suspended with cell cell centrifugation is come out, and then it is suspended in the washing soln, and centrifugally from washing soln goes out cell.Washing soln does not normally have probe solution.

In the specified scheme of present method, the solution that uses in the step (2) comprises the analogue of probe (comprising report thing group), report thing group, and fixing agent.Itself also constitutes a part of the present invention such probe solution.

If add analogue in the used solution of step (2), then its concentration is preferably 0.01 to 0.5%(particularly about 0.05 to 0.01%) (W/V)

The preferably combination mode is fluorescein or rhodamine derivative and aurin, and its derivative or Napachrome Green share.

Probe

Nucleic acid probe can be DNA, RNA or comprise DNA or the oligonucleotide of RNA or polynucleotide.DNA or RNA can contain bases adenine, uridylic, thymus pyrimidine, guanine, cytosine(Cyt) or its any natural or artificial chemical derivative.Probe can be by the chemical bond of one or more types, normally by forming hydrogen bonded on complementation or mirror image target cell gene order.

Before in joining hybridization solution, can carry out the detectability mark to nucleic acid probe.Detectable label can be selected and can be incorporated into person on the hybridization product in addition, but available any detection moiety label probe, but and to be actually used in detection moiety such among the present invention can be any the have physics that can detect or material of chemical property.Useful especially is the enzymatic activity group, as enzyme (referring to Clin Chem., 22: 1243,1976), enzyme substrates is (referring to british patent specification 1,548,741), synthase (referring to U.S. Patent No. 4,230,797 and 4,238,565) and enzyme inhibitor (referring to U.S. Patent No. 4,134,792), fluorescent substance is (referring to Clin Chem., 25: 353,1979), chromophoric group, luminophore such as chemiluminescent substance and noclilucence material are (referring to Clin Chem., 25: 512,1979), particularly combinative aglucon, near-end interact and radio isotope as ³H, ³⁵S, ³²P, ¹²⁵I and ¹⁴C.

Can be by nick translation, zymetology or chemical process are incorporated into biotin labeled Nucleotide among DNA or the RNA.Use the probe of avidin/streptavidin, fluorescence, enzyme or Radioactive colloidal gold binding substances hybridization back detection of biological elementization.Also other fluorescent chemicalses can be used, the fluorescent derivative or the vitamin H analogue labeling nucleic acid of immunodetection can be carried out.Also can be by being connected to come labeling nucleic acid with protein.Also can use the nucleic acid that combines (ssB) protein cross with radioactivity material or fluorescence histone HI, enzyme (alkaline phosphatase and peroxidase) or strand.In order to increase the susceptibility that detects Radioactive colloidal gold or peroxidase product, the enhancing or the amplification method that can adopt the silver-colored solution of multiple use to carry out.

Also can use indirect immuno fluorescent cytochemical methods (Rudkin and Stollar, 1977, Nature 265: 472, Van Prooijen et al., Exp.Cell Res., 141: 397,1982).Through to animal injection poly(rA)-poly(dT) produce the polyclonal antibody of anti-RNA-DNA crossbred.Make the hybridization of dna probe and cell in-situ, and be incubated back detection crossbred at antibody with anti-RNA-DNA crossbred.The luminous organism element ^TM(Photobiotin ^TM) label probe is better than biotinylated probe.

Target in cell, tissue and the body fluid

Analyte RNA can be positioned in cell or the viral organism entity.Cell or virus can be suspended in the solution and not be fixed on the solid phase carrier.On the other hand, also can be on solid phase carrier with cell or viropexis.Cell or virus can be the parts of tissue slice.

In an embodiment of present method, during hybridizing, target cell is fixed on the solid phase surface.In another program, target cell all is suspended in the entire operation process in the liquid and is not fixed on the solid phase surface.Be particularly suitable for using normal flow kinetocyte counting mechanism among the present invention.

The cell that contains the analyte nucleic acid molecule can be eukaryotic cell (as people's cell), prokaryotic cell prokaryocyte (as bacterium), vegetable cell or other types cell.They can be simple eukaryotic cell such as yeast, or the cell that is obtained by complicated eukaryote such as human body.

Analyte RNA can be no tunicle or the virus that tunicle (having non-wrap film such as lipoprotein membrane) arranged.

Analyte RNA can be a viral RNA.For some virus (as the human immunodeficiency virus), in single cell, can there be complementary analyte RNA chain simultaneously.

The viral nucleic acid target can be the part of virus, and this moment, virus can be in or be not in the cell.In addition, the viral nucleic acid target also may not be the part of virus, but may be in cell.

Can to be present on liquid suspension, the wave plate or in the cell on other solid phase carriers, in the tissue culture cells and tissue slice in biological entities in target carry out hybridization analysis.When biological entities is cell, it can be from solid tissue (as nerve, muscle, heart, skin, lung, kidney, pancreas, spleen, lymphoglandula, testis, uterine cervix and brain), or is present in various lining form passages, conduit and cavity (as gi tract, urethra, vas deferens, uterine cavity, uterus pipe, vagina, respiratory tract, nasal cavity, oral cavity, pharynx; Larynx, tracheae, segmental bronchus and lung) or body fluid (as urine, gastric juice, spinal fluid, blood and lymph liquid) or ight soil in cell.

Hybridization fixing agent and solution

The fixing agent and the hybridizing method of immobilized cell have been discussed in PCT application WO90/02173 and WO90/02204.Fixing agent should be able to keep the morphology of cell well, and the accessibility and the hybridization ability (also should keep antigenic accessibility and immunoreactivity in case of necessity) of hybridization target.The precipitation fixing agent comprises the combination of ethanol, acetate, methyl alcohol, acetone and these materials.Cross linking fixative comprises Paraformaldehyde 96, glutaraldehyde and formaldehyde.Thereby must form that the prisoner falls into the network of nucleic acid or cause covalent modification to destroy under the condition of its crossability it and use cross linking fixative being unlikely.

The optional freedom of fixing agent is independent or unite any precipitation agent of use or the class material that linking agent is formed, and can be moisture or water-free.Fixing agent can be selected from the class material that formaldehyde solution, alcohol, salts solution, mercury chloride, sodium-chlor, sodium sulfate, potassium bichromate, potassiumphosphate, brometo de amonio, calcium chloride, sodium acetate, lithium chloride, cesium acetate, lime acetate or magnesium, saltpetre, potassium bichromate, Sodium chromate, potassiumiodide, sodium iodate, Sulfothiorine, picric acid, acetate, Paraformaldehyde 96, sodium hydroxide, acetone, chloroform, glycerine, thymol etc. are formed.Fixing agent preferably comprises by precipitating action fixed cell composition and reagent with following feature: use is a reversible, can keep cell (or virus) form, keep required cellular constituent antigenicity, make nucleic acid in cell, keep suitable location, can not modify it in a kind of mode that makes nucleic acid can not form two or three strands of crossbreds, and do not make nucleic acid and all already present target sequences hybridize the mode that is suppressed to influence cellular constituent with a kind of.

Employed linking agent is preferably less than 10%(V/V).The hybridization solution of step 2 that is used for the method for check and analysis thing nucleic acid molecule generally can contain high from liquid sequence denaturing agent, damping fluid, pore former, crossbred stablizer.High from liquid sequence denaturing agent (Robinson, D.W.and Grant, M.E.(1966), J.Biol.Chem.241: 4030; Hamaguchi, K.and Geiduscheck, E.P.(1962) .J.Am.Chem.Soe.84: 1329) comprise methane amide, urea, thiocyanic acid, Guanidinium, three nitrogen acetates, tetramethylammonium, perchloric acid salt face sodium iodide.Can be preferred any PH that can make remains on damping fluid between at least 7.0 to 8.0.Pore former can be stain remover such as Brij 35, Brij 58, sodium lauryl sulphate, CHAPS or Triton X-100 and so on.It seems that 0.05% Brij35 or 0.1% Triton X-100 can make probe by the endochylema film but do not pass through nuclear membrane.And Sodium desoxycholate will make probe pass nuclear membrane, therefore in order to limit and the biological polymer target hybridization of endochylema, should avoid using the nuclear membrane pore former.In the time of in target biopolymer is positioned endochylema, thereby this selectivity Subcellular Localization is by reducing or preventing that probe and complementary nuclear sequence hybridization from improving the specificity and the susceptibility of this method.The crossbred stablizer as one or divalent cation salt be contained in the hybridization solution, be used to promote the formation of the complementary sequence and the hydrogen bond between its target biopolymer of probe.Sodium chloride concentration is 0.15M to 1M preferably.In order to prevent the non-specific binding of nucleic acid probe, can in hybridization solution, add and the irrelevant nucleic acid of target biopolymer.

Available solid phase carrier includes, but is not limited to glass, Scotch bar (3M), nylon, Gene Screen Plus(New England Nuclear) and nitrocellulose.Preferably use microslide.

In order to be configured for finishing the medicine box of the whole bag of tricks of the present invention, can put into bag and/or bottle with being used for all cpds of the present invention and reagent.And put in the single container also preferably with specification sheets how to finish the inventive method.

Wherein should comprise the reagent that is used to hybridize, as contain the damping fluid of methane amide.Hybridizing reagent preferably include following one or more: penetrating toughener of the present invention, radical scavenger and report thing group analogue.Medicine box should have the background depressant preferably, as the Yi Fansishi indigo plant of using during the fluoroscopic examination.Another example approach of medicine box then comprises the signal toughener.Specific medicine box should contain and is useful on the probe that the particular diagnosis purpose infects as the diagnosis viral RNA.

Reagent

Can buy reagent from multiple different sources, comprise Aldrich Chemical Co., Milwaukee, Wisconsin; Sigma Chemical Co., St.Loris, Missouri; Molecular Probes, Inc., Eugene, Oregon; Clontech, Palo Alto, California; Kodak, Rochester, NY and Spectrum Chemical Manufacturing Corp., Gardenea, California.

Other information of some material can be shown table 1 as follows in this article.

