CN112301111B - Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity - Google Patents
Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity Download PDFInfo
- Publication number
- CN112301111B CN112301111B CN201910675931.4A CN201910675931A CN112301111B CN 112301111 B CN112301111 B CN 112301111B CN 201910675931 A CN201910675931 A CN 201910675931A CN 112301111 B CN112301111 B CN 112301111B
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- mutation
- intramolecular
- arms
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an intramolecular occlusion ARMS with ultrahigh mutation detection sensitivity. The invention provides an intramolecular blocking ARMS primer, which consists of a universal primer (which is reversely complementary with a template sequence at the downstream of a mutation position) and a mutation site recognition primer formed by connecting a wild type blocking sequence (a base at the corresponding mutation position is a wild type base, the rest bases are matched with the template sequence, and if the 3' -end of the wild type blocking sequence is free, the wild type blocking sequence is blocked) with the mutation site recognition primer (the first base at the 3' -end is a mutation base at the mutation position, the 2 nd base at the 3' -end is provided with a mismatch base, and the rest bases are matched with the template sequence). The method has higher mutation detection sensitivity, can realize stable detection of the gene mutation with mutation rate of one ten thousandth, is hopeful to be applied to liquid biopsy, simplifies the complexity of operation, reduces the cost and improves the detection universality.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to an intramolecular occlusion ARMS with ultrahigh mutation detection sensitivity.
Background
The evolving Nature of tumors makes tumors very difficult to treat, and the evolution of tumors is closely related to mutations in some key genes and the progressive accumulation of these mutations [ Ding L, getz G, wheeler D A, et al Somatic mutations affect key pathways in lung adenocarcinoma [ J ]. Nature,2008,455 (7216):1069-1075.Paez J G,Janne P A,Lee J C,et al.EGFR mutations in lung cancer:Correlation with clinical response to gefitinib therapy[J ]. Science,2004,304 (5676):1497-1500.Cairns J.Mutation selection and the natural history of cancer[J ]. Nature,1975,255 (5505):197-200 ], such as genes EGFR, KRAS, BRAF and PIK3 CA. In recent years, there have been a number of clinical studies demonstrating significant correlation between DNA in blood and tumor genomic DNA, and thus detection of mutant genes in blood has been considered to have important clinical application values [ Murtaza M, dawson S J, tsui D W Y, et al, no-invasive analysis of acquired resistance to cancer therapy by sequencing of plasma DNA [ J ]. Nature,2013,497 (7447):108-112.Diaz L A,Bardelli A.Liquid Biopsies:Genotyping Circulating Tumor DNA[J ]. Journal of Clinical Oncology,2014,32 (6): 579- + ]. The current widely adopted biological biopsy technology needs to be punctured and sampled, and the sampling difficulty is high. The diagnosis of tumor markers such as circulating tumor DNA, circulating tumor cells and exosomes in liquid samples such as plasma is called liquid biopsy, which is a non-invasive diagnostic method and is easy to sample and a trend in tumor diagnosis [ Crowley E, di Nicolantonio F, loupakis F, et al liquid biosy: monitoring cancer-genetics in the blood [ J ]. Nature Reviews Clinical Oncology,2013,10 (8): 472-484 ].
Currently, the mainstream techniques used for mutant gene detection are ARMS (amplification-blocked mutation System) technique [ Newton C R, graham A, heptinstall L E, et al analysis of any point mutation in DNA. The Amplification Refractory Mutation System (ARMS) [ J ]. Nucleic Acids Res,1989,17 (7): 2503-16 ], ddPCR (drop digital PCR) technique [ Sanmamed M F, fernandez-Lanzuri S, rodriguez C, et al quantitative Cell-Free Circulating BRAF (V600E) Mutation Analysis by Use of Droplet Digital PCR in the Follow-up of Patients with Melanoma Being Treated with BRAF Inhibitors [ J ]. Clinical Chemistry,2015,61 (1): 297-304 ], BEAMing technique [ Chen W, balaj L, liau L M, et al AMBEI and Droplet Digital PCR Analysis of Mutant IDH1mRNA in Glioma Patient Serum and Cerebrospinal Fluid Extracellular Vesicles [ J ]. Molecular Therapy-Nucleic Acids,2013,2 ] and secondary sequencing techniques. The technical methods have advantages and disadvantages, wherein the ARMS technology is most widely used and has strong universality, and some large hospitals have detection capability, but the mutation detection capability of the method is insufficient, and the detection requirement of liquid biopsy cannot be met at present. ddPCR, BEAMing and second generation sequencing and the like have strong detection capability but complex operation, and most of large hospitals do not have detection capability at present. The mutation detection capability of the ARMS technology is improved, so that the ARMS technology is finally suitable for the requirement of liquid biopsy, on one hand, the complexity of the liquid biopsy technology is reduced, the clinical application and popularization of the liquid biopsy are improved, and on the other hand, the detection cost is reduced, and the economic burden of a patient is reduced. In order to improve the mutation detection ability of ARMS technology, researchers have improved the mutation detection ability of ARMS by improving the ARMS technology, for example, by introducing a locked nucleic acid at the end of ARMS primer, thereby improving the mutation detection ability of ARMS [ Chinese patent application: 201710047720.7]; wild-type blockers were added to ARMS systems to increase the mutant detection capacity of ARMS [ Zhang X, chang N, yang G, et al A comparison of ARMS-Plus and droplet digital PCR for detecting EGFR activating mutations in plasma [ J ]. Oncostarget, 2017,8 (67): 112014-112023 ]. Although the advent of these improved methods has improved the mutation detection capability of ARMS to some extent, the requirements of liquid biopsy for mutation detection rate have not been met.
