CN108823285A - A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA - Google Patents
A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA Download PDFInfo
- Publication number
- CN108823285A CN108823285A CN201810744811.0A CN201810744811A CN108823285A CN 108823285 A CN108823285 A CN 108823285A CN 201810744811 A CN201810744811 A CN 201810744811A CN 108823285 A CN108823285 A CN 108823285A
- Authority
- CN
- China
- Prior art keywords
- detection
- primer
- mutation
- egfr
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of biotechnology, disclose the Loop formula enrichment detection primer and its application of a kind of low abundance mutant DNA.The present invention connects two sections of short nucleotide sequences by one section of Loop formula structure, reach the differential amplification of saltant type and wild type using base stacking effect, the mutation of concentration down to a ten thousandth can be enriched with to 1/1 percent~ten, the detection range for reaching Sanger sequencing be sequenced it can with Sanger and combine the detection for carrying out low abundance mutation.The present invention is suitable for being mutated the detection of the low peripheral blood dissociative DNA of content, and having sampling, simply, conveniently the pain caused by sufferer is few, which has the advantages such as specificity is good, sensitivity degree is high, easy to operate, and detection cycle is short, and testing cost is low.
Description
Technical field
The present invention relates to field of biotechnology, particularly relate to a kind of Loop formula enrichment inspection of low abundance mutant DNA
Survey primer and its application.
Background technique
DNA mutation or micro allele in biological sample is detected to have in fields such as diagnosing tumor, screening and prognosis detections
It is significant.Technology currently based on PCR detection DNA mutation mainly has ARMS-PCR technology (amplification
Refractory mutation system PCR), the PCR beneficiation technologies based on digestion, the PCR beneficiation technologies based on connection,
Composite PCR beneficiation technologies (the co-amplification at of the PCR beneficiation technologies, low denaturation temperature that are hindered based on Blocker
Lower denaturation temperature PCR, COLD-PCR) and Digital round pcr etc..
Since the tissue samples of some patient with advanced cancer, such as Patients with Advanced Lung Cancer are difficult to obtain, it is detected and is caused
Certain limitation, it is therefore desirable to find the sample for being easier to obtain and be detected, such as the detection of Peripheral Circulation DNA.It is based on
Peripheral Circulation DNA and corresponding primary tumors cells are consistent in genetic specificity, can as diagnosing tumor,
The Testing index of screening and prognosis detection etc., therefore, the detection of peripheral blood dissociative DNA becomes the hot spot studied at present.
However, mutant nucleic acid content is lower in Peripheral Circulation DNA, with receptor of epidermal growth factor lung cancer (EGFR) mutation
For detection, Sanger sequencing and the sensitivity of ARMS-PCR method both methods are lower, and sequencing is only capable of detecting 5% or more
EGFR single base site mutation, ARMS-PCR method detectable 1/10th~millesimal EGFR single base site mutation,
Mutation is difficult to detect by using Sanger sequencing and ARMS-PCR method.This just needs a kind of detection skill that detection sensitivity is high
Art, currently used is Digital PCR, which can detect the mutation of one thousandth~ten a ten thousandths, but the technology according to
Bad particular instrument is detected, and testing cost is high.
Summary of the invention
In view of this, the purpose of the present invention is to provide a kind of Loop formulas of low abundance mutant DNA to be enriched with detection primer, it is special
Be not for detect EGFR mutation in L858R and T790M mutation enrichment detection primer so that the primer high sensitivity,
Specificity is good, and can effectively be enriched with and detect the mutation in sample down to a ten thousandth, can be by the mutation of a ten thousandth
Template is enriched with 100~1000 times or more；
Another object of the present invention is that providing includes the detection kit for being enriched with detection primer, it is suitable for general
Logical PCR and real-time fluorescence quantitative PCR are especially applied in L858R the and T790M abrupt climatic change in EGFR mutation；
Another object of the present invention is that the method for detecting low abundance DNA using the enrichment detection primer is provided,
Suitable for regular-PCR and real-time fluorescence quantitative PCR, especially apply in L858R the and T790M abrupt climatic change in EGFR mutation.
To achieve the goals above, the present invention provides the following technical solutions：
A kind of Loop formula enrichment detection primer of low abundance mutant DNA, including upstream primer, the upstream primer is by assisting
Primer, catenation sequence and amplimer composition, the helper primers, catenation sequence and amplimer are sequentially connected；
The helper primers length is 11-16nt, and design has the mutational site of the mutant DNA thereon, and the auxiliary is drawn
Object and the mutant DNA can complete complementary match, and wild DNA corresponding with the mutant DNA has a mutating alkali yl
It mismatches；
The amplimer length is 10-14nt, can be exactly matched with the mutant DNA and wild DNA；
The helper primers Tm value is higher than 3 DEG C of amplimer Tm value or more；Preferably more than 3-10 DEG C, more preferably higher than
3-5℃；In a specific embodiment, it may be selected to be higher than 3 DEG C, 4 DEG C, 5 DEG C, 6 DEG C, 7 DEG C, 8 DEG C, 9 DEG C or 10 DEG C.
When the enrichment detection primer is in conjunction with the mutant DNA, the amplimer bond area is located at the auxiliary
The upstream in primer binding zone domain, and 5 ' ends of the helper primers and 3 ' ends of the amplimer are in the mutant DNA
On 0-5, binding site interval base；
The catenation sequence is not combined with the mutant DNA and wild DNA.
The present invention is enriched with helper primers Tm value in detection primer and is slightly above amplimer Tm value, makes amplimer higher
Under annealing temperature, only helper primers in conjunction with template in the case where, could in conjunction with template, start amplified reaction；If auxiliary
For primer not in conjunction with template, amplimer cannot start amplified reaction since its sequence is too short in conjunction with template.From there through auxiliary
Primer is helped to reach the difference to saltant type template and wild-type template in conjunction with saltant type template and the otherness of wild-type template
Amplification；Catenation sequence connection helper primers and amplimer, when helper primers with amplimer in conjunction with template after,
The enrichment detection primer is invented in Loop formula structure.Schematic illustration is referring to Fig. 1.
Preferably, the catenation sequence is made of Oligo (dT) and C12Spacer.Wherein, C12Spacer has removed company
It is outer to connect effect, the extension of amplified production can be hindered in amplification procedure, avoids the excessive extension of complementary strand, the enrichment to next round
Effect has a negative impact.In a specific embodiment of the invention, Oligo (dT) degree of polymerization is 25-35nt；More specifically
Ground, Oligo (dT) degree of polymerization are 28nt or 32nt.
In a specific embodiment of the invention, enrichment detection primer of the present invention is the enrichment inspection for mutation EGFR
Primer is surveyed, i.e., the described helper primers length is 11-16nt, and design has the mutational site of mutation EGFR, the helper primers thereon
With the EGFR of mutation can complete complementary match, and have the mismatch of a mutating alkali yl with wild EGFR；
The amplimer length is 10-14nt, can be exactly matched with the EGFR and wild EGFR of the mutation.
Wherein, the helper primers length can be specially 11 or 15nt, and the amplimer length can be specially 11 or 12nt.