The abbreviation of table 1. compound and dyestuff and common name

The abbreviation or

The common name compound

Tempo 2,2,6,6-tetramethyl piperidine-N-oxygen base

(CAS#2564-83-2)

The EDTA ethylenediamine tetraacetic acid (EDTA)

The DMSO dimethyl sulfoxide (DMSO)

The DTT dithiothreitol (DTT)

The PVP polyvinylpyrrolidone

PEG4000 polyoxyethylene glycol (molecular weight about 4000)

The PBS phosphate buffered salt solution

CHAPS 3-((3-courage amido propyl group)-dimethylamino)-

1-propane-sulfonate (CAS#75621-

03-3)

Plain N-(4-azido--2-nitrophenyl) N'-of luminous organism

(3-biotinyl aminopropyl)-N'-methyl isophthalic acid, 3

-propylene diamine { CAS#96087-37-5}

Ficoll nonionic ficoll (Pharmacia)

Silicon { the CAS#65455-that Percoll colloid PVP applies

52-9}

The hot phenoxy group polyoxyethylene glycol (a kind of Soxylat A 25-7) of Triton X-100

{ CAS#9002-93-1; Referring to Aldrich

Chem.Co.1990-91 catalogue }

Brij 35 polyoxyethylene 23 dodecyl ether { CAS#9002-

92-0}

Brij 58 polyoxyethylene 20 hexadecyl ether { CAS#9004-

95-9}

Hoechst33258 2'-[4-hydroxyphenyl]-the 5-[4-methyl isophthalic acid-

Piperazinyl]-2,5'-pair-1H-benzene carbon amide pyrrole

Cough up trihydrochloride { CAS#23491-52-

3}

The dyestuff abbreviation

The abbreviation of dyestuff numbering dyestuff actual name

12 naphthol blue black naphthols B1.B1K.

13 palace fast black WAN palace F-BWAN

20 sulfo group rhodamines, 101 hydrate sulfo group rhodamines 101

Lsothiocyanates fluorescein F1TC

Solution

SSC has following composition: 0.15M NaCl, 0.15M Trisodium Citrate, PH7.0.Be made into XSSC so that after water dilution in 1: 1, will obtain SSC; Be made into 10XSSC, so that after water dilution in 1: 10, obtain SSC.0.1XSSC。0.1XSSC be that water obtains with 1: 10 dilution SSC.

The fixed solution F that uses in the wandering cells counting contains following ingredients: 4 volumes (vol) ethanol adds 5 volume 1XPBS solution and adds 1 volume Glacial acetic acid.

No. 1 washing soln (#1) has following composition: 0.4M isothiocyanic acid Guanidinium, and 0.1% Triton X-100,0.1XSSC is dissolved in deionized water.No. 2 washing solns (#2) have following composition: 0.1% Triton X-100,0.1%SSC is dissolved in deionized water.

PBS is a phosphate buffered saline (PBS), fills a prescription to be 0.136MNaCl, 0.003MKCl, 0.008MNa ₂HPO ₄7H ₂O, 0.001MKH ₂PO ₄

Embodiment 1

Use is at the crossover probe of the target that contains complementary nucleic acid chain

A) make have addition chromosome 18(XX=18) the individual layer of cell line growth for joining, use tryptic digestion then.And with cell rotation (cytospin) method with about 5,000 cell depositions on clean slide.

(H18-100L, H18-100R and H18-110R 213,238 and 263 on a chain respectively have its 5 ' end to the crossover sequence; H18-11 and 18-10 are having its 5 ' end on 275 and 250 of another chain respectively) derive from the α kinetochore reiterated DNA sequences on the karyomit(e) of having published 18.Sequence is as follows:

Probe

Designation Sequence（5′to 3′）

H18-10 TCTTAGTGTGAGTACACACATCTCA

H18-11 CTCCTTCAAAACGGTGGTTCAATTC

H18-100L CTCAGAACTTATTTGAGATGTGTGT

H18-100R ACTCACACTAAGAGAATTGTTCCAC

H18-110R CGTTTTGAAGGAGCAGTTTTGAAAC

Synthetic (Applied Biosystems dna synthesizer, 380B type, A.B.I. reagent) oligodeoxynucleotide, and in the end the stage is added to ammonia hexyl joint on 5 ' terminal phosphate.Joint on the oligodeoxynucleotide is coupled on the rhodamine dyes (buying) then from Clontcch, and use baseline 810 chromatogram equipments be HTB31 " C-33A " (J.Natl.Cancer Institute 32: 135-148,1964) in contrast.

Probe populations is made up of 23 probes: 12 are numbered HPV16-501 to HPV16-512, and at the continuous probe arranged of 300 base zones on the chain (No. 1 chain) of HPV target DNA on the gene map, add 11 serial numbers be HPV16-426 to HPV16-436, and the probe of on gene map, arranging along 275 base zones of No. 2 chains (i.e. the complementary strand of 300 base sequences) continuously.When crossover, then probe on chain and 12 or 13 base crossovers between the probe on another chain.These sequences are the sequence acquisitions according to disclosed HPV16 type, and by Genetic Sequence Data Bank, GenBank, version 69.0 chooses.The base sequence of these probes (from 5 ' to 3 ' direction) as follows:

HPV 16-501: AACTAGTAGCACACCCATACCAGGG

HPV 16-502: TCTCGCCCAGTGCCACGCCTAGGAT

HPV 16-503: TATATAGTCGCACAACACAACACGT

HPV 16-504: TAAAGTTGTAGACCCTGCTTTTGTA

HPV 16-505: ACCACTCCCACTAAACTTATTACAT

HPV 16-506: ATGATAATCCTGCATATGAAGGTAT

HPV 16-507: AGATGTGGATAATACATTATATTTT

HPV 16-508: TCTAGTAATGATAATAGTATAATA

HPV 16-509: TAGCTCCAGATCCTGACTTTTTGGA

HPV 16-510: TATAGTTGCTTTACATAGGCCAGCA

HPV 16-511: TTAACCTCTAGGCGTACTGGCATTA

HPV 16-512: GGTACAGTAGAATTGGTAATAAACA

HPV 16-426: CACTGGGCGAGACCCTGGTATGGGT

HPV 16-427:TGCGACTATATAATCCTAGGCGTGCWaters HPLC purifying it.

For finishing hybridization step, with 20-25 μ l by 30% methane amide, 5XSSC,, the salmon of 0.1M sodium phosphate buffer (PH7.4), 100 μ g/ml lower molecular weight sex change or herring sperm dna, 5%(V/V) Triton X-100,5XFicoll/PVP, 0.4M isothiocyanic acid Guanidinium, 10mMDTT and 0.025MEDTA, and the hybridization mixture of forming with the probe that 2.5 μ g/ml concentration add adds in the cell that is deposited on the slide.Slide is put into incubator in 85 ℃ of insulations 15 minutes, and carry out sex change and hybridization simultaneously.

After the hybridization, in the solution of forming by 0.1XSSC and 0.4M isothiocyanic acid Guanidinium and 0.1%Triton X-100, slide was washed 2 minutes in stirring down.And then washed 5 minutes under in the solution that contains 0.1XSSC and 0.1% Triton X-100, stirring, wash the back and from solution, remove cell.Add 15 μ l then and contain 0.1%1,4-phenylenediamine anatrophic (in 50% glycerine) and 1 μ g/ml Hoechst(33258) fixed solution.

Use Kodak Ektachrome EES-135(PS800/1600) film, carry out photomicrography, exposure and expand processing at the 1600ASA place on the Olympus BH10 of tool fluorescence resolving power microscope.Time shutter is 20 seconds.

The visual inspection slide finds that the strength of signal that obtains with all probes is single with sense strand or single twice with antisense strand gained intensity.

(b) use CCL1550 " CAski " cell.They are the person neck sarcoma cell lines (Science 196: 1456-1458,1977) that contain 400-500 the HPV16 copy that is incorporated in its genome.Use derives from neck cancer biopsy and does not contain the person neck sarcoma derived cell of human papillomavirus

HPV 16-428: TCTACAACTTTAACCTGTTGTGTTG

HPV 16-429: AGTGGGAGTGGTTACAAAAGCAGGG

HPV 16-430: CAGGATTATCATATGTAATATTTGA

HPV 16-431: TTATCCACATCTATACCTTCATATG

HPV 16-432: ATCATTACTAGAAAAATATAATGTA

HPV 16-433: GATCTGGAGCTATATTAATACTATT

HPV 16-434: AAAGCAACTATATCCAAAAAGTCAG

HPV 16-435: CCTAGAGGTTAATGCTGGCCTATGT

HPV 16-436: TTCTACTGTACCTAATGCCAGTACG

Synthetic oligodeoxynucleotidecombination, and in the end the stage is connected to ammonia hexyl joint on 5 ' terminal phosphate.Make 5 then '-ammonia hexyl oligodeoxynucleotide be coupled to that rhodamine dyes (deriving from Clontech) is gone up and with the HPLC purifying it.

For hybridizing, with 20 μ l by PEG(21%), methane amide 25%), 5 * SSC, toadfish sperm DNA (1mg/ml), Ficoll/PVP(15 *), isothiocyanic acid Guanidinium (0.4M), DTT(50mM), Triton X-100(5%), EDTA(50mM), Na ₂PO ₄(50mM) and concentration be that the hybridization mixture that the probe of 0.06% μ g/ml is formed is added on the slide.Put cover glass and with slide in 95 ℃ the heating 5 minutes, be cooled to 42 ℃ after under this temperature the insulation 25 minutes.

After the hybridization, slide is placed on is added with 100ml and contains in the Coplin jar of washing soln of 0.1 * SSC, 0.4M isothiocyanic acid Guanidinium and 0.1% Triton X-100.Stirred solution is also placed solution 2 minutes.Change second kind of washing soln forming by 0.1 * SSC and 0.1% Triton * 100 into after removing this solution.The hypsokinesis in 1 minute of this solution stirring is gone, and last washing step repeats twice.The washing back adds 8 μ l anatrophic/Hoechst counterstains.Cover slide and under fluorescent microscope, observe with cover glass.

Use Kodak Ektachrome EES-135(PS800/1600) film, having exposure picked-up Photomicrograph on the Olympus BH10 microscope of fluorescence resolving power, and expanding processing in 7600ASA.Time shutter was 20 seconds.

The result shows shown in the table D, when using 12 oligomer of No. 1 chain or No. 2 chains, the gained strength of signal be in hybridization solution, use two chains probe gained intensity 1/2nd.