Disclosure of Invention
The invention aims to solve the technical problems of the mutation gene detection method, and finally provides a mutation gene amplification detection method which has stronger mutation detection capability, strong detection universality, simple operation process and low cost by improving the ARMS technology.
The technical scheme adopted by the invention is as follows: by connecting the wild type blocking sequence and the mutant primer sequence into one molecule, the hybrid strand substitution efficiency of the wild type blocking strand to the mismatched primer strand is accelerated, the background amplification of the wild type template is effectively inhibited, and finally the effective detection of the mutant gene with the mutation rate of one ten million is realized.
In a first aspect, the invention claims an intramolecular ligation ARMS primer.
The intramolecular blocking ARMS primer disclosed by the invention consists of a mutation site recognition primer and a universal primer;
the mutation site recognition primer is formed by connecting a wild type blocking sequence with a mutant primer sequence;
the first base at the 3 'end of the mutant primer sequence is a mutant base at a mutation position, the 2 nd position of the 3' end is provided with a mismatched base, and the rest bases are matched (consistent) with a template sequence;
the base at the corresponding mutation position in the wild type blocking sequence is a wild type base, and the rest bases are matched with the template sequence; further, the wild-type base at the corresponding mutation position in the wild-type blocking sequence may be located at the first position at the 3' -end or may be located somewhere in the middle.
In the mutation site recognition primer, if the 3' -end of the wild type blocking sequence is a free end, blocking the wild type blocking sequence;
the universal primer is reverse complementary to the template sequence downstream of the mutation site.
Further, the mutation site recognition primers are of four types: sequential, symmetrical, hairpin enhanced, and hybrid (fig. 1), as follows:
(A1) A sequential mutation site recognition primer;
the wild-type blocking sequence in the sequenced mutation site recognition primer is in the same intramolecular direction as the mutant primer sequence. The sequential mutation site recognition primer is formed by connecting the 3 '-end of the wild type blocking sequence with the 5' -end of the mutant primer sequence.
(A2) A symmetric mutation site recognition primer;
the wild-type blocking sequence in the symmetric mutation site recognition primer is in the opposite intramolecular direction of the mutant primer sequence. The symmetrical mutation site recognition primer is formed by connecting the wild type blocking sequence with the 5 'end of the mutant primer sequence in a chemical bonding mode through the 5' end; and the 3' -end of the wild-type blocking sequence is blocked.
(A3) Hairpin enhanced mutation site recognition primers;
the hairpin enhanced mutation site recognition primer connects the wild type blocking sequence and the mutant primer sequence into a molecule through a hairpin structure, the hairpin structure further shortens the space distance between the wild type blocking sequence and the mutant primer sequence, the hybridization chain substitution efficiency of the wild type blocking sequence to the mismatched primer sequence is enhanced, and the mutation detection capability of an ARMS method in the molecule is further improved.
The hairpin enhanced mutation site recognition primer consists of a hairpin loop, a hairpin stem, a connecting sequence, the mutation type primer sequence and the wild type blocking sequence; the wild type blocking sequence is connected with the 5 'end of the hairpin structure in a chemical bonding mode through the 5' end; the mutant primer sequence is connected with the 3' end of the hairpin structure through the connecting sequence.
(A4) Hybrid mutation site recognition primers;
the mixed mutation site recognition primer is formed by mixing the design of symmetrical and sequential primer structures. The mixed mutation site recognition primer is formed by connecting the 5 'end of the sequential mutation site recognition primer with the 5' end of the other wild type blocking sequence in a chemical bonding mode; and the 3' -end of the wild-type blocking sequence of the strip is blocked.
Further, in (A1), the 3 '-end of the wild-type blocking sequence and the 5' -end of the mutant primer sequence may be linked by an oligonucleotide sequence or by chemical bonding or direct ligation. Wherein the oligonucleotide sequence may be 2-8mer (e.g., 3-7mer or 3 mer) in length.
Still further, in (A3), the length of the hairpin loop may be 3-9mer (e.g., 7 mer); the hairpin stem can be 3-12bp (such as 9 bp) in length; the linking sequence may be 2-8mer (e.g., 4 mer) in length.
Still further, the wild-type blocking sequence may be 12-30 mer (e.g., 20 mer) in length; the length of the mutant primer sequence may be 12-30 mer (e.g., 20 mer); the universal primer may be 12-30 mer (e.g., 20 mer) in length.
Further, the chemical bonding may be based on a chemical reaction between aldehyde groups and amino groups, epoxy groups and amino groups, carboxyl groups and amino groups, azide groups and alkynyl groups, or mercapto groups and alkenyl groups, or the like.
In a second aspect, the invention also claims a mutation site recognition primer as described in the first aspect above.
In a third aspect, the invention also claims an intramolecular blocking ARMS amplification reagent.
The intramolecular occlusion ARMS amplification reagents claimed in the present invention contain the intramolecular occlusion ARMS primers described hereinbefore.