Closer, enrichment detection primer of the present invention is mutated for the L858R in EGFR mutation and T790M is prominent
Become.Then the enrichment detection primer is divided into the primer of enrichment detection T790M mutation and the primer of enrichment detection L858R mutation.?
In the primer of enrichment detection T790M mutation, the helper primers length is 11-16nt, and design thereon has the T790M of mutation EGFR prominent
Conjugate point, the helper primers and mutation EGFR can complete complementary match, and have with wild EGFR the mismatch of a mutating alkali yl；
The amplimer length is 10-14nt, can be exactly matched with the mutation EGFR and wild EGFR.
Wherein, as a specific embodiment, the sequence of the helper primers such as SEQ ID NO:Shown in 1, the expansion
Increase the sequence such as SEQ ID NO of primer:Shown in 2.
In the primer of enrichment detection L858R mutation, the helper primers length is 11-16nt, and design has mutation thereon
The mutational site L858R of EGFR, the helper primers and mutation EGFR can complete complementary match, and with wild EGFR have one it is prominent
Become the mismatch of base；
The amplimer length is 10-14nt, can be exactly matched with the mutation EGFR and wild EGFR.
Wherein, as a specific embodiment, the sequence of the helper primers such as SEQ ID NO:Shown in 3, the expansion
Increase the sequence such as SEQ ID NO of primer:Shown in 4.
Preferably, enrichment detection primer of the present invention further includes downstream primer corresponding with the upstream primer,
It can be designed according to mutant DNA template；In the present invention, the downstream primer length is in 20-25nt.Of the invention specific real
Apply in mode, when it is described enrichment detection primer be enrichment detection T790M mutation primer when (when on helper primers design have it is prominent
When becoming the mutational site T790M of EGFR), the downstream primer sequence is as such as SEQ ID NO:Shown in 5；When enrichment detection is drawn
When object is the primer of enrichment detection L858R mutation (when design has the mutational site L858R of mutation EGFR on helper primers),
The sequence of the downstream primer such as SEQ ID NO:Shown in 6.
Concentration can effectively be detected in the mutation of a ten thousandth, to a ten thousandth using present invention enrichment detection primer
Mutagenesis template can effectively be enriched with 100~1000 times or more, and not expand to wild type DNA, be expanded simultaneously using sequencing primer
Sequencing, sequencing result is consistent with testing result of the present invention, shows that enrichment detection primer specificity of the present invention is high, accuracy is high
And high sensitivity.Based on this, it is prominent in detection mutant DNA and/or preparation detection that the present invention provides the enrichment detection primers
Become the application in DNA kit.
According to application, the present invention provides a kind of kits for detecting low abundance mutant DNA, including enrichment of the present invention
Detection primer.
Preferably, the kit one or more of also comprises the following components：
Up/down is sequenced in enrichment detection amplifing reagent, mutant DNA positive quality control product, wild DNA feminine gender quality-control product, mutant DNA
Swim primer, sequencing up/down trip universal primer, sequencing amplifing reagent.
Wherein, the enrichment detection amplifing reagent is：0.5mM dNTP,4mM MgCl2、60mM NH4Cl、50mM Tris-
HCl (pH8.0), 100mM KCl, the 0.2U/ μ l archaeal dna polymerase (special construction of primer of the present invention, it is desirable that expand DNA used
Polymerase must have 5 ' → 3 ' 5 prime excision enzyme activity)；
The mutant DNA positive quality control product be the recombinant plasmid containing mutant DNA, such as T790M be mutated when, for containing
There is the recombinant plasmid of T790M mutant nucleotide sequence；It is described for the recombinant plasmid containing L858R mutant nucleotide sequence when for L858R mutation
Commercial plasmid can be used as basic plasmid, such as PUC plasmid in recombinant plasmid.
The wild DNA feminine gender quality-control product is the DNA not mutated, such as when being mutated for EGFR, is not sent out for EGFR
People's blood genomic nucleic acids of raw mutation.
The mutant DNA sequencing up/down trip primer, sequencing up/down trip universal primer are as auxiliary detected components, to logical
It crosses sequencing means and further verifies present invention enrichment testing result.Mutant DNA is sequenced up/down trip primer and is directed to via the enrichment
Loop formula amplified production design after detection primer amplification, introduces one section of suspension type sequence and universal primer in primer sequence.
In the specific embodiment of the invention, primer sequence such as SEQ ID NO is swum for the sequencing up/down of T790M mutation:
Shown in 17-18, primer sequence such as SEQ ID NO is swum for the sequencing up/down of L858R mutation:Shown in 19-20；In the sequencing/
Downstream universal primer sequence such as SEQ ID NO:Shown in 21-22.
The sequencing amplifing reagent is：0.5mM dNTP,3mM MgCl2、50mM Tris-HCl(pH8.0)、100mM
KCl, 0.2U/ μ l archaeal dna polymerase.
It can be verified by regular-PCR using mentioned reagent box, therefore the present invention corresponds to and provides a kind of side for detecting mutant DNA
Method carries out regular-PCR Enrichment Amplification using nucleic acid of the kit to sample to be tested, according to the presence or absence of electrophoretic band and combines survey
Judging DNA, whether there is or not mutations for sequence (because of the powerful enrichment of present invention enrichment detection primer, can reach the requirement for sequencing).
Wherein, the regular-PCR amplification system is：
The enrichment of 12.5 μ l detects amplifing reagent, and the enrichment detection primer of 2.5 μ l, the corresponding template of 5~10 μ l, moisturizing is extremely
25 μ l are uniformly mixed.
The regular-PCR Enrichment Amplification program：
95 DEG C of 5min are recycled 1 time；
95 DEG C of 5s, 56 DEG C of 10s, 68 DEG C of 30s are recycled 15 times；
95 DEG C of 5s, 60 DEG C of 5s, 68 DEG C of 30s are recycled 35 times；
In order to further verify present invention enrichment testing result by sequencing means, expanded in regular-PCR sequencing amplification
System is：
The sequencing amplifing reagent of 12.5 μ l, the corresponding primer component of 2.5 μ l, 5 μ l templates are (with above-mentioned regular-PCR Enrichment Amplification
1000 times of product dilution are used as template), 5 μ l of moisturizing to 25 μ l of total volume is uniformly mixed.
Amplification program is sequenced in the regular-PCR：
95 DEG C of 5min are recycled 1 time；
95 DEG C of 10s, 60 DEG C of 60s are recycled 40 times；
On the basis of mentioned reagent box component, it may also include one or more of following component (based on real-time
The kit of quantitative fluorescent PCR)：
Outer quality-control product, the mutant DNA probe for being modified with fluorescent reporter group and fluorescent quenching group, the inspection of interior Quality Control sequence
Survey up/down trip primer, the interior Quality Control Sequence Detection probe for being modified with fluorescent reporter group and fluorescent quenching group, outer Quality Control inspection
The outer Quality Control detection probe surveyed up/down trip primer, be modified with fluorescent reporter group and fluorescent quenching group.