Table D

Cell probe mark probe numbering result's (intensity)

No. 2 chain FITC 11 of C-33A-

No. 2 chain FITC 11 of Caski ++

No. 1 chain FITC 12 of C-33A-

No. 1 chain FITC 12 of Caski ++

C-33A 1 and No. 2 chain FITC 23-

Caski 1 and No. 2 chain FITC 23 ++ ++

(c) this embodiment has proved several aspect of the present invention, comprises the quantitatively intracellular DNA and the RNA of individual cells such as HIV infection how simultaneously.

Use H9 clone.Cell suspension was placed 12 to 16 hours down in 40% ethanol, 50%PBS and 10% Glacial acetic acid and in 4 ℃.After fixing, the centrifugal stationary liquid of removing is washed 1 time and is resuspended among 2 * SSC with 1 * PBS.Cell should use immediately.

HIV sequence with full probe is by GenBank, and version 69.0 chooses, and they are cut into as shown in Figure 2 30mer to make the probe of HPV sequence.This design causes one 15 base " crossover " zone.

Probe name GenBank location name fluorescent tag molecule probe, public affairs

Department's catalog number

HIV-sense strand HUMHB102 FITC 1-3

HIV-antisense strand HUMHB102 rhodamine derivative T-488

Make a series of thiophosphatephosphorothioate oligonucleotide probes, each 30-mer has 4 sulphur atoms.Being positioned such that of sulphur atom: 15 ' end at probe, the 2nd between the 7th and the 8th Nucleotide (from 5 ' end counting), the 3rd between the 22nd and the 23rd Nucleotide, the 4th between the 29th and the 30th Nucleotide.As follows the sulphur atom of poly sulfurized oligonucleotide is coupled to fluorescence dye then, as (adjustable integral body amasss to synthesize less volume production thing) on iodacetyl amino-fluorescein: 200 μ g exsiccant oligonucleotide are dissolved in the 100 μ l25umM Tris damping fluids (PH7.4) obtain first solution.Then 1mg sulfur acetyl fluorescein and 100ml anhydrous dimethyl formamide (being 100%DMF) are merged into second solution.Two solution are mixed and shaken overnight.Spend the night after the insulation, use ethanol and 3M sodium acetate to precipitate the oligonucleotide of mark.Make this roughage cross the PD-10 post then to remove free dye.Under vacuum, remove the liquid phase that contains required part and use the HPLC(high performance liquid chromatography) purifying gained material.

In order to hybridize, 50 μ l being contained DNA, the 3%(V/V that 30% methane amide, 5 * SSC, 0.16M sodium phosphate buffer (PH7.4), 1 μ g/ μ l are sheared) hybridization mixture of Triton X-100,5%FEG4000,25mM DTT, 4M isothiocyanic acid Guanidinium, 15 * Ficoll/PVP and the probe that adds with 2.5 μ g/ml concentration is added on the cell of centrifugal collection.In 42 ℃ of hybridization 30 minutes.

After the hybridization, in the 1 * SSC, the 4M isothiocyanic acid Guanidinium that are stirring under 42 ℃ and .1%Triton, cell was washed 5 minutes.Then, washed 5 minutes in 42 ℃ in .1 * SSC, the .1%Triton that stirs, at this moment, cell is a single cell suspension again.The centrifugal cell of isolating from washing soln also is suspended in 0.2ml again by redying in the solution that 0.0025% Yi Fansishi orchid (in 1 * PBS) is formed.

FACSTAR with Beckon Dickinson manufacturing ^TMAnalysis of cells.This device uses 5 watts of argon lasers that are coupled on the dyestuff head, uses the 525nm band-pass filter mating plate at FL1, and at the 584nm band-pass filter mating plate of rhodamine.For each analyzed sample, all at first analyze and contain the sample of negative probe and fix on four fens states, so that fall into upper right 1/4th or 1/4th places, bottom right less than 0.01% cell.Under the identical parameter of analyzing above-mentioned sample, analyze the sample of analyzing with the HIV probe then.Because state was accurately reserved in four minutes, and difference done identical processing, so at the cell numbers (about 0.01%) of upper right 1/4th records positive record as two chains and/or mRNA.The cell number (more than 0.01%) of 1/4th records then is the positive record as DNA in the bottom right.

Embodiment 2

Present embodiment proof 25 base oligomer under this routine hybridization conditions can be hybridized, and 6 to 12 base oligomer can not be hybridized.

Use H9 clone in the following experiment.(PBS) washes cultured cells with the nuclease free phosphate buffered saline (PBS), and makes single cell suspension with the concentration of the cell that obtains clear separation.Centrifugation cell becomes agglomerate and abandoning supernatant.Cell is resuspended in 40% ethanol, 50%PBS and 10% Glacial acetic acid, and placed 12-16 hour down in 4 ℃.After fixing, eccentric cell is washed in 1 * PBS then 1 time and is resuspended among the 2XSSC to remove stationary liquid.Cell should use immediately.

Design is named into the conservative fragments of the eucaryon 28S rRNA of 28S-25-AL and used as the positive control probe in the experiment described herein.

From see bacterium and known not with eukaryotic cell in the nitrogen reductase gene of nucleic acid hybridization obtain being called the negative probe of NR25-AL.Tabulate the down dna sequence dna of these two probes shown in 4.Also be derived from 12 bases, 10 bases, 8 bases and the 6 base oligomer of these 25 base oligomer with the preparation of sequence shown in the table 4.The all sequences of showing among the embodiment all has 5 ' end as the left-hand end of sequence.

Table 4

Probe Sequence

28S-25-AL ATCAGAGTAGTGGTATTTCACCGGC

28S-21-AL ATCAGAGTAGTGGTATTTCAC

28S-18-AL ATCAGAGTAGTGGTATTT

28S-15-AL ATCAGAGTAGTGGTA

28S-12-AL ATCAGAGTAGTG

28S-10-AL ATCAGAGTAG

28S-8-AL ATCAGAGT

28S-6-AL ATCAGA

NR25-AL TACGCTCGATCCAGCTATCAGCCGT

NR12-AL TACGCTCGATCC

NR10-AL TACGCTCGAT

NR8-AL TACGCTCG

NR6-AL TACGCT

(all sequences described herein all is 5 ' terminal on the left)

Synthetic oligodeoxynucleotidecombination (Applied Biosystems dna synthesizer, 380B type use A, B, I, the reagent recommended), and in the end the stage receives amino hexyl joint on 5 ' terminal phosphate.Purifying 5 '-amino hexyl oligodeoxynucleotide, be coupled to it on rhodamine derivative that derives from Molecular Probes and use baseline 810 chromatogram working ordeies with Waters HPLC purifying it.

In order to hybridize, will be by 30% methane amide, DNA, 3%(V/V that 5 * SSC, 0.16M sodium phosphate buffer (PH7.4), 1 μ g/ μ l shear) alcohol derivate of Triton X-100(Soxylat A 25-7, referring to the 1990-91 catalogue of Aldrich Chemical Co.), the 5%PEG4000(polyoxyethylene glycol), 25mM DTT(dithiothreitol (DTT)), 0.4M isothiocyanic acid Guanidinium, 15 * Ficoll/PVP and the hybridization mixture 50 μ l that form with the probe that 2.5 μ g/ml concentration add are added on the cell precipitation cake.Hybridize and under 42 ℃, carried out 30 minutes.Above said 500 * Ficoll/PVP be that 5g Ficoll 400 types (molecular weight is 400,000 ficoll) add 5g PVP(polyvinylpyrrolidone) final volume that is dissolved in the water is 100ml; 15 * Ficoll/PVP is the 500 * Ficoll/PVP of water with the dilution of 15/500 Dilution ratio.

Behind the hybridization, suitable washing is very necessary to the background pollution that the non-specific binding of eliminating because of probe causes.After the hybridization cell is placed on and is added with 10ml and preheats to 42 ℃., the 15ml taper of the washing soln of being made up of 0.1 * SSC, 0.4M isothiocyanic acid Guanidinium and 0.1%Triton in vitro.Stirred solution becomes single cell suspension up to cell, with 250 * g centrifugal 5 minutes then.Remove supernatant liquor, adding preheats 42 ℃ of 10ml washing solns of being made up of 0.1 * SSC and 0.1%Triton in cell mass.Stirred solution becomes single cell suspension up to cell, with 250 * g centrifugal 5 minutes then.Remove supernatant liquor and cell mass is suspended in 0.2ml once more by in the blue solution of forming of 0.0025% Yi Fansishi that is added among 1 * PBS.

Profile II with Coulter Instruments manufacturing ^TMAnalysis of cells.This device uses the 488nm argon laser, and uses the 525nm band-pass filter mating plate at FL1, and at the 635nm band-pass filter mating plate of counterstain.In each test sample, at first analyze and contain the sample of negative probe, and set four fens states and be less than 0.01% so that fall into the cell of upper right 1/4th scopes.Under as the identical parameter of the negative probe sample of analytic band, analyze the sample that contains positive probe then.Because set four fens states exactly, and two samples have all been done identical processing, thus upper right 1/4th the record cell numbers (more than 0.01%) as positive record.

Be distributed in two test tubes about 500,000 H9 cells also fixing as stated above.In a copy of it aliquot sample, add the hybridization solution contain positive probe (28S), and in another part, add and contain the hybridization solution that is equivalent to the onesize negative probe (NR) of listed positive probe in the above table 4.Hybridize washing and wandering cells counting then.

The result who uses flow cytometry to record is: when using the 28S-25-AL probe, the cell more than 99% is positive, and when using the 28S-21-AL probe, the cell of 0.01-99% is positive; When using other probes, positive less than 0.01% cell.In addition, as detect average LFL1, obtain result as shown in table 5.