In a fourth aspect, the invention claims the use of an intramolecular occlusion ARMS primer as described hereinbefore or said mutation site recognition primer or said amplification reagent in any of the following:
(B1) Detecting a mutant gene;
(B2) Preparing a product for detecting the mutant gene;
(B3) Detecting whether a sample to be detected contains a mutant gene;
(B4) And preparing a product for detecting whether the sample to be detected contains the mutant gene.
Further, the detection of the mutant gene and the detection of whether the sample to be detected contains the mutant gene may be liquid biopsies.
In such applications, the method of detecting a mutant gene using the intramolecular occlusion ARMS primer or the mutation site recognition primer or the amplification reagent of the present invention is called an intramolecular occlusion ARMS method. Intramolecular blocking ARMS are divided into four types according to four different types of mutation site recognition primers: sequential intra-molecular blocking ARMS, symmetrical intra-molecular blocking ARMS, hairpin-enhanced intra-molecular blocking ARMS, and hybrid intra-molecular blocking ARMS. The molecular internal blocking ARMS method is utilized to amplify and detect mutant genes, a Taqman probe, a molecular beacon or a fluorescent dye can be used for realizing the real-time quantitative detection of amplified products, the detection of amplified products can be realized through agarose gel electrophoresis, and the effective detection of mutant templates with mutation rate of one ten thousandth can be realized.
In a fifth aspect, the invention claims any of the following:
(I) An intramolecular blocking ARMS primer for detecting EGFR p.l858r mutation, based on the intramolecular blocking ARMS primer described in the first aspect above, wherein the sequence of the universal primer is specifically set forth in SEQ ID No. 1; the wild type blocking sequence is specifically shown as SEQ ID No. 2; the sequence of the mutant primer is specifically shown in SEQ ID No. 3;
(II) an intramolecular occlusion ARMS amplification reagent for detecting EGFR p.l858r mutation, comprising an intramolecular occlusion ARMS primer for detecting EGFR p.l858r mutation as described in (I).
In a specific embodiment of the invention, the intramolecular blocking ARMS primer for detecting EGFR p.l858r mutation is specifically any one of the following:
(a1) Consists of a general primer shown in SEQ ID No.1 and a sequential mutation site recognition primer shown in SEQ ID No. 4;
(a2) Consists of a general primer shown in SEQ ID No.1 and a symmetrical mutation site recognition primer; the symmetrical mutation site recognition primer is formed by connecting a wild type blocking sequence shown in SEQ ID No.2 with CHO modification at the 5' end and C3Spacer modification at the 3' end with a mutant primer sequence shown in SEQ ID No.3 with NH2 (C12) modification at the 5' end through a reaction bond between an aldehyde group and an amino group.
(a3) Consists of a universal primer shown in SEQ ID No.1 and a hairpin enhanced mutation site recognition primer; the hairpin enhanced mutation site recognition primer is formed by connecting a wild type blocking sequence shown in SEQ ID No.2 with CHO modification at the 5' end and C3Spacer modification at the 3' end with a nucleotide sequence shown in SEQ ID No.5 with NH2 (C12) modification at the 5' end through a reaction bond between an aldehyde group and an amino group.
(a4) Consists of a universal primer shown in SEQ ID No.1 and a hairpin enhanced mutation site recognition primer; the hairpin enhanced mutation site recognition primer is formed by connecting a wild type blocking sequence shown in SEQ ID No.2 with DBCO modification at the 5' end and C3Spacer modification at the 3' end with a nucleotide sequence shown in SEQ ID No.5 with Azide modification at the 5' end through a reaction bond between azido and alkynyl.
Further, the method for detecting EGFR p.l858r mutation may be a liquid biopsy.
In the present invention, the "3 '-end of the wild-type blocking sequence is blocked" may specifically be a modification group such as C3Spacer or the like which is capable of preventing primer extension attached to the 3' -end of the wild-type blocking sequence.
The beneficial effects of the invention are as follows: according to the invention, the wild type blocking sequence and the mutant primer sequence are connected into one molecule, so that four intramolecular ARMS amplification detection methods are constructed, the hybrid chain substitution reaction of the wild type blocking sequence on the mismatched primer is accelerated, the mutation detection capability of the ARMS is greatly improved, and the specific detection of the mutation gene with the mutation rate of one ten parts per million is realized; the invention can be applied to the requirements of liquid biopsy by improving the mutation detection capability of ARMS, is beneficial to simplifying the operation complexity of mutation detection, reducing the detection cost and improving the detection universality, and is hopeful to accelerate the application and popularization of liquid biopsy in clinic.
Drawings
FIG. 1 shows the primer design for intramolecular occlusion ARMS.
FIG. 2 shows amplification curves for different types of intramolecular occlusion ARMS. A is an amplification curve of the traditional ARMS method; b is a sequential intramolecular internal resistance ARMS method amplification curve; c is a symmetrical intramolecular internal resistance ARMS amplification curve; d is a hairpin enhanced intramolecular internal resistance ARMS amplification curve. The wild type templates contained in each group were 3.68X10 respectively 6 Copy, each curve represents mutation rates of 0.1%, 0.01%, 0.001%, 0.0001% and NC (negative control), respectively, wherein the addition amounts of mutant templates were 3.68X10%, respectively 3 Copy, 3.68X10 2 Copy, 37 copy, 4 copy, and 0 copy.