Wherein, interior Quality Control sequence is one section of sequence that do not mutate in mutant DNA near the sequence of mutational site, effect
First is that whether judgement sample contains mutation；Second is that the gene content of Quality Control sample, i.e., for Quality Control sample to be tested it is nucleic acid-templated in
Amplification comparison is detected containing mutant DNA+wild DNA gene content, and with mutational site, obtains final detection result；Such as
When for EGFR mutation, interior quality-control product is one section sequence of the EGFR gene in addition to T790M and L858R extension increasing sequence of the present invention,
Contain the content of EGFR gene for mass controlled template, and detect amplification comparison with mutational site, obtains final detection result；At this
In invention specific embodiment, for the interior Quality Control sequence such as SEQ ID NO of EGFR mutation:Shown in 7.The interior Quality Control detection
Up/down trip primer and interior Quality Control detection probe are designed according to interior Quality Control sequence, for SEQ ID NO:Sequence shown in 7
It arranges, provides in the specific embodiment of the invention such as SEQ ID NO:Interior Quality Control detection up/down shown in 8-9 swims primer, and
Such as SEQ ID NO:Interior Quality Control detection probe shown in 10.
Outer quality-control product is the recombinant plasmid of one section of sequence of the RNaseP gene containing amplification, is used for the prepared inspection of Quality Control
Survey system whether there is problem；In the specific embodiment of the invention, one section of sequence of the RNaseP gene containing amplification
Such as SEQ ID NO:Shown in 11, while providing for the sequence such as SEQ ID NO:Outer Quality Control shown in 12-13 detects up/down
Primer is swum, and such as SEQ ID NO:Outer Quality Control detection probe shown in 14.
It is modified with the mutant DNA probe of fluorescent reporter group and fluorescent quenching group, it can be according to mutant DNA to be detected
It is designed and modifies fluorescent reporter group and quenching group, by taking T790M mutation and L858R mutation as an example, T790M mutation
Probe sequence such as SEQ ID NO:Shown in 15, the probe sequence such as SEQ ID NO of L858R mutation:Shown in 16.
Preferably, the fluorescent reporter group can be selected from FAM or JOE, the fluorescent quenching group can be selected from BHQ1Or BHQ2。
Meanwhile the kit that the present invention also provides a kind of using above-mentioned based on real-time fluorescence quantitative PCR detects mutant DNA
Method, i.e., real-time fluorescence quantitative PCR Enrichment Amplification is carried out to the nucleic acid of sample to be tested using the kit.
More specifically, the kit that the present invention provides a kind of using above-mentioned based on real-time fluorescence quantitative PCR detects mutation
The method of EGFR carries out real-time fluorescence quantitative PCR Enrichment Amplification using nucleic acid of the kit to sample to be tested, when outer Quality Control
When (PC, outer Quality Control product examine are surveyed) detection fluorescence signal Ct≤20, negative control (NC, wild DNA feminine gender quality-control product detection) detection
When as a result without S type amplification curve, when interior Quality Control (IC, interior Quality Control Sequence Detection) 10 < Ct≤22 of fluorescent assay signal, detection knot
Fruit is effective；
For the detection of T790M mutation, when Ct value-interior Quality Control of the enrichment detection primer amplification sample to be tested nucleic acid is drawn
Testing result is the positive, testing result when the Δ Ct > 13.8 when object expands the Δ Ct≤13.8 of the Ct value of sample to be tested nucleic acid
For feminine gender；For the detection of L858R mutation, as the Δ Ct≤13.2, testing result is the positive, when the Δ Ct > 13.2
Testing result is feminine gender；As interior Quality Control fluorescent assay signal Ct > 22, pattern of descriptive parts dosage is very few, need to increase template additional amount
Again it detects, as interior Quality Control fluorescent assay signal Ct < 10, it is right can be carried out appropriate dilution by pattern of descriptive parts excessive concentration for template
It detects again afterwards.
In addition, working as testing result Δ Ct > 10, especially T790M detects Δ Ct > 13.8, and L858R detects Δ Ct>13.2,
Illustrate that not containing saltant type template or its wherein is lower than one thousandth or a ten thousandth, can not directly determine it by this method
Whether the product after Loop formula primer amplification of the present invention can be surveyed again containing saltant type template in order to further confirm that
Then the amplification of sequence primer send sequencing, it is determined whether really contain mutated genes.
From the above technical scheme, the present invention connects two sections of short nucleotide sequences, benefit by one section of Loop formula structure
The mutation of concentration down to a ten thousandth, can be enriched with to hundred by the differential amplification for reaching saltant type and wild type with base stacking effect
1// mono-~ten, reach the detection range of Sanger sequencing, it is sequenced can with Sanger and combines the low abundance of progress
The detection of mutation.The present invention is suitable for being mutated the detection of the low peripheral blood dissociative DNA of content, has sampling simply, conveniently, to disease
Pain caused by trouble is few, and the detection technique is good with specificity, sensitivity degree is high, easy to operate, and detection cycle is short, testing cost
Low advantage.
Detailed description of the invention
Fig. 1 show the amplification schematic diagram of present invention enrichment detection primer；
Fig. 2 show the present invention and is directed to schematic diagram of the enrichment detection primer of T790M mutation in conjunction with template；
Fig. 3 show testing result of the T790M mutation through the present invention enrichment and not being enriched with；
Fig. 4 show the amplification curve of outer quality-control product, interior quality-control product and negative controls；
Fig. 5 show the amplification curve of T790M mutation standard items；
Fig. 6 show the amplification curve of L858R mutation standard items；
Fig. 7 show a ten thousandth sequencing result of T790M mutation and L858R mutation.
Specific embodiment
The embodiment of the invention discloses a kind of Loop formula of low abundance mutant DNA enrichment detection primer and its applications.Ability
Field technique personnel can use for reference present disclosure, be suitably modified realization of process parameters.In particular, it should be pointed out that all similar replaces
Change and change apparent to those skilled in the art, they are considered as being included in the present invention.Of the invention draws
Object and related application are described by preferred embodiment, and related personnel can obviously not depart from the content of present invention, essence
Primer as described herein and related application are modified or appropriate changes and combinations in mind and range, carry out this hair of implementation and application
Bright technology.
In a specific embodiment, the present invention is by taking the T790M mutation and L858R mutation that are mutated in EGFR as an example to the present invention
The enrichment detection primer is described in detail, but this not limit enrichment detection primer of the present invention be simply possible to use in detection dash forward
Become the T790M mutation and L858R mutation in EGFR, in the case of central principle is identical, enrichment detection primer of the present invention
The detection of any mutant DNA can be directed to.
For a further understanding of the present invention, below with reference to embodiment to a kind of low abundance mutant DNA provided by the invention
Loop formula enrichment detection primer and its application are described in detail.
Embodiment 1：The present invention detects the enrichment detection primer of T790M mutation and L858R mutation
Table 1
In table 1, T790M-Loop-F and L858R-Loop-F are that the enrichment being mutated for T790M mutation and L858R detects
Primer is wherein mutational site base at underscore；T790M-R and L858R-R is respectively corresponding downstream primer, sequence
Such as SEQ ID NO:Shown in 5-6.