Table 5

Signal (average LFL1)

Length N R 28S Fold Diff

6 .322 .370 1.1

8 6.4 .441 Neg

10 .422 .3 .70

12 .321 .231 .72

15 .327 .373 1.1

18 .407 .339 .83

21 .281 .616 2.2

25 .3 50.0 168

Embodiment 3

Penetrating toughener and signal toughener

The wandering cells counting

Use Coulter Profile II flow cytometry to carry out the wandering cells counting.As probe dye, the spectral filter of LFL3 is the 635nm long wavelength pass filter with FITC, and the spectral filter of LFL1 is the 540bp spectral filter; Excitation wavelength is 488nm.Adjust the locating device of PMT1 and PMT3 as required.When dyestuff partly is fluorescein, generally be that PMT1 is set at 1100, PMT3 is set at 900, and use 15% color compensating (PMT1, PMT3).

Hybridization mixture " HC " is the salmon sperm dna of the solution that following component is arranged: 5 * SSC, 15 * Ficoll/PVP, 0.16M sodium sulfate damping fluid (PH6), 1mg/ml shearing, 10%Triton X-100,0.4M isothiocyanic acid Guanidinium, 30%(V/V) methane amide, 10mM ethylenediamine tetraacetic acid (EDTA) (EDTA), 1.5% polyoxyethylene glycol (PEG), 25mM DTT(dithiothreitol (DTT)) and 5 to 10 μ g/ml(mcg/ml) probe.

Hybridization mixture " HC-DMSO " is salmon sperm DNA, 10%Triton X-100,0.4M isothiocyanic acid Guanidinium, the 30%(V/V that the solution that contains following component: 5 * SSC, 15 * Ficoll/PVP, 0.16M sodium phosphate buffer (PH6) 1mg/ml shear) methane amide, 10mM EDTA, 1.5%PEG, 25mM DTT, 10%(V/V) DMSO and 5-10 μ g/ml probe.Above, 500 * Ficoll/PVP is that 5g Ficoll400 type (molecular weight is 400,000 ficoll) adds 5g PVP and is diluted with water to cumulative volume 100ml; 15 * Ficoll/PVP be 500 * Ficoll/PVP use water as 15/500 the dilution obtain.

Detect in flow cytometer, carrying out fluidic cell, with cell suspension in 1 * PBS solution.

The 28S rna probe is special to ribosome-RNA(rRNA), and has the nucleotide sequence of 28S-25-AL described herein.The NR probe is special to the nitrogen reductase gene in the dried bacterium (rather than eukaryotic cell), and it has the nucleotide sequence of NR-25-AL described herein.

" slide in-situ preparing and hybridization program "

1) with cell suspension in stationary liquid (3 volume ethanol add 1 volumes methanol) and use that the Cytospin device is centrifugal to be transferred on the slide.

2) testing liquid (only contain hybridization mixture HC or with one or more tested compound as toughener) that will contain dna probe (25 μ l) is added on the cell and covered.

3) slide glass was heated 5 minutes down so that the DNA sex change was hybridized in 46 ℃ of insulations then in 30 minutes in 90 ℃.

4) with washing cell once at No. 1 washing soln of 42 ℃ of following equilibrated, be used in No. 2 washings cells of 42 ℃ of counter-balanceds 10 times.

5) (50% glycerine (V/V) that is dissolved among 1 * PBS adds nuclear staining agent Hoechst(#33258 to add fixedly solution on cell; 1 μ g/ml) and covered.

6) there is being the Olympus BH10 microscopically of capabilities of fluorescence detection (excitation wavelength 567nm, emission wavelength 584nm) to observe hybridization signal to use rhodamine derivative spectral filter.

" liquid original position cell preparation and hybridization program " (step 1～6):

1. fixed cell in solution F is suspended in cell among 2 * SSC then again.

2. centrifugation goes out cell and is suspended in again in the testing liquid (only contain hybridization mixture HC or with merge as the tested compounds of one or more of toughener) from solution.

3.42 hybridization went out cell by centrifugation in the testing liquid, to wash cell in 42 ℃ of pre-warmed No. 1 washing solns after 30 minutes under ℃.

4. in 42 ℃ of pre-warmed No. 2 washing solns, wash cell then.

5. cell is suspended in again in the 1 * PBS solution that contains as 0.002% Trypan Blue of counterstain.

6. make cell pass through the histogram (" counting " is meant cell counting) of wandering cells calculating instrument and making " counting is to LFL1 ".With the basis of this histogram as definite average LFL1.

(a) influence of proof adding alkane (squalane) and other compounds as follows:

The in-situ preparing Cell sheet glass is hybridized then.Hybridization mixture is made up of 8 volume HC-DMSO, 1 volume squalane, 1 volume squalane and other compounds of 1 volume.Other compounds are one of following compounds: lauryl alcohol (alcohol), beta-cyclodextrin (sugar), Wickenol 111 (fatty acid ester) 1,2-propylene glycol (alcohol), pyrrolidone (lactan), hexamethyldisiloxane (organosilane) or oleyl alcohol (alcohol).In the control sample, replace other compounds of 1 volume with 1 volume water.As a result, in all samples concentration of DMSO and squalane be respectively 8% and 10%(V/V).

With regard to control sample, observing the slide strength of signal is 2.Compare with the contrast slide, whether according to intensity is respectively 0.5,1.0,1.5 and 2 times of control sample slide, is 1,2,3 or 4 and assess all other slide rated value.

B) during liquid hybridization is tested in position, in testing liquid, except that adding DMSO, also have under the condition of other additional compounds, measure its influence probe signals intensity.With flow cytometry method analytical data.

Follow liquid original position cell preparation and hybrid method.Used cell is the Hela cell.Used probe is the NR probe of 28S rna probe.Each probe all has by Aminolink cross linker molecule (ammonia hexyl; Available from Applied Biosystems Inc.) be connected to the FITC part on its 5 ' end.

The 28S rna probe is the target-specific probe special to ribosome-RNA(rRNA); With the summation of its fluorescence that records representative from the autofluorescence of the fluorescence of the probe of the probe of target combination, non-specific binding and cellular elements.The NR probe is sequence-specific to plant nucleic acid, and in the present embodiment, with its fluorescence that records representative from the fluorescence of the probe of non-specific binding and the summation of autofluorescence.In this experiment, hybridization mixture adds that by 9 volume HC-DMSO 1 volume additional compound forms.In control sample, replace 1 volume additional compound with 1 volume water.As a result, the concentration of DMSO all is 9%(V/V in all samples).

Table 6

28S RNA NR probe 28S RNA/NR in the hybridization mixture

The ratio of additional compound probe

Water 6.070 0.137 44

10% pyrrolidone 10.19 0.133 77

10% beta-cyclodextrin 9.593 0.135 71

10% hexamethyldisiloxane 7.426 0.126 59

10% Wickenol 111 8.057 0.140 58

10% propylene glycol 8.227 0.148 56

10% lauryl alcohol 4.804 0.142 34

10% oleic acid 3.643 0.142 26

10% oleyl alcohol 0.731 0.136-

10% different triacontanol 0.611 0.123-

Ratio 28S/NR is a ratio of using 28S rna probe and the viewed average LFL1 of NR probe respectively.Result shown in " 28S rna probe " and " NR probe " hurdle is respectively with 28S RNA and the observed average LFL1 of NR probe.

These results are the mean value of four independent experiments.Result's demonstration in the table 6 is compared with 9%DMSO gained result with single, and pyrrolidone, beta-cyclodextrin, hexamethyldisiloxane, Wickenol 111 and propylene glycol and 9%DMSO share has increased luminance signals.If single with DMSO concerning luminance signals, the 9%th, best or near best DMSO concentration.

Use 10% squalane or 10% oleyl alcohol can make it from solution, to be precipitated out, and all produce biphase mixture in both cases.All obviously reduced strength of signal under two kinds of situations of result.

(c) follow liquid original position cell preparation and hybrid method.Share on DMSO and the basis of squalane in detection, detect the reinforced effects of using the further raising in back again with the third compounds the influence of fluorescent probe signal.

Almost in both cases, hybridization mixture is made up of 9 volume HC-DMSO, 0.5 volume squalane and 0.5 volume additional compound.Additional compound is one of following compounds: lauryl alcohol (alcohol), beta-cyclodextrin (sugar), Wickenol 111 (fatty acid ester), 1,2-propylene glycol (alcohol), pyrrolidone (lactan), hexamethyldisiloxane (organosilane) or oleyl alcohol (alcohol).Thereby a kind of situation is a water replaces the additional compound hybridization mixture just to be made up of 9 volume HC-DMSO, 0.5 volume squalane and 0.5 volume water.In control sample, mixture is made up of 9 volume HC-DMSO and 1 volume water.The result has 9% big DMSO(V/V in all samples).If add squalane then ratio be 5%, if additional compound is arranged also is 5%.

The average LFL1 that measures the signal that operational analysis thing RNA molecular specificity probe records is to the ratio of the average LFL1 of the signal that uses the NR probe and record.

(d) when additional compound lauryl alcohol, beta-cyclodextrin, Wickenol 111,1, when 2-propylene glycol, pyrrolidone or hexamethyldisiloxane, according to the described method of present embodiment (a) part, it is 4 that people's Y chromosome α-satellite DNA specific probe that personnel selection Hepg2 cell is connected with FITC records its rated value.Obtain rated value 3 with oleyl alcohol.Obtain rated value 2 with trolamine or control material (water), obtain rated value 1 with trolamine.

(e) according to the described method of present embodiment (c) part, use α-satellite DNA probe in detecting, when neither existing squalane also not have additional compound, the LFL1 of satellite probe is 22 to the ratio of the LFL1 of NR probe, and this ratio is not 37 when there being squalane but when not having additional compound.In addition, when having squalane, if additional compound is that this ratio of pyrrolidone is 77.As additional compound is that this ratio of Wickenol 111 is 52, is 1 as additional compound, and this ratio of 2-propylene glycol is 39, is that this ratio of beta-cyclodextrin is 39 as additional compound.

(f) according to the described method of present embodiment (d) part, end user women's white cell (caryogram XX) and the fluorescently-labeled female chromosome HXR of rhodamine probe in detecting, when additional compound is 1, strength of signal is 4 when 2-propylene glycol, lauryl alcohol or Wickenol 111, when additional compound is pyrrolidone, oleyl alcohol, squalane or squalene is 3, be 2 when compound is hydroxypropyl cyclodextrin or hexamethyldisiloxane, control group (replacing additional compound with water) is 1.