FIG. 3 is an amplification curve of EGFR p.L858R in hairpin enhanced intramolecular ligation ARMS (integrated array) detection of patient plasma extracted cfDNA. P1 and P2 are two patient samples.
Detailed Description
The experimental methods used in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Example 1 detection of sequential intramolecular blocking ARMS for EGFR p.L858R mutation
The embodiment is that sequential intramolecular blocking ARMS is used for detecting EGFR p.L858R mutation on a plasmid, and the sequence of a general primer is shown as SEQ ID No. 1; the wild type blocking sequence is shown as SEQ ID No. 2; the sequence of the mutant primer is shown as SEQ ID No. 3.
Primer sequence and modification:
L858R-F：5’-GCTTGGTGCACCGCGACCTG-3’(SEQ ID No.1)；
sequential L858R-R:5' -CGCACCCAGCAGTTTGGCCAAAAAAACGCACCCAGCA GTTTGGCGC-3' (SEQ ID No. 4), the underlined part is an oligonucleotide linker sequence, and the sequences at both ends are the wild-type blocking sequence shown in SEQ ID No.2 and the mutant primer sequence shown in SEQ ID No.3, respectively.
The synthesis and modification of the primer sequences were served by the division of bioengineering (Shanghai) and mutant plasmids carrying the EGFR p.L858R mutation (recombinant plasmids obtained by cloning the DNA fragment shown in SEQ ID No.6 onto pUC 57) and EGFR wild type plasmids not carrying the EGFR p.L858R mutation (recombinant plasmids obtained by cloning the DNA fragment shown in SEQ ID No.7 onto pUC 57) were synthesized by the division of bioengineering (Shanghai). SEQ ID No.6 carries a wild template sequence corresponding to EGFR p.L858R mutation; SEQ ID No.7 carries the EGFR p.L858R mutant template sequence.
Detection of mutant plasmids:
firstly, before preparing an amplification system, scrubbing a PCR operation table by using a 5% sodium hypochlorite solution, then scrubbing again by using 75% ethanol, and finally turning on an ultraviolet lamp to irradiate the table for 30min. When the irradiation was completed, 10. Mu.L of PCR amplification system was prepared as follows: the concentration of each of the upstream and downstream primers was 10. Mu.M, 0.2. Mu.L, 5. Mu.L of 2 XPCR premix (Thermo Fisher, cat. No. 4398881, product name: AMPLITAQ GOLD 360MASTER MIX), 0.2. Mu.L of 50 XSYBER GREEN I, 2.4. Mu.L of ultra pure water, 1. Mu.L of the primer containing 3.68X10. Mu.L of the primer 6 Wild-type template DNA solution of each copy, 1. Mu.L of mutant DNA template solution (series concentration: addition amount of mutant template is 3.68X10, respectively 3 Copy, 3.68X10 2 Copy, 37 copies and 0 copies) then, the EP tube lid was covered, spun and mixed for 2min, and the tube wall liquid was centrifuged to the bottom. The octant with the system was then discharged into a Bio-rad real-time fluorescent quantitative PCR instrument for amplification detection. PCR temperature cycles were as follows: firstly, incubating at 95 ℃ for 5min to activate the hot start DNA polymerase, then, entering into temperature circulation (95 ℃,30s;60 ℃,30s;72 ℃,30 s), wherein the circulation number is 60, and finally, gradually raising the temperature from 65 ℃ to 95 ℃ to obtain a melting curve of an amplified product.
The experiment was also set up with the conventional ARMS method as a control. The primers used were as follows: 5'-CGCACCCAGCAGTTTGGCGC-3' (SEQ ID No. 3) and the other primer is a universal primer, 5'-GCTTGGTGCA CCGCGACCTG-3' (SEQ ID No. 1). The reaction system and the temperature cycle are the same as those of the above method.
After the amplification curve data was obtained, the data was derived and plotted using Origin 9.0. The amplification curve of the sequential intramolecular internal resistance ARMS method of the invention is shown as B in FIG. 2. The amplification curve of the conventional ARMS method is shown in FIG. 2A. As can be seen from the graph, for the amplification curve of the blocking ARMS method in the sequential type molecule, when the mutation rate is more than one ten thousandth, the positive result is obtained, and the mutation rate is lower than one ten thousandth group and the peak-out time of the negative control NC group is obviously delayed from the positive amplification curve. For the amplification curve of the traditional ARMS method, two groups of amplification curves with mutation rates of one ten thousandth and one ten thousandth are indistinguishable, so that the amplification specificity and the detection rate of the amplification curve are obviously inferior to those of the ARMS method in the sequential type in-molecule blocking.
Example 2 detection of EGFR p.L858R mutations by blocking ARMS in symmetrical molecules and hairpin enhanced intramolecular blocking ARMS
The embodiment is that symmetrical and hairpin enhanced intramolecular blocking ARMS is used for detecting EGFR p.L858R mutation on plasmids, and the sequence of a general primer is shown as SEQ ID No. 1; the wild type blocking sequence is shown as SEQ ID No. 2; the sequence of the mutant primer is shown as SEQ ID No. 3.