In T790M-Loop-F, Oligo (dT) degree of polymerization is 32, indicates C12Spacer modification for C12,
TCATCATGCAGCTCA is auxiliary primer nucleic acid sequence (SEQ ID NO:Shown in 1), CACCGTGCAGC is amplimer nucleic acid
Sequence (SEQ ID NO:Shown in 2), and the end of amplimer 3 ' and the end of helper primers 5 ' and 0, template binding site interval base,
Schematic diagram is referring to fig. 2.
In L858R-Loop-F, Oligo (dT) degree of polymerization is that 28, C12 indicates C12Spacer modification, and GGGCGGGCCAA is
Helper primers nucleic acid sequence (SEQ ID NO:Shown in 3), GATCACAGATTT is amplimer nucleic acid sequence (SEQ ID NO:4
It is shown), and the end of amplimer 3 ' and the end of helper primers 5 ' and 1, template binding site interval base.
Embodiment 2：The present invention detects the enrichment detection kit (regular-PCR) of T790M mutation and L858R mutation
Table 2
In table 2, CX-T790M-F and CX-T790M-R are that upstream and downstream amplimer (SEQ ID NO is sequenced in T790M:17-18
It is shown), CX-L858R-F and CX-L858R-R are that upstream and downstream amplimer (SEQ ID NO is sequenced in L858R:Shown in 19-20),
CX-F and CX-R is that upstream and downstream universal primer (SEQ ID NO is sequenced in upper machine:Shown in 21-22).
It is composed of the following components for T790M and L858R mutation enrichment detection kit (regular-PCR)：T790M mutation is rich
Collect primer mixed liquor, L858R is mutated enriching primer mixed liquor, and amplimer mixed liquor is sequenced in T790M, and L858R sequencing amplification is drawn
Upstream universal primer CX-F is sequenced in object mixed liquor, and downstream universal primer CX-R is sequenced, and is mutated Enrichment Amplification reagent, sequencing amplification
Reagent, positive quality control product, negative quality-control product.
T790M is mutated enriching primer mixed liquor：For T790M-Loop-F and T790M-R mixed liquor, T790M-Loop-F exists
Concentration in system is 0.5 μM, and concentration of the T790M-R in system is 0.35 μM.
L858R is mutated enriching primer mixed liquor：For the L858R-R mixed liquor of L858R-Loop-F, wherein L858R-Loop-
F concentration in system is 0.5 μM, and L858R-R concentration in system is 0.3 μM.
Amplimer mixed liquor is sequenced in T790M：For the mixed liquor of CX-T790M-F and CX-T790M-R, two primers are in system
In concentration be 0.25 μM.
Amplimer mixed liquor is sequenced in L858R：For the mixed liquor of CX-L858R-F and CX-L858R-R, two primers are in system
In concentration be 0.25 μM.
It is mutated Enrichment Amplification reagent：0.5mM dNTP,4mM MgCl2、60mM NH4Cl、50mM Tris-HCl(pH8.0)、
100mM KCl, 0.2U/ μ l archaeal dna polymerase.
Amplifing reagent is sequenced：0.5mM dNTP,3mM MgCl2、50mM Tris-HCl(pH8.0)、100mM KCl、
0.2U/ μ l archaeal dna polymerase.
Negative quality-control product：The people's blood genomic nucleic acids not mutated for EGFR gene
Positive quality control product：Plasmid pUC-T790M-M containing T790M mutant nucleotide sequence, the plasmid containing L858R mutant nucleotide sequence
PUC-L858R-M entrusts Sangon Biotech (Shanghai) Co., Ltd.) limited liability company's synthesis.
Upstream universal primer is sequenced in upper machine：10μM CX-F.
Downstream universal primer is sequenced in upper machine：10μM CX-R.
Embodiment 3：The present invention detects the regular-PCR method of T790M mutation and L858R mutation
1, detection method
It carries out two-wheeled amplification using the kit of embodiment 2 to be detected, first round amplification carries out the richness of low abundance mutation
Collection, the second wheel amplification carry out the addition of universal sequencing primer object, prepare for the sequencing of upper machine.
The preparation of first round amplification system takes an eight townhouse PCR reaction tubes, sequentially adds 2 × detection body of 12.5 μ l
System, the corresponding primer component of 2.5 μ l, the corresponding template of 5~10 μ l, moisturizing to 25 μ l are uniformly mixed, and prepared PCR is anti-
Should pipe be placed in PCR amplification instrument and expanded.
First round amplification program：
95 DEG C of 5min are recycled 1 time
95 DEG C of 5s, 56 DEG C of 10s, 68 DEG C of 30s are recycled 15 times
95 DEG C of 5s, 60 DEG C of 5s, 68 DEG C of 30s are recycled 35 times
The preparation of second wheel amplification system, takes an eight townhouse PCR reaction tubes, and the 2 × sequencing for sequentially adding 12.5 μ l is expanded
Increasing system, the corresponding primer component of 2.5 μ l, 5 μ l templates (dilute 1000 times as template using first round amplified production), 5 μ l of moisturizing
To 25 μ l of total volume, it is uniformly mixed, configured PCR reaction tube is placed in PCR amplification instrument and is expanded.
In order to further verify present invention enrichment testing result by sequencing means
Second wheel amplification program：
95 DEG C of 5min are recycled 1 time
95 DEG C of 10s, 60 DEG C of 60s are recycled 40 times
Then, the agarose gel electrophoresis that the second wheel amplified production is carried out to 0.8%, will there is the amplified production of amplified band
It send Beijing Qing Kexin industry Bioisystech Co., Ltd to be sequenced, sequencing result is analyzed.
2, sensitivity and specificity detect
Positive quality control product pUC-T790M and pUC-L858R-M plasmid is diluted to 10000 copies/μ l.Negative charging product are dilute
It releases to 10000 copies/μ l.The negative quality-control product diluted and positive quality control product are mixed in following ratios, preparation is corresponding
The reference material of concentration, positive quality control product and negative quality-control product mixed proportion 0:100 (pure wild types), 0.01:99.99 (ten thousand/
One), 0.1:99.9 (one thousandths), 1:99 (1 percent), 10:90 (1/10th), 100:0 (pure saltant type), and not
With sequencing sequencing control test concentration 5:95 (5 percent), 20:80 (20 percent), 40:60 (40 percent), 60:
40 (60 percent) isoconcentrations.
The corresponding amplifing reagent of 2 kit of embodiment is prepared according to above-mentioned detection method, takes the reaction tube of respective reaction number
Sequentially add the mutation enrichment detection amplifing reagent of 12.5 μ l, the corresponding primer mixed liquor of 2.5 μ l, the distilled water of 5 μ l, 5 μ l
Corresponding template.The amplification of various concentration standard items is carried out simultaneously, and it is pure wild type, ten thousand that a wheel, which expands standard concentration used,
/ mono-, one thousandth and 1 percent and pure wild type and pure saltant type template control.In order to guarantee experimental result
The each sample of accuracy does 3 repetitions simultaneously and detects.Above-mentioned prepared amplification system is placed in PCR instrument and carries out amplification inspection
It surveys.