(g) DMSO, hexamethyldisiloxane (HEX), squalane or the polyoxyethylene glycol (PEG) of prescribed concentration are respectively added in use, contain 62 μ l water, 10 μ l10 * damping fluids (500mM KCl, 100mM Tris PH8.4, be dissolved in the 1mg/ml gelatin in the sterile distilled water), 10 μ l 2mM dNTP mixture (2mM GTP, 2mM CTP, 2mM ATP, 2mM TTP, be added in the TE buffer solution ph 7.5), 1 μ l100mM MgCl ₂, 1 μ l oligonucleotide 1(betaglobulin, 3 ' primer, all primers are all soluble in water with 0.416 μ g/ml), 1 μ l oligonucleotide 1(beta Globulin, 5 ' primer), 10 μ l DNA(people total cell dnas) and the reaction mixture of 5 μ l TAQ polysaccharases (2.5 unit), detectable level is 2%, 4%, 6%, 8% and 10% DMSO, HEX, squalane and the PEG influence to the PCR reaction.Be reflected under the thermo cycler mineral oil in fluid layer and carry out; 90 μ l are freeze dried, and be suspended in reaction mixture in 12 μ l water and the 3 μ l electrophoresis sample-loading buffers again, then on 16 polyacrylamide gels, in 300 volts, 50 amperes electrophoresis 90.Gel dyes with bromination 3.8-diamino-5-ethyl-6-phenylphenanthridineand, and the DNA bonded bromination 3.8-diamino-5-ethyl-phenylphenanthridineand that is stimulated is taken a picture under UV light.Respond and do not depend on the amount of DMSO, HEX, squalane or PEG, on gel, produce different DNA bands, i.e. the characteristic band of PCR product.According to The above results, there is not evidence to show that DMSO, hexamethyldisiloxane, squalane or polyoxyethylene glycol have suppressed the PCR reaction.

(h) will be included in the fixed solution as all cpds of signal toughener, rather than in their solution of the suspension before it is suspended in the fixed solution, so as to proving the validity of these compounds.After the in situ hybridization step, wash cell and add improved fixed solution then, and in the fluorescent signal of microscopically observation of cell.Improved fixed solution comprises 9 volume fixed solutions and 1 volume additional compound, and wherein tested additional compound is the compound through test tool signal toughener ability.Additional compound is selected from water (contrast), 1,2-propylene glycol, hydroxypropyl cyclodextrin, hexamethyldisiloxane, lauryl alcohol, pyrrolidone, Wickenol 111, oleyl alcohol, squalane and squalene (alkene).Fixed solution is by being added in 0.1%1 in 50% glycerine (V/V), 4-pentanoic (anatrophic) and nuclear tinting material Hoechst(#33258; 1 μ g/ml) forms.

Embodiment 4

The example of background depressant

The purpose of present embodiment is to determine whether certain compound has background depressant function, be whether it can reduce by the probe molecule of non-specific binding and the light quantity of auto-fluorescence molecule emission, and do not reduce light quantity equally by the probe molecule emission of specificity combination.

The dyestuff abbreviation title that table 7. is used

Dye item number dyestuff actual name abbreviation title

12 naphthol blue black naphthols B1.B1K

13 palace fast black WAN palace F-BWAN

20 sulfo group rhodamines, 101 hydrate sulfo group rhodamines 101

Fluorescein isothiocyanate FITC

NR is a part of bonded DNA25mer with cell nitrogen reductase gene; Its nucleic acid moiety has the nucleotide sequence of probe NR-25-AL described herein.The 28SRNA probe is and 28S ribosome-RNA(rRNA) bonded DNA25mer that its nucleic acid moiety has the nucleotide sequence of probe 28S-25-AL described herein.Also in the end the stage is connected to an ammonia hexyl joint on 5 ' terminal phosphate synthesising probing needle.Then 5 ' ammonia hexyl oligodeoxynucleotide is coupled to that FITC dye molecule (deriving from Molecular Probes) is gone up and with the HPLC purifying it.

The method described in the embodiment 3 of pressing is used Coulter.Profile II flow cytometry.

The composition of hybridization mixture HC is described with embodiment 3, adds 3%Triton X-100(V/V but wherein change into) and 5%PEG.

Illuminating colour solution contains following component: the illuminating colour 0.002%(W/V in 1 * PBS).In general, if used illuminating colour and be used as the background depressant, then its concentration be 0.0002% and 0.10%(W/V) between.Preferably cell and background reduction compound are incubated 2 minutes to 8 hours down in 20 ℃ to 46 ℃.Some illuminating colour also is to reduce the background compound.Wherein great majority are also as counterstain.

Illuminating colour solution has the composition identical with the mobile damping fluid of FAScan.

The H9 cell is the lymphoma cell line (ATCC No.CRL 8543) that derives from the people.

For carrying out nonspecific binding test, use " NR " probe.

For carrying out specificity, use " 28S " probe in conjunction with test.

When using the NR probe, radiative amount will be the total amount by the light of two light emitted; The probe molecule of non-specific combination and the molecule of autofluorescence.In other words, this radiative amount promptly is a bias light.

When using the 28S probe, radiative amount is the light and the summation of three light emitted: the molecule of the probe of specific combination, the probe of non-specific combination and autofluorescence.In other words, this radiative amount is that target-specific light adds bias light.

Therefore will find a kind of compound that can reduce bias light, will find the compound that maximum A/B ratio is arranged, said here A is the light quantity of being launched when using the 28S probe, and B is the light quantity of launching when using the NR probe.As a criterion, when the compound that does not add as the background depressant, measure the A/B ratio.

Yet it is not enough that maximum A/B ratio is arranged, and in addition, sufficiently high probe specificity light quantity must be arranged also.The amount of probe specificity light promptly is (A-B).As can be seen, when use reducing the background compound, the amount of probe specificity light is still and is enough to assess.

Experimentize as follows.

1. in solution F, fix not infected H9 cell, and then be suspended among 2 * SSC.

2. with cell centrifugal come out from solution, and be suspended in again among the hybridization mixture HC.With regard to employed probe, the HC mixture is different with the difference of sample.Used three class probes: NR probe, HIV probe and 28S rna probe.Each probe all has the fluorescein that is connected on the probe oligonucleotides.

3.42 ℃ down hybridization is after 30 minutes, with 250 * g centrifugal 5 minutes, cell separated from hybridization mixture and washes cell in preheating 42 ℃ No. 1 washing soln.

4. in preheating 42 ℃ No. 2 washing solns, wash cell then.

5. cell is suspended in again 1 * PBS solution or contains in the PBS solution that remains to be tried compound (promptly detect its validity as the background depressant, this compound also is counted as illuminating colour in the present embodiment).

6. use the flow cytometry counting cells, and obtain an axle and represent illuminating colour fluorescence (LFL2 or LFL3), and the histogram of another axle expression fluorescence probe (LFL1).

What make in the step (6) is " counting is to LFL1 " histogram (" counting " is meant cell counting).Based on this histogram, determine whether wait to try compound can be used as effective background depressant.Also make other histograms and FS/SS graphic representation, but not as the basis of determining background reduction effect; Do not provide these figure herein.

Use sulfo group rhodamine 101 hydrates (as illuminating colour) and NR probe or 28S probe to make a series of countings to the histogrammic example of LFL1.It the results are summarized in table 8 and 9.

Table 8: counting is to the summary of result shown in the LFL1 histogram among Fig. 1

The average LFL1 of group cell counting cell Pcl

1 4917 100.0 0.1560

2 4587 93.3 0.126

3 309 6.3 2.966

4 4 0.1 41.66

Table 9: counting is to the summary of result shown in the LFL1 histogram

The average LFL1 of group cell counting cell Pcl

1 5034 100.0 101.0

2 2 0 0.218

3 31 0.6 6.535

4 4999 99.3 103.0

In the table 8 and 9, " cell Pcl " hurdle provides the per-cent that accounts for total cell count; " LFL " representative " Log fluorescence ".

Summed up detected result in the following table to each tested illuminating colour.

Table 10: result's summary

The mean value of each probe

Dye item number illuminating colour NR HIV 28S 28S/NR

The mean value ratio

12 naphthols B1.B1K 1.159 1.301 73.43 63.66

13 palace F-BWA 0.726 1.030 63.76 87.82

14 Trypan Blues 0.266 0.259 77.56 291.6

20 sulfo group rhodamines 101 0.156 0.143 101.0 647.4

PBS phosphate buffered saline (PBS) 64.5 38.73 246.1 3.82

" mean value ratio, 28S/NR " is the ratio of the mean value of NR probe to the mean value of 28S probe.

From the right-hand column (wherein providing the tolerance of above-mentioned A/B ratio) of table 10 as can be seen, all four kinds of tested dyestuffs have all increased the A/B ratio.In addition, the amount of probe specificity light (A-B) is still significantly.Therefore all dyestuffs of listing in the table 4 all can be used as the background depressant.

Embodiment 5

Radical scavenger

Table 11: the abbreviation of compound

The compound abbreviation

Vitamin-E (alpha-tocopherol) Vil, E

2,2-phenylbenzene-1-picrylhydrazyl hydrate 2,2, DIPH

2,2,6,6-tetramethyl piperidine-N-oxygen base Tempo

Fluorescein isothiocyanate EITC

Diethylamine tetraacethyl EDTA

Dimethyl sulfoxide (DMSO) DMSO

Dithiothreitol (DTT) DTT

Polyvinylpyrrolidone PVP

Polyoxyethylene glycol (molecular weight about 4000) PEG4000

This paper uses Coulter Profile II flow cytometry, but it should be noted, carries out using when LFL detects 540bp(.40) spectral filter, the spectral filter that promptly only allows wavelength 520nm to pass through to the light of 560nm.The spectral filter of LFL3 is by being longer than the spectral filter of 635nm, promptly allowing the above light of all 635nm wavelength to pass through.

Use following solution in the present embodiment:

The composition that hybridization mixture HC has this paper to address, and following change is arranged: use 3% Triton X-100(V/V; Triton X-100 is the alcohol derivate of Soxylat A 25-7, referring to the 1990-91 catalogue of Aldrich Chemical Co.) and 5%PEG4000.