Primer sequence and modification:
L858R-F：5’-GCTTGGTGCACCGCGACCTG-3’(SEQ ID No.1)；
symmetrical L858R-Bl:5'-CHO/CGCACCCAGCAGTTTGGCCA/C3spacer-3' (SEQ ID No. 2);
symmetrical L858R-Pr:5'-C12NH2/CGCACCCAGCAGTTTGGCGC-3' (SEQ ID No. 3);
hairpin enhancement type L858R-Bl:5'-CHO/CGCACCCAGCAGTTTGGCCA/C3spacer-3' (SEQ ID No. 2).
Hairpin enhanced L858R-HPr:5' -C12NH 2-CGGCGGTTTTCCGCCGAATTCGCACC CAGCAGTTTGGCGC-3' (SEQ ID No.5, two places below)The streak part forms a hairpin stem of the hairpin structure, the middle part is a hairpin ring, the bold AATT is a connecting sequence, and the rear part is a mutant primer sequence shown as SEQ ID No. 3).
The synthesis of the primer sequences and the terminal modification were served by the division of bioengineering (Shanghai), and mutant plasmids having EGFR p.L858R mutation (recombinant plasmids obtained by cloning the DNA fragment shown in SEQ ID No.6 onto pUC57 plasmid) and EGFR wild type plasmids not having EGFR p.L858R mutation (recombinant plasmids obtained by cloning the DNA fragment shown in SEQ ID No.7 onto pUC57 plasmid) were synthesized by the division of bioengineering (Shanghai). SEQ ID No.6 carries a wild template sequence corresponding to EGFR p.L858R mutation; SEQ ID No.7 carries the EGFR p.L858R mutant template sequence.
The chemical bonding process of the wild-type blocking strand and the mutant primer strand is as follows:
the wild-type blocking strand and the mutant primer strand are linked by a reaction between an aldehyde group and an amino group. The specific experimental steps are as follows: the synthesized L858R-Bl, L858R-Pr and L858R-HPr were diluted to 100. Mu.M with ultrapure water, respectively, and then L858R-Bl and L858R-Pr were mixed in a volume ratio of 10.5:10 and L858R-Bl and L858R-HPr were mixed, followed by rapid shaking reaction at room temperature for 2 hours. Adding TE buffer solution which is four times of the mixed solution, shaking again at room temperature for reaction for 1h, and placing the obtained symmetrical intramolecular internal blocking ARMS primer with the concentration of 10 mu M and hairpin enhanced intramolecular internal blocking ARMS primer with the concentration of 10 mu M into a refrigerator with the temperature of 4 ℃ for standby, and placing into a refrigerator with the temperature of-20 ℃ for standby if long-term storage is needed.
Detection of mutant plasmids:
firstly, before preparing an amplification system, scrubbing a PCR operation table by using a 5% sodium hypochlorite solution, then scrubbing again by using 75% ethanol, and finally turning on an ultraviolet lamp to irradiate the table for 30min. When the irradiation was completed, 20. Mu.L of PCR amplification system was prepared as follows: the concentration of each of the upstream and downstream primers was 10. Mu.M, 0.2. Mu.L, 5. Mu.L of 2 XPCR premix (Thermo Fisher, cat. No. 4398881, product name: AMPLITAQ GOLD 360MASTER MIX), 0.2. Mu.L of 50 XSYBER GREEN I, 2.4. Mu.L of ultra pure water, 1. Mu.L of the primer containing 3.68X10. Mu.L of the primer 6 Wild-type template DNA solution of each copy, 1. Mu.L of mutant DNA template solution (series concentration: addition amount of mutant template is 3.68X10, respectively 3 Copy, 3.68X10 2 Copy, 37 copy, 4 copy, and 0 copy). Then, the EP tube cover is covered, the mixture is rotated and evenly mixed for 2min, and the tube wall liquid is centrifuged to the bottom. The octant with the system was then discharged into a Bio-rad real-time fluorescent quantitative PCR instrument for amplification detection. PCR temperature cycles were as follows: firstly, incubating at 95 ℃ for 5min to activate the hot start DNA polymerase, then, entering into temperature circulation (95 ℃,30s;60 ℃,30s;72 ℃,30 s), wherein the circulation number is 60, and finally, gradually raising the temperature from 65 ℃ to 95 ℃ to obtain a melting curve of an amplified product.
The experiment was also set up with the conventional ARMS method as a control. The primers used were as follows: 5'-CGCACCCAGCAGTTTGGCGC-3' (SEQ ID No. 3) and the other primer is a universal primer, 5'-GCTTGGTGCA CCGCGACCTG-3' (SEQ ID No. 1). The reaction system and the temperature cycle are the same as those of the above method.
After the amplification curve data was obtained, the data was derived and plotted using Origin 9.0. The results of the amplification curves of the symmetrical intramolecular blocking ARMS and the hairpin enhanced intramolecular blocking ARMS of the invention are shown as C and D in FIG. 2. The amplification curve of the conventional ARMS method is shown in FIG. 2A. For the amplification curves of the symmetrical intramolecular internal blocking ARMS method and the hairpin enhanced intramolecular internal blocking ARMS method, when the mutation rate is more than one ten thousandth, positive results are obtained, and the peak-out time of the negative control NC group is obviously delayed to the positive amplification curve. For the amplification curves of the traditional ARMS method, two groups of amplification curves with mutation rates of one ten thousandth and one ten thousandth are indistinguishable, and the amplification specificity and the detection rate of the amplification curves are obviously inferior to those of the symmetrical intramolecular internal blocking ARMS method and the hairpin enhanced intramolecular internal blocking ARMS method. This shows that the symmetrical intramolecular blocking ARMS method and the hairpin enhanced intramolecular blocking ARMS method have higher specificity and detection rate, and realize the specific detection of mutation genes with mutation rate of one ten million.