First round amplification program is as follows:
95℃5min；
95 DEG C of 5s, 56 DEG C of 10s, 68 DEG C of 30s are recycled 15 times；
95 DEG C of 5s, 60 DEG C of 5s, 68 DEG C of 30s are recycled 35 times；
Above-mentioned amplified production is diluted into 100 times of templates as the second wheel amplification, while using concentration for a ten thousandth, thousand
/ mono-, 1 percent, 5 percent, 10,20 percent, 40 percent, 60 percent standard items are made
For control, is expanded simultaneously with detection sample, then send amplified production to sequencing, sequencing result is analyzed.
Interpretation of result
Sample sequencing result is compared with control group sequencing result, discovery concentration passes through this in the mutation of a ten thousandth
After the technology enrichment of invention, concentration is up to 5 percent or more, and enrichment times are at 100 times or more.Sequencing result such as Fig. 3 institute
Show, the sequencing result compareed after being enriched with for the T790M first round with without first round amplification enrichment.By experimental group and control group
Comparison reaches it can be seen that saltant type concentration from original a ten thousandth becomes > 5% after method enrichment of the invention
The detection range of Sanger sequencing.
Thus, it is possible to find out that the enrichment to low abundance mutagenesis template may be implemented in present invention enrichment detection primer.By pure open country
Raw type testing result can be seen that detection technique specificity of the invention is good, can detect under higher wild type concentration lower
Saltant type.From this it can be concluded that enrichment detection primer detection sensitivity of the invention is high, specific good, detection time
It is short, it is at low cost.
3, clinical sample detects
The plasma sample of 30 patients with lung cancer is acquired, wherein having determined that the T790M that 11 are EGFR gene is mutated, 12 are
The L858R of EGFR gene is mutated, remaining 7 unknown for other mutation or the cause of disease, this 30 Plasma of The Patients With Lung Cancer sample standard deviations pick up from
Tiantan Hospital.The sample of acquisition is subjected to nucleic acid extraction using Qiagen kit.Then the method according to the invention is examined
It surveys, and is compared with testing result before, result is as shown in table 3 below.
Table 3
Enrichment detection technique of the invention is used it can be seen from the table, testing result is as shown in Table, it can be seen that
Testing result of the invention and the detection technique testing result used before hospital are almost the same, and testing result is T790M before
(+), be also T790M (+) using technology detection of the invention, hospital is detected as L858R (+), using technology of the invention
Testing result is also L858R (+), in the sample of unknown mutation, detects 1 T790M mutation and 1 using the present invention
L858R mutation.Confirm through a variety of methods, which contains low-abundance corresponding mutation really.It can thus be seen that this hair
Bright detection sensitivity is higher than ARMS-PCR detection technique used in current hospital, and can be to low-abundance prominent by this technology
The effective enrichment for this progress saltant type template of changing, enrichment times are up to 100~1000 times or more.
Embodiment 4：The present invention detects the enrichment detection kit (real time fluorescent quantitative of T790M mutation and L858R mutation
PCR)
Table 4
In table 4, probe T790M-P, 5 ' it is terminal modified have a fluorescent reporter group FAM, 3 ' terminal modified have fluorescent quenching group
BHQ1；Probe L858R-P, 5 ' it is terminal modified have a fluorescent reporter group FAM, 3 ' terminal modified have fluorescent quenching group BHQ1；Probe I C-
P, 5 ' it is terminal modified have a fluorescent reporter group JOE, 3 ' terminal modified have fluorescent quenching group BHQ2；Probe RNP-P, 5 ' it is terminal modified have it is glimmering
Light reporter group FAM, 3 ' terminal modified have fluorescent quenching group BHQ1。
Kit for T790M and L858R mutation enrichment detection is composed of the following components：The mixing of T790M detection primer
Amplimer mixed liquor, L858R sequencing amplification is sequenced in liquid, L858R detection primer mixed liquor, outer Quality Control primer mixed liquor, T790M
Primer mixed liquor, mutation enrichment detection reagent, is sequenced amplifing reagent, general upstream primer CX-F is sequenced, general downstream is sequenced and draws
Object CX-R, outer quality-control product, positive quality control product, negative quality-control product, each group are grouped as described below.
T790M detection primer mixed liquor group becomes：T790M-Loop-F, T790M-R and T790M-P and interior Quality Control primer
IC-F, IC-R and IC-P.Wherein, T790M-Loop-F concentration in system is 0.5 μM, and T790M-R concentration in system is 0.3
μM, T790M-P concentration in system is 0.25 μM, and IC-F concentration in system is 0.25 μM, and IC-R concentration in system is
0.25 μM, IC-P concentration in system is 0.2 μM.
L858R detection primer mixed liquor group becomes：L858R-Loop-F, L858R-R and L858R-P and interior Quality Control primer
The mixed liquor of IC-F, IC-R and IC-P, wherein L858R-Loop-F concentration in system is 0.5 μM, and L858R-R is dense in system
Degree is 0.3 μM, and L858R-P concentration in system is 0.25 μM, and IC-F concentration in system is 0.25 μM, and IC-R is dense in system
Degree is 0.25 μM, and IC-P concentration in system is 0.2 μM.
T790M sequencing amplimer mixed liquor group becomes：CX-T790M-F and CX-T790M-R, its concentration point in system
It Wei not 0.2 μM of CX-T790M-F, 0.2 μM of CX-T790M-R.
L858R sequencing amplimer mixed liquor group becomes：CX-L858R-F and CX-L858R-R, its concentration point in system
It Wei not 0.2 μM of CX-L858R-F, 0.2 μM of CX-L858R-R.
General upstream primer is sequenced：10μM CX-F；
General reverse primer is sequenced：10μM CX-R；
Abrupt climatic change reagent set becomes：0.5mM dNTP,4mM MgCl2、60mM NH4Cl、50mM Tris-HCl
(pH8.0), 100mM KCl, 0.2U/ μ l archaeal dna polymerase.
Sequencing amplifing reagent group becomes：0.5mM dNTP,3mM MgCl2、50mM Tris-HCl(pH8.0)、100mM
KCl, 0.2U/ μ l archaeal dna polymerase.
Outer quality-control product：For the recombinant plasmid pUC-RNP containing following sequences：GCAGATTTGGACCTGCGAGCGGGTTCTG
ACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACC(SEQ ID NO:11)；
Negative quality-control product：It is EGFR based on the people's blood genomic nucleic acids not mutated
Positive quality control product：Plasmid pUC-T790M-M containing T790M mutant nucleotide sequence and the matter containing L858R mutant nucleotide sequence
Grain pUC-L858R-M.