If add radical scavenger in mixture, its preferred concentration is 0.1% to 10%(V/V).

When use was added with the hybridization mixture of nucleic acid probe, the temperature of hybridization was more fortunately between 30 ℃ to 46 ℃; Reaction times is more fortunately between 5 minutes to 16 hours.

The ALEX cell is the human cell line.

The NR probe is the fluorescein-labeled NR-25-AL probe that this paper has addressed.The 28S rna probe is the fluorescein-labelled DNA oligomer special to people 28S RNA nucleotide sequence that this paper has addressed.Two kinds of probes all have the ammonia hexyl joint that is connected on 5 ' terminal phosphate, and this joint is coupled on the FITC molecule then.

Carry out the experiment first time as follows:

1. fixed cell in solution F, then with the cell resuspending in 2 * SSC.

2. centrifugation goes out cell and is suspended in again among the hybridization mixture HC from solution.According to different and different with the difference of radical scavenger (if adding really) HC mixture with sample.

3.42 ℃ down hybridization is after 30 minutes, with 250 * g centrifugal 5 minutes, isolates cell and wash cell from hybridization mixture in preheating 42 ℃ No. 1 washing soln.

4. in preheating 42 ℃ No. 2 washing solns, wash cell again.

5. cell is suspended in 1 * PBS solution again.

6. counting cells on flow cytometry, and obtain that an axle is represented autofluorescence (LFL3) and the histogram of another axle expression fluorescence probe (LFL1).

What obtain in the step (6) is: " counting is to LFL1 " histogram (" counting " is meant cell counting).Whether is the basis of effective autofluorescence depressant with this histogram as definite compound to be checked.Also produced other histogram and FS/SS graphic representation, but not with they bases as definite autofluorescence reduction effect: this paper does not show these figure.

Table 11: the average LFL1 and the LFL3 that use radical scavenger

The average LFL3 of the average LFL1 of compound that adds

Do not have 7.92 0.22

Vil.E 0.501 0.119

2,2,DIPH 17.27 0.863

Tempo 3.23 0.181

Thiophenol 1.69 0.138

" compound of adding " is to add (class I liquid I of Vil.E is 5%(V/V) concentration in the table 11, and solid is 5g/100ml) compound in the test mixture.

Because of the demonstration amount that adds the autofluorescence reduction effect that radical scavenger causes is to use the average LFL1 intensity that aforementioned mixture records and uses the poor of LFL1 intensity that mixture records with radical scavenger.Another demonstration amount then is only to use the LFL3 intensity that mixture records and use the poor of average LFL3 intensity that mixture records with radical scavenger.The result shows, Tempo, and thiophenol and vitamin-E are radical scavengers, combining under the situation in conjunction with the used fluorescent absorption-emission wavelength of present embodiment also is effective autofluorescence depressant.On the other hand, the result shows 2, and 2DIPH then can not be used as the autofluorescence depressant under these conditions.2,2, DIPH is invalid may not to be because it does not reduce autofluorescence, but because it is the fluorescent chemicals that the emission light positive is in the wavelength place that present embodiment monitors.Free radical scavenging agent Vil.K also observes similar situation.

In second experiment, experimental arrangement is identical with first experiment basically, but replaces the ALEX cell with not infected H9 cell, and is added in NR probe in the HC mixture or the concentration of 28S rna probe is 10 μ g/ml.The NR probe is special to the bacterium nitrogen reductase gene that is not present in people's cell.This probe is used as negative control.

The 28S rna probe is sequence-specific to people 28S RNA.

The results are shown in the table 13.

Table 13

Have or not Vil.E LFL1 in the probe HC mixture

NR does not have 13.27

NR has 8.86

28S does not have 251

28S has 231

The result shows, exists vitamin-E can make undesirable background level (NR causes) reduction about 33% in the hybridization mixture, and only causes that (28S, the signal level that RNA) records reduces by 8% with the target-specific probe.

The method of this paper embodiment can be done following one or more changes: add i.e. 1 volumetric molar concentration of 5 μ l 1M(in 100 μ l mixtures) DTT and 5 μ l Proteinase K (1mg/ml) solution, and for example in 42 ℃ of following hybridizations 5 minutes, hybridized 5 minutes down in 95 ℃ then, again in 42 ℃ of hybridization 2 minutes.

Embodiment 6

The use of probe analogue

Table B and C show with the FITC mark to be specific to H9-(not infected) and the H9+(HIV infection) result that records of the probe of HIV sequence in the cell.Result shown in the table 4 is during wandering cells counting, adds in containing cell solution or records when not adding T-1824.

Table B

Mixture	H9－	H9+
			Flow	12	226
0.05%NG	11	232
			0.05%ATCA	8	216

Table C

	No T-1824		T-1824
					Mixture	H9－	H9+	H9－	H9＋
Flow	18.9	189	0.127	128
					0.1%NG	19.7	226	0.133	145
0.1%ATCA	12.4	210	0.125	146
					1%NG	19.1	213	0.133	146
1%ATCA	20.3	137	0.212	121

Display density is that 0.05% and 0.1% ATCA can reduce background effectively as a result.The result also shows, exists under the situation of T-1824 during the wandering cells counting, shows that when using napachrome green and ATCA signal increases.

Embodiment 7

The reaction of one sulfurized oligonucleotide in phosphate buffered saline buffer

200 μ g exsiccant oligonucleotide are dissolved in formation first solution in the 100 μ l 50mM phosphate buffered saline buffers (PH7.0).Then amino fluorescein of 1mg iodacetyl and 100 μ l dry DMF (being 100%DMF) are merged into second solution.Two solution are mixed and shaken overnight.So making the ratio of the amino fluorescein of oligonucleotide and iodacetyl is 1: 5.Precipitate the oligonucleotide of mark after the incubated overnight with ethanol and 3M sodium acetate.Make this roughage cross the PD-10 post then to remove free dye.Collect required fraction, under vacuum, remove liquid phase then, and with this roughage of HPLC purifying.

Embodiment 8

Synthetic many sulfurized oligonucleotide in phosphate buffered saline buffer

200 μ g exsiccant oligonucleotide are dissolved in the 100 μ l 50mM phosphate buffered saline buffers (PH7.0) to form first solution.1mg iodacetyl amino-fluorescein and 100 μ l dry DMF are merged obtain 200 μ l reaction mixtures.Two solution are mixed and shaken overnight.So causing the ratio of the oligonucleotide acetparaminosalol fluorescein in the reaction mixture is 1: 5.The amino fluorescein of 1mg iodacetyl is merged with 100 μ l dry DMF once more, get its 100 μ l and 200 μ l reaction mixtures then and merge.In 400 μ l reaction mixtures, add 100 μ l 50mM phosphate buffered saline buffers again, and make reaction proceed 6 hours.With the method separated product described in the embodiment 7.

Embodiment 9

The dye molecule of sulphur connection is to the influence of 50mer at interval

Connect the sulphur atom place difference mark of phosphorus to 28S and the special 50mer oligodeoxynucleotide of NR with fluorescein-kharophen part at (between the nucleosides) between nucleosides.

The sequence of 28S50mer is:

GCCTCACCGGGTCAGTGAAAAAACGATCAGAGTAGTGGTATTTCACCGGC

The sequence of NR50mer is:

CGCCTCGGAGTTGAAGGGATGTTTCCCTGTGAGACGTACCATGGAAGGGT

Use H9 clone, with nuclease free phosphate buffered saline (PBS) (PBS, 0.36M NaCl, 0.003M KCl, 0.008M Na ₂HPO ₄7H ₂O, 0.001M KH ₂PO ₄) wash cultured cells, and make single cell suspension with the cell concn that produces clear separation.Centrifugation cell and abandoning supernatant.Cell is resuspended in 40% ethanol, 50%PBS and 10% Glacial acetic acid, and placed 12 to 16 hours down in 4 ℃.Fixing back centrifugal removal cell from solution; Washing and be suspended in again 2 * SSC(1 * SSC in 1 * PBS is 0.15M NaCl, 0.015M Trisodium Citrate, and PH7.0:2 * SSC is 0.30M NaCl, 0.030M Trisodium Citrate PH7).Cell will use immediately.

For every kind of probe, all about 500,000 H9 cells are distributed to two and in vitro and as stated above fix.The hybridization solution that will contain positive probe (28S) is added in a copy of it sample, and will contain the hybridization solution that is equivalent to as above to show the onesize negative probe (NR) of listed positive probe and be added in another duplicate samples.Hybridize then, wash and carry out wandering cells and count.

For hybridizing, in the cell of centrifugation, add 50 μ l hybridization mixtures, DNA, 3%(V/V that this mixture is sheared by 30% methane amide, 5 * SSC, 0.16M sodium phosphate buffer (PH7.4), 1 μ g/ml) alcohol derivate of Triton X-100(Soxylat A 25-7; Referring to Aldrich Chemical Co.1990-91 catalogue), the 5%PEG4000(Macrogol 4000), the 25mMDTT(dithiothreitol (DTT)), the hybridization mixture formed of 0.4M isothiocyanic acid Guanidinium, 15 * Ficoll/PVP and probe (2.5 μ g/ml).Above, 500 * Ficoll/PVP is that 5g Ficoll400 type (ficoll of molecular weight 400,000) adds 5g PVP(polyvinylpyrrolidone) soluble in water be that 100ml, 15 * Ficoll/PVP represent that 500 * Ficoll/PVP has used water as 15/500 dilution to cumulative volume.

Hybridization was carried out under 42 ℃ 30 minutes.

After the hybridization, cell is placed on to be added with preheats 42 ℃, in the 15ml taper test tube of the washing soln of forming by 0.1 * SSC, 0.4M isothiocyanic acid Guanidinium and 0.1% Triton.Stir this solution up to becoming single cell suspension, centrifugal 10 minutes then with 1000 * g.Remove supernatant liquor and in the cell precipitation agglomerate, add and preheat 42 ℃, contain the 10ml washing soln of 0.1 * SSC and 0.1% Triton.Stir this solution up to becoming single cell suspension.With cell centrifugal 10 minutes with 1000 * g.Remove supernatant liquor and the cell precipitation agglomerate is suspended in 0.2ml again and contain redying in the solution of 0.0025% T-1824 (in 1 * PBS).

Profile II in Coulter Instruments manufacturing ^TMLast analysis of cells.This device uses the 488nm argon laser, for FL1 with 525nm band-pass filter mating plate, for counterstain with 635nm band-pass filter mating plate.

The number of the separated nucleosides of successive sulphur atom is different between each probe.Observed semaphore when between sulphur-sulphur, having 4 nucleosides at interval, only and the semaphore that obtains when 6,8 or 10 nucleosides are arranged between sulphur atom almost big.

Claims (91)

1, the method for target molecule in the detection of biological entity, this method may further comprise the steps:

(1) biological entities is contacted with the testing liquid that contains probe molecule, so that probe molecule is attached on the target molecule, and

(2) be attached to detection this probe molecule in back on the target molecule at it,

Said testing liquid contains probe molecule and is selected from dimethyl sulfoxide (DMSO) (" DMSO ") alcohol, aliphatic alkanes, alkene, cyclodextrin, fatty acid ester, acid amides and lactan, and this compounds of organosilane.

Said probe molecule is nucleic acid probe or antibody probe,

Said biological entities is cell or virus.

2, according to the method for claim 1, wherein target molecule is a nucleic acid molecule, and testing liquid contains nucleic acid probe and DMSO(2-20%) and one or more be selected from compound in following one group: alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%), formula R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%) and formula

（SiR ₅R ₆R ₇）N（SiR ₈R ₉R ₁₀）、

（SiR ₅R ₆R ₇）-（SiR ₈R ₉R ₁₀）

(SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) or

(SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) organosilane (2-20%), DMSO and the merging volume that is selected from the compound in this group are no more than the 30%(V/V of testing liquid),

R wherein ₁, R ₂, R ₃, R ₄, R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Be moieties, R ₁And R ₂Can covalently bound formation ring structure, R ₃And R ₄Also can covalently bound formation ring structure, and the per-cent that indicates in the compound unquote is meant the compound concentrations of representing with the per-cent that accounts for testing liquid.

3, according to the method for claim 2, wherein alcohol has 2 to 40 carbon atoms; Aliphatic alkanes has 10 to 60 carbon atoms; Alkene has 10 to 60 carbon atoms; R ₁Add R ₂Have 3 to 20 carbon atoms together, if R ₁And R ₂When not having covalent attachment to form ring, R ₁And R ₂At least 1 carbon atom is respectively arranged; R ₃Add R ₄Have 2 to 20 carbon atoms together, if R ₃And R ₄When not having covalent attachment to form ring, R ₃And R ₄At least 1 carbon atom is respectively arranged; R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀At least 1 carbon atom is respectively arranged; Six alkyl carbon structures, R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Have together and be no more than 20 carbon atoms.

4,, also has the another kind of compound that is selected from this group at least according to the process of claim 1 wherein except DMSO and alkane or alkene.

5, according to the method for claim 4, comprising alkane and at least a other compounds that are selected from this group.

6, according to the method for claim 5, wherein DMSO and the merging volume that is selected from the compound in this group are no more than the 20%(V/V of testing liquid).

7, the method for target molecule in the detection of biological entity, this method comprises the following steps:

(1) biological entities is contacted with the testing liquid that contains probe molecule, so that probe molecule is bonded on the target molecule,

(2) from testing liquid, remove biological entities,

(3) the enhancing signal compound is added in the solution of suspended biological entity, and

(4) detect the signal photon that directly or indirectly produces by target bonded probe molecule,

Said enhancing signal compound is selected from alcohol, aliphatic alkanes, sugar, fatty acid ester, acid amides or lactan, and this compounds of organosilane,

Wherein said biological entities is cell or virus.

8, according to the method for claim 7, wherein photon is directly produced by target bonded probe molecule.

9, according to the method for claim 7, wherein when carrying out step (4), the enhancing signal compound is added in the solution that is suspended with biological entities.

10, according to the method for claim 7, wherein probe molecule comprises that the photon of fluorescence part and detection in step (4) is by this part emission.

11, the medicine box of target molecule in the detection of biological entity, said medicine box comprises probe molecule and is selected from DMSO, alcohol, aliphatic alkanes, alkene, cyclodextrin, fatty acid ester, acid amides and lactan, and this compounds of organosilane, said probe molecule is nucleic acid probe or antibody probe.

12, the method for detection of biological entity amplifying nucleic acid target molecule, this method may further comprise the steps:

(1) biological entities is contacted with the testing liquid that contains the enzyme molecule, so that the enzyme molecule is attached on the target molecule, and,

(2) make enzymic catalytic reaction,

Said testing liquid contains enzyme and is selected from down group:

Aliphatic alkanes, alkene, cyclodextrin, fatty acid ester, acid amides or lactan, and the compound of organosilane,

Said enzyme is selected from archaeal dna polymerase, RNA polymerase, reverse transcriptase, RNaseH, dna ligase and this class of enzymes of rna replicon enzyme,

Said biological entities is cell or virus.

13, according to the method for claim 12, wherein testing liquid comprises enzyme and the DMSO(2-20% that is selected from this group) and one or more be selected from compound in following one group, i.e. alcohol (2-20%), aliphatic alkanes (2-20%), alkene (2-20%), cyclodextrin (2-20%), formula R ₁(COO) R ₂Fatty acid ester (2-20%) or R ₃(NH) (CO) R ₄Acid amides or lactan (2-15%), formula (SiR ₅R ₆R ₇) N(SiR ₈R ₉R ₁₀),

（SiR ₅R ₆R ₇）-（SiR ₈R ₉R ₁₀）、

(SiR ₅R ₆R ₇) O(SiR ₈R ₉R ₁₀) or

(SiR ₅R ₆O) (SiR ₇R ₈O) (SiR ₉R ₁₀O) organosilane (2-20%), DMSO and the merging volume that is selected from the compound in this group are no more than the 30%(V/V of testing liquid),

R wherein ₁, R ₂, R ₃, R ₄, R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Be moieties, R ₁And R ₂Can covalent attachment become ring structure, R ₃And R ₄Also can covalent attachment become ring structure, and the per-cent that indicates in the bracket after the compound is meant the compound concentrations with per-cent (V/V) expression that accounts for testing liquid.

14, according to the method for claim 13, wherein alcohol has 2 to 40 carbon atoms; Aliphatic alkanes has 10 to 60 carbon atoms; Alkene has 10 to 60 carbon atoms; R ₁Add R ₂Have 3 to 20 carbon atoms together, if R ₁And R ₂When not having covalently bound formation ring, R ₁And R ₂At least 1 carbon atom is respectively arranged; R ₃Add R ₄2 to 20 carbon atoms are arranged together, as R ₃And R ₄There is not covalently bound formation ring, then R ₃And R ₄At least 1 carbon atom is respectively arranged; R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀At least 1 carbon atom is respectively arranged; These 6 alkyl carbon structures, R ₅, R ₆, R ₇, R ₈, R ₉And R ₁₀Be no more than 20 carbon atoms together.

15, according to the method for claim 12, wherein except DMSO, alkane or alkene, also have a kind of other compounds that are selected from this group at least.

16, according to the method for claim 15, comprising alkane and at least a other compounds that are selected from this group.

17, measure the method for the amount of target molecule in the biological entities, this method may further comprise the steps:

(1) fluorescent probe of biological entities in solution is incubated,

(2) from solution, remove biological entities,

(3) make biological entities in the exposure of the absorbing wavelength place of fluorescent probe, and

(4) measurement is with the amount of the light of the emission wavelength emission of fluorescent probe;

Wherein after step (1) beginning and before step (4) termination, in being suspended with the solution of biological entities, exist and reduce the background compound.

Wherein said biological entities is cell or virus,

Said reduction background compound contains the absorb light part that structure is different from the fluorescence dye part of fluorescent probe,

Said reduction background compound has the emission wavelength that comprises fluorescent probe (in step (4) in the amount of this wavelength place measuring light) in interior absorbing wavelength scope.

18, according to the method for claim 17, wherein fluorescent probe comprises antibody moiety or nucleic acid moiety.

19,, wherein during step (4), exist and reduce the background compound according to the method for claim 17.

20, according to the method for claim 17, between the described step of claim (2) and (3), this method further comprises a step of washing cell in no probe solution.

21, according to the method for claim 17, its middle probe comprises the single-chain nucleic acid part.

22, according to the method for claim 17, wherein the fluorescent probe dyestuff comprises the fluorescein part.

23, the medicine box that comprises fluorescently-labeled probe and reduction background compound, the emission wavelength of its middle probe is identical with the absorbing wavelength that reduces the background compound.

24, fluorescence detection method, this method may further comprise the steps:

(1) make biological entities with contain can move in conjunction with in the said organism or the solution of the fluorescent probe of the target molecule on it contact, said contact is to be attached on the said target molecule with a kind of fluorescent probe that can make, thereby this probe is become finish in conjunction with the method for the probe of biological entities.

(2) this biological entities is contacted with the solution that contains radical scavenger,

(3) make biological entities bonded probe absorb the light at fluorescent absorption wavelength place of the probe of said biological entities combination, and

(4) light at the fluorescent emission wavelength place of the probe of the said biological entities combination of detection,

Wherein step (1) occurs in step (2) before, and step (2) is afterwards or during the step (2),

Wherein said biological entities is cell or virus.

25, according to the method for claim 24, wherein radical scavenger has at least 20% elimination efficiency of vitamin-E.

26, according to the method for claim 24, fluorescent probe and radical scavenger are included in the same solution, and while completing steps (1) and (2).

27, according to the method for claim 24, this method also further comprises a washing step between step (2) and (3), and said washing step is included in the no probe solution and washes biological entities.

28, according to the method for claim 24, wherein handled biological entities with stationary liquid before in step (1).

29, according to the method for claim 24, wherein fluorescent probe is that fluorescence dye and nucleic acid molecule are covalently bound.

30, according to the method for claim 29, wherein fluorescent probe has the fluorescein part.

31, according to the method for claim 29, it hits is human immunodeficiency virus RNA or DNA.

32, the solution that comprises fluorescent probe and radical scavenger, said probe comprises nucleic acid moiety or antibody moiety.

33, the medicine box that comprises fluorescent probe and radical scavenger, said probe comprises nucleic acid moiety or antibody moiety.

34, use the method for nucleic acid probe detection nucleic acid target,

Said probe comprises sub-thread nucleic acid moiety and a plurality of report thing part, and makes each said report thing part covalently bound to a middle mesic atom by shank, and mesic atom is connected between the nucleosides of said nucleic acid moiety on the phosphorus atom in this;

Said probe comprises the nucleotide sequences that is complementary to the nucleotide sequences in the said target;

Said method may further comprise the steps:

(1) probe and target are incubated in same solution together, so that their phase mutual crosses, and

Whether whether (2) exist the detection method of said report thing part to detect with a kind of detection exists and target bonded probe molecule.

35, according to the method for claim 34, it hits is in biological entities, and said biological entities is cell or virus.

36, according to the method for claim 34, its middle probe comprises the single-stranded dna part.

37,, report respectively that wherein thing has partly included ring structure, and the separation length between the phosphorus atom is two atoms at least between said ring structure and nucleosides according to the method for claim 34.

38, according to the method for claim 34, wherein separating two average nucleosides numbers of reporting the nucleic acid phosphorus atom that things partly connect is 4 at least.

39, according to the method for claim 34, wherein middle intervention atom is selected from this class atom of Sauerstoffatom, sulphur atom and nitrogen-atoms.

40, according to the method for claim 35, its middle probe comprises a plurality of report thing parts, i.e. fluorescence dye part.

41, according to the method for claim 40, wherein step (2) is used flow cytometry and is finished.

42, according to the method for claim 40, wherein step (2) is to finish by the microscope of being furnished with fluorescence detection device.

43, according to the method for claim 40, wherein fluorescence dye partly is the fluorescein part.

44, the probe that comprises sub-thread oligonucleotide molecules and a plurality of report thing part, wherein each said report thing part is covalently bound to middle mesic atom by shank, and the latter is connected to again between the nucleosides of oligonucleotide on the phosphorus atom.

45, the medicine box that is used for nucleic acid molecule in the detection of biological entity, said medicine box comprises the probe and additional being used in the solution of claim 44, make the reaction of said probe populations and said biological entities, thereby can in the molecule of probe populations and biological entities, form the reagent of crossbred molecule between the nucleic acid molecule.

46, a kind of detection method, this method may further comprise the steps:

(1) make biological entities with contain can in conjunction with in the said biological entities or the solution of the probe of the target molecule on it contact, said contact is so that thereby probe combines the method that causes probe to become biological entities bonded probe finishes with said target molecule, said probe comprises report thing group

(2) making this biological entities is that the solution of analogue contacts with containing with the structure of report thing group.

(3) finish report thing group on one or more detections and the probe that biological entities combines, but do not detect the step of the analogue that combines with biological entities,

Wherein step (1) occurs in step (2) before, and step (2) is afterwards or during the step (2).

Wherein said biological entities is cell or virus.

47,, report that wherein the thing group is a ring compound according to the method for claim 46.

48, according to the method for claim 47, wherein the loop section of ring compound comprises unsaturated link(age).

49, according to the method for claim 48, wherein ring compound is an aromatic substance.

50, according to the method for claim 46, wherein said probe comprises nucleic acid moiety or antibody moiety.

51,, probe and analogue are included in the same solution and completing steps (1) and (2) simultaneously according to the method for claim 46.

52,, report that wherein the thing group is that fluorescence part and step (3) comprise with fluorescence detection and detect said report thing group according to the method for claim 46.

53,, report that wherein the thing group can participate in chemiluminescence reaction, and said step (3) comprises with chemiluminescence detecting method and detects said report thing group according to the method for claim 46.

54, according to the method for claim 46, this method also comprises washing step between step (2) and (3), and said washing step is included in the no probe solution and washes biological entities.

55, according to the method for claim 46, wherein handled biological entities with stationary liquid before in step (1).

56, according to the method for claim 53, wherein fluorescence partly is fluorescein.

57, according to the method for claim 46, its middle probe is special to viral nucleic acid.

58, according to the method for claim 46, it hits is human immunodeficiency virus RNA or DNA.

59,, report that wherein the thing group is selected from this class material of fluorescein, texas Red, tonka bean camphor, rhodamine or rhodamine derivative, phycoerythrobilin and Peri-P according to the method for claim 52.

60,, report that wherein the thing group is fluorescein or rhodamine derivative, and analogue is the aurin or derivatives thereof according to the method for claim 59.

61,, report that wherein the thing group is that fluorescein and analogue are the aurin or derivatives thereofs according to the method for claim 60.

62, according to the method for claim 61, wherein analogue is an aurin tricarboxylic acid.

63,, report that wherein thing partly is different luminol,3-aminophthalic acid cyclic hydrazide (isoluminol) according to the method for claim 62.

64, a kind of detection method, this method may further comprise the steps:

(1) make target molecule and contain and can contact with the solution of the probe of said target molecule combination, said contact is to finish in a kind of mode that probe is attached on the said target molecule, and said probe comprises report thing group,

(2) target molecule is contacted with the solution of the analog that contains report thing group,

(3) finish report thing group on one or more detections and the probe that target molecule combines, but do not detect the step that is attached to the analogue on the biological entities,

Wherein step (1) occurs in step (2) before, and step (2) is afterwards or during the step (2).

65, the solution that includes following component:

1) contain the probe that report thing group also further comprises antibody or nucleic acid moiety, and

2) analog of said report thing group.

66, the medicine box that comprises following component:

1) comprise that report thing group also further comprises the probe of antibody or nucleic acid moiety, and

2) analog of said report thing group.

67, detect the method for bifilar nucleic acid target, this method comprises the following steps:

(1) chain of isolation of target molecules, be enough to make they separately with the nucleic acid probe hybridization with complementary nucleotide sequence;

(2) abundant isolating target chain and nucleic acid probe colony are incubated altogether, said nucleic acid probe colony comprises the nucleotide sequence molecule of another target chain that has been complementary to the molecule of a target chain and nucleotide sequence complementation, and

(3) detect the nucleic acid probe molecules of hybridizing with target molecule;

Wherein form completing steps (2) under the condition of crossbred in the nucleic acid probe molecules that each chain that allows target and nucleotide sequence wherein are complementary to this target chain;

Wherein, a total complementary sequence is arranged in the target chain for the nucleotide sequence of each probe molecule;

Wherein, each probe molecule is complementary at least one other probe molecule on nucleotide sequence top;

Wherein there is not the nucleotide sequence of two probe molecules complementary fully each other;

Wherein if a part of nucleotide sequence of a probe molecule is complementary to another probe molecule, then this partial-length is very short can not hybridize it with other probe molecules under the condition of step (2).

68, according to the method for claim 67, wherein probe molecule has such nucleotide sequence, promptly when a chain of target saturated during probe molecule, then do not form the not hybridization target chain-ordering of breach between probe molecule.

69, according to the method for claim 67, wherein two target chains are positioned in the biological entities, and wherein said biological entities is cell or virus.

70, according to claim 1,8,12,17,24,35,46 or 67 method, wherein biological entities is a cell.

71, according to claim 1,8,12,17,24,35,46 or 67 method, wherein cell is people's cell.

72, according to claim 1,8,12,17,24,35,46 or 67 method, wherein biological entities is a virus.

73, according to claim 1,8,12,17,24,35,46 or 67 method, wherein biological entities is suspended in the solution rather than is fixed on the solid phase carrier.

74, according to claim 1,8,12,17,24,35,46 or 67 method, wherein biological entities is fixed on the solid phase carrier.

75, according to claim 1,8,12,17,24,35,46 or 67 method, wherein biological entities is tissue slice or takes from the part of the Histological section of multicellular organism entity.

76, according to the method for claim 67, wherein each probe molecule all comprises detectable mark.

77, according to the method for claim 76, wherein detectable label is a luminescent dye molecule.

78, according to the method for claim 67, two nucleic acid that the target chain all is a purifying wherein.

79, according to the method for claim 78, wherein two target chains all are fixed on the solid phase carrier during this method steps (2).

80, according to the method for claim 67, wherein each probe molecule nucleotide sequence is complementary at least one other probe molecule, and length is not less than about 12 Nucleotide, but is not more than the sequence of about 100 Nucleotide.

81,0 method according to Claim 8, wherein the length that is complementary at least one other probe molecule of each probe molecule is not less than about 12 Nucleotide, but is not more than the sequence of 20 Nucleotide.

82,1 method according to Claim 8, each the probe molecule length that wherein is complementary to the sequence at least one other probe molecule is about 12 Nucleotide.

83, according to the method for claim 67, wherein the length of each probe is between 15 Nucleotide and 100 Nucleotide.

84, according to the method for claim 67, wherein the length of each probe is between about 15 Nucleotide and 40 Nucleotide.

85, according to the method for claim 67, wherein the length of each probe is about 25 Nucleotide.

86, according to the method for claim 67, wherein bifilar target tool article one target chain and second target chain, and wherein nucleotide sequence is complementary to the probe molecule of article one target chain, has the detectable label that is different from the detectable label on the probe molecule that nucleotide sequence is complementary to second target chain on the structure.

87,6 method according to Claim 8, wherein bifilar target is the DNA target, and wherein nucleotide sequence is complementary to the probe molecule of article one target chain, nucleotide sequence also is complementary to the cell RNA molecule.

88, according to claim 1,8,12,17,24,35,46 or 67 method, it hits is viral DNA or RNA.

89, nucleotide probe colony, wherein

1) length of each nucleic acid probe molecules is greatly between 15 Nucleotide and about 100 Nucleotide,

2) there is not the nucleotide sequence of probe molecule to be complementary to another probe molecule fully, and

3) each probe molecule nucleotide sequence is complementary at least one other probe molecule at least in part.

90, the medicine box of detection of biological entity amplifying nucleic acid molecule, said medicine box comprises the probe populations of claim 89, and is used in the additive reagent that makes said probe populations and the reaction of said biological entities in the solution.Thereby can make and form the crossbred molecule between the nucleic acid molecule in probe populations and the biological entities.

91, according to claim 1,8,12,17,24,35,46 or 67 method, it hits is hiv dna or RNA.