Example 3 hairpin enhanced intramolecular blocking ARMS for detection of EGFR p.L858R in plasma extraction of cfDNA
The hairpin enhanced intramolecular blocking ARMS is used for detecting EGFR p.L858R mutation in blood plasma extracted cfDNA, and the sequence of a general primer is shown as SEQ ID No. 1; the wild type blocking sequence is shown as SEQ ID No. 2; the sequence of the mutant primer is shown as SEQ ID No. 3.
Primer sequences and modifications were as follows:
L858R-F：5’-GCTTGGTGCACCGCGACCTG-3’(SEQ ID No.1)；
hairpin enhancement type L858R-Bl:5'-DBCO/CGCACCCAGCAGTTTGGCCA/C3spacer-3' (SEQ ID No. 2);
hairpin enhanced L858R-HPr:5' -Azide-CGGCGGTTTTCCGCCGAATTCGCACCCAGC AGTTTGGCGC-3' (SEQ ID No. 5), wherein two underlined parts form a hairpin stem of a hairpin structure, a hairpin ring is arranged at the middle part, the bold AATT is a connecting sequence, and the rear part is a mutant primer sequence shown as SEQ ID No. 3);
the synthesis and end modification of the primer sequences are all serviced by the company Shanghai, inc.
The chemical bonding process of the wild-type blocking strand and the mutant primer strand is as follows:
the wild-type blocking strand and the mutant primer strand are linked by a reaction between an azide group and an alkyne group. The specific experimental steps are as follows: the synthesized L858R-Bl and L858R-HPr were diluted to 100. Mu.M with ultrapure water, respectively, and then the L858R-Bl and L858R-HPr were mixed at a volume ratio of 10.5:10, and reacted by rapid shaking at room temperature for 2 hours. Adding TE buffer solution which is four times of the mixed solution, shaking again at room temperature for reaction for 1h, blocking ARMS primer in hairpin enhanced molecule with concentration of 10 mu M, and storing in refrigerator at 4deg.C for use, if long-term storage is needed, storing in refrigerator at-20deg.C for use.
Extraction of cfDNA in plasma samples:
cfDNA was extracted from plasma samples using the QIAseq cfDNA Extraction Kit kit from Qiagen corporation, the procedure was set forth as a kit protocol.
Detection of EGFR p.l858r mutation in extracted cfDNA:
firstly, before preparing an amplification system, scrubbing a PCR operation table by using a 5% sodium hypochlorite solution, then scrubbing again by using 75% ethanol, and finally turning on an ultraviolet lamp to irradiate the table for 30min. When the irradiation was completed, 20. Mu.L of PCR amplification system was prepared as follows: the concentration of each of the upstream and downstream primers was 10. Mu.M, 0.4. Mu.L, 10. Mu.L of 2 XPCR premix (Thermo Fisher, cat. No. 4398881, product name: AMPLITAQ GOLD 360MASTER MIX), 0.4. Mu.L of 50 XSYBER GREEN I, 3.8. Mu.L of ultrapure water, 5. Mu.L of the extracted cfDNA solution. Then, the EP tube cover is covered, the mixture is rotated and evenly mixed for 2min, and the tube wall liquid is centrifuged to the bottom. The octant with the system was then discharged into a Bio-rad real-time fluorescent quantitative PCR instrument for amplification detection. PCR temperature cycles were as follows: firstly, incubating at 95 ℃ for 5min to activate the hot start DNA polymerase, then, entering into temperature circulation (95 ℃,30s;60 ℃,30s;72 ℃,30 s), wherein the circulation number is 60, and finally, gradually raising the temperature from 65 ℃ to 95 ℃ to obtain a melting curve of an amplified product. After the amplification curve data was obtained, the data was derived and plotted using Origin 9.0. The experimental results are shown in FIG. 3. As can be seen, the amplification curve for P2 (patient sample number 1) peaked at about 52 cycles, while the amplification curve for P1 (patient sample number 2) was not peaked. By further carrying out sequencing verification on the two samples, the invention proves that the P2 sample is truly EGFR p.L858R mutation positive, and the P1 sample is negative.