Interior Quality Control sequence：TATCTCAACACTGTCCAGCCCACCTGTGTCAACAGCACATTCGACAGCCCTGCCCACT
GGGCCCAGAAAGGCAGCCACCAAATTAGCCTGGACAACCCTGACTACCAGCAGGACTTCTTTCCCAAGGAAGCCAAG
CCAAATGGCATCTTTAAGGGCTC(SEQ ID NO:7)
Embodiment 5：The present invention detects the real time fluorescence quantifying PCR method of T790M mutation and L858R mutation
1, detection method
Using 4 kit of embodiment, suitable eight townhouses PCR reaction tube is taken according to experiment demand, sequentially adds 12.5 μ l
Enrichment detection reagent, the corresponding primer component of 2.5 μ l, 5~10 corresponding templates of μ l, moisturizing to 25 μ l, be uniformly mixed, upper machine
It is detected, the detection carried out using 7500 real-time fluorescence PCR instrument of ABI.It is glimmering that pattern detection selects FAM and JOE binary channels to carry out
Light collection, outer Quality Control detect and select the channel FAM and carry out fluorescence signal acquisition, and it is logical that positive control and negative control detect and select FAM
Road carries out fluorescent collecting.It is as described below that Enrichment Amplification detects program：
95 DEG C of 5min are recycled 1 time；
95 DEG C of 5s, 56 DEG C of 10s, 68 DEG C of 30s are recycled 15 times；
95 DEG C of 5s, 60 DEG C of 5s, 68 DEG C of 30s (acquisition fluorescence), recycle 35 times.
Detection time only needs 90min that detection can be completed.
As a result interpretation
Detection is both needed to carry out outer Quality Control detection and positive control and negative control detection simultaneously every time.Outer Quality Control positive inspection
Survey fluorescent collecting channel is FAM, and two channels pattern detection simultaneous selection FAM and JOE are into fluorescence signal acquisition.When outer Quality Control
(PC) when detecting FAM signal Ct≤20, when negative control (NC) testing result is without S type amplification curve, interior Quality Control (IC) JOE detection
When 10 < Ct≤22 of signal, testing result is effective, for the detection of T790M mutation, when Δ Ct (detection-interior Quality Control)≤13.8
Testing result is the positive, and testing result is feminine gender when Δ Ct > 13.8；For the detection of L858R mutation, when Δ Ct (detection-interior
Quality Control)≤13.2 when testing result be the positive, testing result is feminine gender when Δ Ct > 13.2.When interior Quality Control JOE detects signal Ct
When > 22, pattern of descriptive parts dosage is very few, need to increase template additional amount and detect again, when interior Quality Control JOE detects signal Ct < 10,
Template can be carried out appropriate dilution and then detected again by pattern of descriptive parts excessive concentration.
Enrichment detection technique of the invention differs greatly to the amplification of saltant type and wild-type template, and detection process is simultaneously
It is also the enrichment process to saltant type template, so, as testing result Δ Ct > 10, especially as T790M abrupt climatic change >
When 13.8, L858R abrupt climatic change > 13.2, auxiliary detection is carried out using Sanger sequencing, duplicate acknowledgment is carried out to result,
Specific practice is that amplified production is diluted 100~1000 times to be used as template, and amplimer is sequenced using T790M or L858R is sequenced
Amplimer and sequencing amplifing reagent expanded, amplification program be 95 DEG C of 5min, 95 DEG C of 10s, 60 DEG C of 60s, recycle 30 times, so
Amplified production is subjected to Sanger sequencing with sequencing universal primer CX-F and CX-R afterwards.According in sequencing result judgement sample whether
It is mutated containing T790M or L858R.
2, sensitivity and specificity
The corresponding amplification system of 3 kit of embodiment is prepared according to the method described above, takes the reaction tube of respective reaction number successively
The enrichment detection amplifing reagent of 12.5 μ l is added, the corresponding primer mixed liquor of 2.5 μ l, the distilled water of 5 μ l, 5 μ l's is corresponding
Template.Various concentration standard items, positive control, negative control, outer Quality Control and the detection of Inner Quality Control are carried out simultaneously, in order to guarantee
The each sample of the accuracy of experimental result does 3 repetitions simultaneously and detects.Above-mentioned prepared amplification system is placed in real-time fluorescence
Enrichment Amplification detection is carried out in PCR instrument.
Enrichment Amplification program is as follows:
95℃5min；
95 DEG C of 5s, 56 DEG C of 10s, 68 DEG C of 30s are recycled 15 times；
95 DEG C of 5s, 60 DEG C of 5s, 68 DEG C of 30s (acquisition fluorescence), recycle 35 times；
Ct value after record amplification, then carries out data analysis, and testing result is as Figure 4-Figure 6, and Fig. 4 is control group inspection
It surveys as a result, it is that 18.8, L858R positive control Ct mean value is that wherein outer Quality Control Ct mean value, which is 14.3, T790M positive control Ct mean value,
18.2, for negative control without amplification curve, interior Quality Control Ct mean value is that 19.1 < 22 meet the requirements.
Fig. 5 is T790M concentration standards amplification curve, wherein the pattern detection Ct mean value of pure saltant type is 18.8, very
One of pattern detection Ct mean value be 22.4, Δ Ct (1/10th-IC)=3.3；Centesimal pattern detection Ct mean value is
25.2, Δ Ct (1 percent-IC)=6.1；Millesimal pattern detection Ct mean value is 28.8, Δ Ct (one thousandth-IC)
=9.7, the pattern detection Ct mean value of a ten thousandth is 31.2, Δ Ct (a ten thousandth-IC)=12.1；The sample of pure wild type without
Amplification curve, result are feminine gender.
Fig. 6 is L858R concentration standards amplification curve, wherein the pattern detection Ct mean value of pure saltant type is 18.2, very
One of pattern detection Ct mean value be 21.6, Δ Ct (1/10th-IC)=2.5；Centesimal pattern detection Ct mean value is
24.8, Δ Ct (1 percent-IC)=5.7；Millesimal pattern detection Ct mean value is 27.9, Δ Ct (one thousandth-IC)
=8.8, the pattern detection Ct mean value of a ten thousandth is 31.1, Δ Ct (a ten thousandth-IC)=12；The sample of pure wild type is without expansion
Increase curve, result is feminine gender.
Since a ten thousandth detects Δ Ct=12 or 12.1 > 10, so by the amplified production of 6 samples of a ten thousandth
Then 1000 times of dilution is expanded with corresponding sequencing amplimer mixed liquor and sequencing amplifing reagent, amplified production is carried out
Sanger sequencing, as a result as shown in Figure 7, it can be seen that T790M or L858R mutation is implicitly present in sample, and by the present invention
Detection method amplification after be enriched with, reached Sanger sequencing detection range.It can be seen that the present invention can
The detection of low abundance mutation is carried out, and low abundance template can be enriched with.This hair can be seen that by pure wild type testing result
Bright enrichment detection primer specificity is good, can detect lower saltant type under higher wild type concentration.It is possible thereby to
Conclusion out, enrichment detection primer detection sensitivity of the invention is high, and specificity is good, and detection time is short, at low cost.
3, clinical detection
The plasma sample of 25 patients with lung cancer is acquired, wherein having determined that 9 are mutated for EGFR gene T790M, 10 are
EGFR gene L858R mutation, remaining 6 unknown for other mutation or the cause of disease, this 25 Plasma of The Patients With Lung Cancer sample standard deviations pick up from depth
Third the People's Hospital of ditch between fields city.The sample of acquisition is subjected to nucleic acid extraction using Qiagen nucleic acid extraction kit.Then according to this
The method of invention is detected, and is compared with testing result before, and result is as shown in table 5 below.