<110> Beijing Feng Teyun based technology development Co., ltd
<120> an intramolecular occlusion ARMS with ultra high mutation detection sensitivity
<130> GNCLN191608
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
gcttggtgca ccgcgacctg 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
cgcacccagc agtttggcca 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
cgcacccagc agtttggcgc 20
<210> 4
<211> 46
<212> DNA
<213> Artificial sequence
<400> 4
cgcacccagc agtttggcca aaaaaacgca cccagcagtt tggcgc 46
<210> 5
<211> 40
<212> DNA
<213> Artificial sequence
<400> 5
cggcggtttt ccgccgaatt cgcacccagc agtttggcgc 40
<210> 6
<211> 435
<212> DNA
<213> Artificial sequence
<400> 6
ttaaaattcc cgtcgctatc aaggaattaa gagaagcaac atctccgaaa gccaacaagg 60
aaatcctcga tgtgagtttc tgctttgctg tgtgggggtc catggctctg aacctcaggc 120
ccaccttttc tcatgtctgg cagctgctct gctctagacc ctgctcatct ccgtcgcttg 180
gtgcaccgcg acctggcagc caggaacgta ctggtgaaaa caccgcagca tgtcaagatc 240
acagattttg ggctggccaa actgctgggt gcggaagatg gccaccatgc gaagccacac 300
tgacgtgcct ctccctccct ccaggaagcc tacgtgatgg ccagcgtgga caacccccac 360
gtgtgccgcc tgctgggcat ctgcctcacc tccaccgtgc agctcatcac gcagctcatg 420
cccttcggct gcctc 435
<210> 7
<211> 419
<212> DNA
<213> Artificial sequence
<400> 7
ttaaaattcc cgtcgctatc aaaacatctc cgaaagccaa caaggaaatc ctcgatgtga 60
gtttctgctt tgctgtgtgg gggtccatgg ctctgaacct caggcccacc ttttctcatg 120
tctggcagct gctctgctct agaccctgct catctccgtc gcttggtgca ccgcgacctg 180
gcagccagga acgtactggt gaaaacaccg cagcatgtca agatcacaga ttttgggcgg 240
gccaaactgc tgggtgcgga agatggccac catgcgaagc cacactgacg tgcctctccc 300
tccctccagg aagcctacgt gatggccagc gtggacaacc cccacgtgtg ccgcctgctg 360
ggcatctgcc tcacctccac cgtgcagctc atcatgcagc tcatgccctt cggctgcct 419
Claims (10)
1. An intramolecular occlusion ARMS primer, which consists of a mutation site recognition primer and a universal primer;
the mutation site recognition primer is formed by connecting a wild type blocking sequence with a mutant primer sequence;
the first base at the 3 '-end of the mutant primer sequence is a mutant base at a mutation position, the 2 nd position of the 3' -end is provided with a mismatched base, and the rest bases are matched with a template sequence;
the base at the corresponding mutation position in the wild type blocking sequence is a wild type base, and the rest bases are matched with the template sequence;
in the mutation site recognition primer, if the 3' -end of the wild type blocking sequence is a free end, blocking the wild type blocking sequence;
the universal primer is reversely complementary with a template sequence at the downstream of the mutation position;
the mutation site recognition primer is a hairpin enhanced mutation site recognition primer;
the hairpin enhanced mutation site recognition primer consists of a hairpin loop, a hairpin stem, a connecting sequence, the mutation type primer sequence and the wild type blocking sequence; the wild type blocking sequence is connected with the 5 'end of the hairpin structure in a chemical bonding mode through the 5' end; the mutant primer sequence is connected to the 3' end of the hairpin structure through the connecting sequence;
the length of the hairpin loop is 3-9mer; the length of the hairpin stem is 3-12bp; the length of the connecting sequence is 2-8mer.
2. The intramolecular occlusion ARMS primer of claim 1 wherein: the length of the wild type blocking sequence is 12-30 mer.
3. The intramolecular occlusion ARMS primer of claim 1 wherein: the length of the mutant primer sequence is 12-30 mer.
4. An intramolecular occlusion ARMS primer according to any of claims 1-3, characterized in that: the length of the universal primer is 12-30 mer.
5. The intramolecular occlusion ARMS primer of claim 1 wherein: the chemical bonding mode is based on chemical reaction between aldehyde group and amino, epoxy group and amino, carboxyl group and amino, azido and alkynyl, or mercapto group and alkenyl.
6. The mutation site recognition primer as set forth in any one of claims 1 to 5.
7. An intramolecular blocking ARMS amplification reagent comprising an intramolecular blocking ARMS primer according to any one of claims 1 to 5.
8. Use of an intramolecular occlusion ARMS primer according to any of claims 1-5 or a mutation site recognition primer according to claim 6 or an amplification reagent according to claim 7 in any of the following:
(B1) Detecting a mutant gene;
(B2) Preparing a product for detecting the mutant gene;
(B3) Detecting whether a sample to be detected contains a mutant gene;
(B4) Preparing a product for detecting whether a sample to be detected contains a mutant gene;
wherein the applications of (B1) and (B3) are non-disease diagnostic applications.
9. An intramolecular blocking ARMS primer for detecting EGFR p.l858r mutation, which is an intramolecular blocking ARMS primer according to any one of claims 1-5, and the sequence of the universal primer is shown in SEQ ID No. 1; the wild type blocking sequence is shown as SEQ ID No. 2; the sequence of the mutant primer is shown as SEQ ID No. 3.