Table 5
Detection technique of the invention is used it can be seen from the table, wherein its Δ Ct is small in 9 T790M positive samples
In 13.8, testing result is the positive, is 100% with hospital's testing result positive coincidence rate；Δ Ct in 10 L858R positive samples
Respectively less than 13.2, testing result is the positive, is 100% with hospital's testing result positive coincidence rate.6 other mutation or it is unknown
In the sample of mutation, 1 L858R mutation is detected, Δ Ct=12.8 < 13.2 can determine that as the L858R positive, by 4
T790M detects Δ Ct>10 samples, 2 L858R detect Δ Ct>L858R detects Δ Ct in 10 sample and 1 negative sample
>The amplified production of 10 samples dilutes 1000 times and is used as template, is expanded, will be expanded using the sequencing primer that this kit provides
Product send sequencing company to be sequenced, and sequencing result shows containing corresponding mutation.Illustrate that the present invention is with higher sensitive
Degree, can detect that low-abundance nucleic acid mutation in sample.
The above description of the embodiment is only used to help understand the method for the present invention and its core ideas.It should be pointed out that pair
For those skilled in the art, without departing from the principle of the present invention, the present invention can also be carried out
Some improvements and modifications, these improvements and modifications also fall within the scope of protection of the claims of the present invention.
Sequence table
<110>Capitalbio Corporation Co., Ltd.
<120>A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA
<130> MP1805295
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 15
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
tcatcatgca gctca 15
<210> 2
<211> 11
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
caccgtgcag c 11
<210> 3
<211> 11
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gggcgggcca a 11
<210> 4
<211> 12
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gatcacagat tt 12
<210> 5
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
aggagcgcag accgcatgtg aggat 25
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
gctgcgagct cacccagaat gt 22
<210> 7
<211> 158
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
tatctcaaca ctgtccagcc cacctgtgtc aacagcacat tcgacagccc tgcccactgg 60
gcccagaaag gcagccacca aattagcctg gacaaccctg actaccagca ggacttcttt 120
cccaaggaag ccaagccaaa tggcatcttt aagggctc 158
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
tatctcaaca ctgtccagcc ca 22
<210> 9
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
gagcccttaa agatgccatt tg 22
<210> 10
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
cagcacattc gacagccctg cccactgg 28
<210> 11
<211> 70
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
gcagatttgg acctgcgagc gggttctgac ctgaaggctc tgcgcggact tgtggagaca 60
gccgctcacc 70
<210> 12
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
agatttggac ctgcgagcg 19
<210> 13
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
gagcggctgt ctccacaagt 20
<210> 14
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
ttctgacctg aaggctctgc gcg 23
<210> 15
<211> 27
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
ggactatgtc cgggaacaca aagacaa 27
<210> 16
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
actgctgggt gcggaagaga aagaatac 28
<210> 17
<211> 54
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
ttaatacgac tcactatagg ggaattgtga gcggatacac cgtgcagctc atca 54
<210> 18
<211> 45
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
tgctagttat tgctcagcgg aggagcgcag accgcatgtg aggat 45
<210> 19
<211> 68
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
ttaatacgac tcactatagg ggaattgtga gcggataaca attcccatgt caagatcaca 60
gattttgg 68
<210> 20
<211> 45
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
tgctagttat tgctcagcgg cctcattcac tgtcccagca agtac 45
<210> 21
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 21
taatacgact cactataggg 20
<210> 22
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 22
gctagttatt gctcagcgg 19
Claims (19)
1. a kind of Loop formula of low abundance mutant DNA is enriched with detection primer, which is characterized in that including upstream primer, the upstream
Primer is made of helper primers, catenation sequence and amplimer, and the helper primers, catenation sequence and amplimer successively connect
It connects；
The helper primers length is 11-16nt, and design thereon has the mutational site of the mutant DNA, the helper primers with
The mutant DNA can complete complementary pairing, and wild DNA corresponding with the mutant DNA have a mutating alkali yl not
Match；
The amplimer length is 10-14nt, can be exactly matched with the mutant DNA and wild DNA；
The helper primers Tm value is higher than 3 DEG C of amplimer Tm value or more；
When the enrichment detection primer is in conjunction with the mutant DNA, the amplimer bond area is located at the helper primers
The upstream of bond area, and 5 ' ends of the helper primers and 3 ' ends of the amplimer are on the mutant DNA
0-5, binding site interval base；
The catenation sequence is not combined with the mutant DNA and wild DNA.
2. being enriched with detection primer according to claim 1, which is characterized in that the catenation sequence by Oligo (dT) and
C12Spacer composition.
3. being enriched with detection primer according to claim 2, which is characterized in that Oligo (dT) degree of polymerization is 25-35nt.
4. being enriched with detection primer according to claim 1, which is characterized in that the helper primers length is 11-16nt, thereon
Design has a mutational site of mutation EGFR, the EGFR of the helper primers and mutation can complete complementary match, and with wild EGFR
There is the mismatch of a mutating alkali yl；
The amplimer length is 10-14nt, can be exactly matched with the EGFR and wild EGFR of the mutation.
5. being enriched with detection primer according to claim 4, which is characterized in that the helper primers length is 11-16nt, thereon
Design have mutation EGFR the mutational site T790M, the helper primers and mutation EGFR can complete complementary match, and with it is wild
EGFR has the mismatch of a mutating alkali yl；
The amplimer length is 10-14nt, can be exactly matched with the mutation EGFR and wild EGFR.
6. being enriched with detection primer according to claim 5, which is characterized in that the sequence of the helper primers such as SEQ ID NO:
Shown in 1.
7. being enriched with detection primer according to claim 5, which is characterized in that the sequence of the amplimer such as SEQ ID NO:
Shown in 2.
8. being enriched with detection primer according to claim 4, which is characterized in that the helper primers length is 11-16nt, thereon
Design have mutation EGFR the mutational site L858R, the helper primers and mutation EGFR can complete complementary match, and with it is wild
EGFR has the mismatch of a mutating alkali yl；
The amplimer length is 10-14nt, can be exactly matched with the mutation EGFR and wild EGFR.
9. being enriched with detection primer according to claim 8, which is characterized in that the sequence of the helper primers such as SEQ ID NO:
Shown in 3.
10. being enriched with detection primer according to claim 8, which is characterized in that the sequence of the amplimer such as SEQ ID
NO:Shown in 4.
11. being enriched with detection primer described in -10 any one according to claim 1, which is characterized in that further include downstream primer.
12. being enriched with detection primer according to claim 11, which is characterized in that when design has mutation EGFR's on helper primers
When the mutational site T790M, the sequence of the downstream primer such as SEQ ID NO:Shown in 5.
13. being enriched with detection primer according to claim 11, which is characterized in that when design has mutation EGFR's on helper primers
When the mutational site L858R, the sequence of the downstream primer such as SEQ ID NO:Shown in 6.
14. enrichment detection primer described in claim 1-13 any one is in detection mutant DNA and/or preparation detection mutant DNA
Application in kit.
15. a kind of kit for detecting low abundance mutant DNA, which is characterized in that including described in claim 1-13 any one
It is enriched with detection primer.
One or more of 16. kit according to claim 15, which is characterized in that also comprise the following components：
Enrichment detection amplifing reagent, mutant DNA positive quality control product, wild DNA feminine gender quality-control product, mutant DNA sequencing up/down trip are drawn
Object, sequencing up/down trip universal primer, sequencing amplifing reagent.
One or more of 17. 6 kit according to claim 1, which is characterized in that also comprise the following components：
Outer quality-control product, the mutant DNA probe for being modified with fluorescent reporter group and fluorescent quenching group, interior Quality Control Sequence Detection
Up/down swims primer, the interior Quality Control Sequence Detection probe for being modified with fluorescent reporter group and fluorescent quenching group, outer Quality Control detection
Up/down trip primer, the outer Quality Control detection probe for being modified with fluorescent reporter group and fluorescent quenching group.
18. a kind of method for detecting mutant DNA, which is characterized in that treat test sample using the kit of claim 15 or 16
This nucleic acid carries out regular-PCR Enrichment Amplification, is judged and combined with sequencing to judge DNA whether there is or not hairs according to the presence or absence of electrophoretic band
Raw mutation.
19. a kind of method for detecting mutant DNA, which is characterized in that using kit described in claim 17 to sample to be tested
Nucleic acid carries out real-time fluorescence quantitative PCR Enrichment Amplification, when outer Quality Control detects fluorescence signal Ct≤20, negative control testing result
When without S type amplification curve, when interior 10 < Ct≤22 of Quality Control fluorescent assay signal, testing result is effective；
For the detection of T790M mutation, when Ct value-interior Quality Control primer of the enrichment detection primer amplification sample to be tested nucleic acid expands
Testing result is the positive when increasing the Δ Ct≤13.8 of the Ct value of sample to be tested nucleic acid, and testing result is yin when the Δ Ct > 13.8
Property；For the detection of L858R mutation, as the Δ Ct≤13.2, testing result is the positive, and when Δ Ct > 13.2 is detected
It as a result is feminine gender；As interior Quality Control fluorescent assay signal Ct > 22, pattern of descriptive parts dosage is very few, need to increase template additional amount again
Detection, as interior Quality Control fluorescent assay signal Ct < 10, template can be carried out appropriate dilution then weight by pattern of descriptive parts excessive concentration
New detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810744811.0A CN108823285A (en) | 2018-07-09 | 2018-07-09 | A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810744811.0A CN108823285A (en) | 2018-07-09 | 2018-07-09 | A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108823285A true CN108823285A (en) | 2018-11-16 |
Family
ID=64136513
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810744811.0A Pending CN108823285A (en) | 2018-07-09 | 2018-07-09 | A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108823285A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110343745A (en) * | 2019-06-09 | 2019-10-18 | 陈超 | A kind of super quick detection kit of EGFR/L858R mutation |
| CN112301111A (en) * | 2019-07-25 | 2021-02-02 | 北京丰特云基科技发展有限公司 | Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity |
| CN117821625A (en) * | 2023-12-29 | 2024-04-05 | 中国医学科学院皮肤病医院(中国医学科学院皮肤病研究所) | Primer probe, kit, detection method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755388A (en) * | 2016-11-24 | 2017-05-31 | 厦门艾德生物医药科技股份有限公司 | A kind of improved ARMS primer constructions (Super ARMS) and its application method |
-
2018
- 2018-07-09 CN CN201810744811.0A patent/CN108823285A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755388A (en) * | 2016-11-24 | 2017-05-31 | 厦门艾德生物医药科技股份有限公司 | A kind of improved ARMS primer constructions (Super ARMS) and its application method |
Non-Patent Citations (2)
| Title |
|---|
| DIANA Y. VARGAS等: "Multiplex Real-Time PCR Assays that Measure the Abundance of Extremely Rare Mutations Associated with Cancer", 《PLOS ONE》 * |
| 黄铭珊等: "建立一种EGFR突变检测的凸环引物荧光PCR新方法", 《分子诊断与治疗杂志》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110343745A (en) * | 2019-06-09 | 2019-10-18 | 陈超 | A kind of super quick detection kit of EGFR/L858R mutation |
| CN112301111A (en) * | 2019-07-25 | 2021-02-02 | 北京丰特云基科技发展有限公司 | Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity |
| CN112301111B (en) * | 2019-07-25 | 2023-07-07 | 杭州梓晶生物有限公司 | Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity |
| CN117821625A (en) * | 2023-12-29 | 2024-04-05 | 中国医学科学院皮肤病医院(中国医学科学院皮肤病研究所) | Primer probe, kit, detection method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106520931B (en) | EGFR genetic mutation detection primer probe and its kit | |
| CN108949990B (en) | Kit and method for detecting EGFR gene mutation | |
| CN110904239B (en) | Detection kit and detection method for lung cancer related molecular marker gene mutation | |
| CN108823285A (en) | A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA | |
| CN102888466A (en) | KRAS gene mutation detection kit and detection method | |
| CN110951843A (en) | Kit and method for detecting HER2 copy number variation of CTCs based on ddPCR | |
| CN110241215A (en) | A kind of primer, kit and detection method to make a variation for detecting Benign Thyroid Nodules tumor- associated gene | |
| CN104818340B (en) | Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms | |
| CN106497916A (en) | A kind of construction method in the NK cell polygenic variations library for high-flux sequence detection and its application | |
| CN108531598A (en) | ROS1 Gene Fusions detection primer, method and kit | |
| CN113373223A (en) | CRISPR-Cas system for FLT3-D835Y mutation detection and application thereof | |
| CN108531600A (en) | A kind of specific primer and probe and kit for detecting the T790M mutation of peripheral blood EGFR gene | |
| CN110438206B (en) | Set of primers, probes and kit for detecting EGFR gene 19 exon deletion mutation | |
| CN107937524A (en) | Mankind's KRAS gene mutation detection kit and detection method | |
| CN108165629A (en) | A kind of DNA point mutation quantitative detecting method | |
| CN109321569B (en) | Primer probe composition and application thereof | |
| CN102925559A (en) | Kit for quantitatively detecting W515 site mutation of MPL genes | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| CN108913774A (en) | C-KIT somatic mutation gene detection KIT and detection method thereof | |
| CN109266723A (en) | Rare mutation detection method, its kit and application | |
| CN115011695A (en) | Multiple cancer species identification marker based on free circular DNA gene, kit and application | |
| CN108330171A (en) | Detect kit, the method and its application of the 19th exon deletion mutation of EGFR gene | |
| CN114196740A (en) | Digital amplification detection method, detection product and detection kit for simultaneously identifying multiple gene types | |
| CN108795930B (en) | Enrichment technology for low-abundance DNA mutation and application thereof | |
| CN109251980A (en) | Bladder Cancer T cell spectrum model and its construction method and building system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181116 |
|
| RJ01 | Rejection of invention patent application after publication |