10. An intramolecular occlusion ARMS amplification reagent for detecting EGFR p.l858r mutation, comprising the intramolecular occlusion ARMS primer for detecting EGFR p.l858r mutation of claim 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910675931.4A CN112301111B (en) | 2019-07-25 | 2019-07-25 | Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910675931.4A CN112301111B (en) | 2019-07-25 | 2019-07-25 | Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112301111A CN112301111A (en) | 2021-02-02 |
| CN112301111B true CN112301111B (en) | 2023-07-07 |
Family
ID=74329221
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910675931.4A Active CN112301111B (en) | 2019-07-25 | 2019-07-25 | Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112301111B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012002477A1 (en) * | 2010-06-30 | 2012-01-05 | 三菱化学メディエンス株式会社 | Highly sensitive mutated gene detection method |
| CN107419018A (en) * | 2012-02-16 | 2017-12-01 | 江苏宏微特斯医药科技有限公司 | A kind of method and kit based on Blocker primers and ARMS primer detection gene mutations |
| WO2018059525A1 (en) * | 2016-09-30 | 2018-04-05 | 苏州新海生物科技股份有限公司 | Composition, method and kit for detecting target nucleic acid sequence variant |
| CN108611412A (en) * | 2018-03-28 | 2018-10-02 | 无锡市申瑞生物制品有限公司 | A kind of primer combination of probe of EGFR genetic mutation detection and its application |
| CN108823285A (en) * | 2018-07-09 | 2018-11-16 | 博奥生物集团有限公司 | A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA |
| CN109136345A (en) * | 2018-09-21 | 2019-01-04 | 北京知光基因科技有限公司 | A kind of PCR method and its application expanded and detect low-content gene mutation |
-
2019
- 2019-07-25 CN CN201910675931.4A patent/CN112301111B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012002477A1 (en) * | 2010-06-30 | 2012-01-05 | 三菱化学メディエンス株式会社 | Highly sensitive mutated gene detection method |
| CN107419018A (en) * | 2012-02-16 | 2017-12-01 | 江苏宏微特斯医药科技有限公司 | A kind of method and kit based on Blocker primers and ARMS primer detection gene mutations |
| WO2018059525A1 (en) * | 2016-09-30 | 2018-04-05 | 苏州新海生物科技股份有限公司 | Composition, method and kit for detecting target nucleic acid sequence variant |
| CN108611412A (en) * | 2018-03-28 | 2018-10-02 | 无锡市申瑞生物制品有限公司 | A kind of primer combination of probe of EGFR genetic mutation detection and its application |
| CN108823285A (en) * | 2018-07-09 | 2018-11-16 | 博奥生物集团有限公司 | A kind of the Loop formula enrichment detection primer and its application of low abundance mutant DNA |
| CN109136345A (en) * | 2018-09-21 | 2019-01-04 | 北京知光基因科技有限公司 | A kind of PCR method and its application expanded and detect low-content gene mutation |
Non-Patent Citations (1)
| Title |
|---|
| 一种检测多种NPM1突变体的ARMS-PCR方法的建立;简正伟等;《中国实验血液学杂志》;20130820(第04期);第257-261页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112301111A (en) | 2021-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107365769B (en) | Bubbling primer, kit composed of bubbling primer and application of kit | |
| CN110719957B (en) | Methods and kits for targeted enrichment of nucleic acids | |
| CN104212904A (en) | Kit for quickly detecting polymorphism of human CYP2C19 gene and using method of kit | |
| CN110951828A (en) | Design method of primer and probe | |
| WO2011131151A1 (en) | Liquid chip for detecting pik3ca gene mutations | |
| CN109234357B (en) | Method, primer combination, kit and application for detecting fusion mutation of target gene | |
| EP3292217B1 (en) | Formation of hairpins in situ using force-induced strand invasion | |
| CN110938673A (en) | Method for generating single-stranded DNA (deoxyribonucleic acid) by using strand displacement primer mediated asymmetric PCR (polymerase chain reaction) | |
| CN113862339B (en) | Nucleic acid combination, detection kit and method for amplifying target nucleic acid | |
| CN112662763A (en) | Probe composition for detecting common amphoteric cancers | |
| CN111808932B (en) | Circular RNA detection method and kit | |
| CN110387400B (en) | Parallel liquid phase hybridization capture method for simultaneously capturing positive and negative sense double chains of genome target region | |
| CN112301111B (en) | Intramolecular blocking ARMS with ultrahigh mutation detection sensitivity | |
| CN113549686A (en) | Detection kit for calcium ion antagonist metabolic marker, detection method and application thereof | |
| CN113584161A (en) | Detection kit for fentanyl metabolic marker, detection method and application thereof | |
| KR102343373B1 (en) | Method for multiplex detection of miRNA and miRNA detection kit using the same | |
| CN113969317B (en) | Noninvasive detection method and noninvasive detection device for venous malformation and related syndromes | |
| CN112501283A (en) | Guiding method and kit for carbamazepine personalized medicine gene | |
| CN112094860A (en) | CTCF-ETO2 blood disease fusion gene and detection primer and application thereof | |
| CN112553325A (en) | Guiding method and kit for sufentanil personalized medicine gene | |
| CN112646869B (en) | Guidance method and kit for atorvastatin personalized medicine genes | |
| CN112831558B (en) | Early screening method and kit for Crohn disease susceptibility genes | |
| CN112708664B (en) | Construction method and kit of multi-gene mutation sequencing library of lung cancer driving gene | |
| CN112708665B (en) | Construction method and kit for lung cancer polygenic mutation sequencing library | |
| US20230399693A1 (en) | Targeted sequencing method and kit thereof for detecting gene alteration |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230529 Address after: 2A20, Building 2, No. 339, No. 25 Road, Baiyang Street, Qiantang New District, Hangzhou City, Zhejiang Province, 311119 Applicant after: Hangzhou Zijing biological Co.,Ltd. Address before: 100071 room 1102, 58 Caihuying, Fengtai District, Beijing Applicant before: BEIJING FENGTE YUNJI TECHNOLOGY DEVELOPMENT CO.,LTD. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |