CN108796134B - Cervical cancer detection probe sequence and application thereof - Google Patents
Cervical cancer detection probe sequence and application thereof Download PDFInfo
- Publication number
- CN108796134B CN108796134B CN201810763465.0A CN201810763465A CN108796134B CN 108796134 B CN108796134 B CN 108796134B CN 201810763465 A CN201810763465 A CN 201810763465A CN 108796134 B CN108796134 B CN 108796134B
- Authority
- CN
- China
- Prior art keywords
- artificial sequence
- sequence
- probe
- type
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
Abstract
The invention relates to the technical field of genetic engineering, and discloses a cervical cancer detection probe sequence and application thereof. The probe sequence comprises one or more than two probe sequences of high-risk HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68; the high-risk HPV probe sequences consist of three probe sequences, namely a capture extension probe, a K-type label extension probe and a blocking probe. The invention aims at the design and artificial optimization of an extension capture probe, a K-type label probe and a closed probe of various high-risk human papilloma virus E6E7 regions, further improves the specificity of cervical cancer cell detection based on similar bDNA and QuantiMAT technologies, shows better quantitative limit, detection limit and sensitivity, and can be applied to the preparation of the kit.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a cervical cancer detection probe sequence and application thereof.
Background
Human Papilloma Virus (HPV) is closely related to cervical cancer, the cervical cancer is the second major death cancer of women, and the clinical evidence shows that 95-99.7% of cervical cancer cases are related to high-risk HPV virus infection. Since Laverty observed the existence of Human Papilloma Virus (HPV) particles in cervical cancer biopsy tissues in an electron microscope in 1977, and Zur Hausen proposed the hypothesis that HPV virus is associated with cervical cancer onset, scholars at home and abroad have conducted a great deal of research on the problem, and finally IARC topic discussion in 1995 was led to the fact that HPV infection is the main cause of cervical cancer, namely HPV infection is the prerequisite trigger of cervical cancer onset.
HPV can be divided into high-risk type and low-risk type, and the high-risk type can cause cancer and harm life after long-term continuous infection. Low risk HPV types can lead to genital condyloma acuminata, affecting quality of life. Meanwhile, a certain proportion of low-risk type infection is accompanied by high-risk type mixed infection. Therefore, it is very important to detect high-risk and low-risk HPV virus of patients with condyloma acuminatum clinically. The high-risk HPV has higher chance of causing cancer, and scientific research finds that at least 20 high-risk HPV are related to 95 percent of early-stage invasive and invasive cervical cancer. HPV infection, especially high-risk type HPV infection, has a clear relationship with the occurrence of cervical cancer. From recent random HPV screening results in the European population and elsewhere, it was demonstrated that HPV can be found in 99.8% of cervical cancer patients.
E6/E7 is an oncogene, encoding viral oncoproteins, and plays a critical role in the process of cellular transformation and maintaining the malignant phenotype of transformed tissues. The progression of cervical lesions through invasive cancer is closely linked to the integration of the HPV genome into the host cell genome, with loss of the E2 gene and subsequent overexpression of the E6/E7 oncogene. The oncogenic protein coded by the E6/E7 gene is an important factor for causing the canceration of cervical epithelium, and the combination and regulation of the two proteins and two main cancer suppressor proteins p53 and pRb in cells can obviously change the growth cycle of the cells and repair of DNA, so that the instability of a genome is a necessary condition for cell transformation and immortalization.
Integration of the HPV genome occurs during the progression from low-grade lesions to cancer. During integration, the E6/E7 gene persists and the L1 gene may be lost. However, the gene L1 is relatively conserved, so that the method is more suitable for detection with a universal primer as a target, and almost all HPV detection products take L1 as a detection target due to the limitation of the existing technical platform. In cervical high-grade lesion, the possibility of losing the L1 gene due to genome integration is high, so that the detection of HPV by using the L1 gene as a target point is high. In contrast, if the detection target is designed in the E6/E7 gene, HPV positive patients can be detected regardless of the integration of the HPV genome.
The prior patent CN105861669A discloses a detection method for rapidly capturing hybrid target substance branched chain DNA signal amplification (QuantiMAT technology), and the sensitivity and the time consumption of the detection method are superior to those of bDNA technology. In the embodiment, a related test for detecting the E6E7 region of the high-risk Human Papillomavirus (HPV) type 16 is provided, but different QuantiMAT probe sequences have the most direct influence on the specificity of the high-risk HPV, and the QuantiMAT probe sequences designed according to the ProbeDesigner V1.0 tool cannot guarantee high specificity when detecting the high-risk HPV, so that the quantitative Limit (LOQ), the detection Limit (LOD) and the sensitivity are influenced.
Disclosure of Invention
In view of this, the invention aims to provide a cervical cancer detection probe sequence and application thereof, so that the probe sequence can detect high-risk HPV16\18\31\33\35\39\45\51\52\56\58\59\66\68, has high specificity, and can be applied to cervical cancer detection related applications.
In order to achieve the above purpose, the invention provides the following technical scheme:
a cervical cancer detection probe sequence, which comprises one or more than two probe sequences of high-risk HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68; each high-risk HPV probe sequence consists of three probe sequences of a capture extension probe, a K-type label extension probe and a blocking probe;
wherein the sequence of the high-risk HPV31 type capture extension probe is shown as SEQ ID No.1-6, the high-risk HPV31 type K type marker extension probe is shown as SEQ ID No.7-20, and the high-risk HPV31 type blocking probe is shown as SEQ ID No. 21-27;
the sequence of the high-risk HPV33 type capture extension probe is shown as SEQ ID No.28-33, the high-risk HPV33 type K type marker extension probe is shown as SEQ ID No.34-49, and the high-risk HPV33 type blocking probe is shown as SEQ ID No. 50-55;
the sequence of the high-risk HPV35 type capture extension probe is shown as SEQ ID No.56-62, the high-risk HPV35 type K type marker extension probe is shown as SEQ ID No.63-78, and the high-risk HPV35 type blocking probe is shown as SEQ ID No. 79-82;
the sequence of the high-risk HPV39 type capture extension probe is shown as SEQ ID No.83-90, the high-risk HPV39 type K type marker extension probe is shown as SEQ ID No.91-112, and the high-risk HPV39 type blocking probe is shown as SEQ ID No. 113;
the sequence of the high-risk HPV45 type capture extension probe is shown as SEQ ID No. 114-139, the sequence of the high-risk HPV45 type K type marker extension probe is shown as SEQ ID No.122-139, and the sequence of the high-risk HPV45 type blocking probe is shown as SEQ ID No. 140-146;
the sequence of the high-risk HPV51 type capture extension probe is shown as SEQ ID No.147-153, the sequence of the high-risk HPV51 type K type marker extension probe is shown as SEQ ID No.154-173, and the sequence of the high-risk HPV51 type blocking probe is shown as SEQ ID No. 174-175;
the sequence of the high-risk HPV52 type capture extension probe is shown as SEQ ID No.176-178, the sequence of the high-risk HPV52 type K type marker extension probe is shown as SEQ ID No.179-194, and the sequence of the high-risk HPV52 type blocking probe is shown as SEQ ID No. 195-204;
the sequence of the high-risk HPV56 type capture extension probe is shown as SEQ ID No. 205-234, the sequence of the high-risk HPV56 type K type marker extension probe is shown as SEQ ID No.209-228, and the sequence of the high-risk HPV56 type blocking probe is shown as SEQ ID No. 229-234;
the sequence of the high-risk HPV58 type capture extension probe is shown as SEQ ID No.235-238, the sequence of the high-risk HPV58 type K type marker extension probe is shown as SEQ ID No.239-255, and the sequence of the high-risk HPV58 type blocking probe is shown as SEQ ID No. 256-262;
the sequence of the high-risk HPV59 type capture extension probe is shown as SEQ ID No.263-267, the sequence of the high-risk HPV59 type K type marker extension probe is shown as SEQ ID No.268-289, and the sequence of the high-risk HPV59 type blocking probe is shown as SEQ ID No. 290-292;
the sequence of the high-risk HPV66 type capture extension probe is shown as SEQ ID No.293-298, the sequence of the high-risk HPV66 type K type marker extension probe is shown as SEQ ID No.299-316, and the sequence of the high-risk HPV66 type blocking probe is shown as SEQ ID No. 317-321;
the sequence of the high-risk HPV68 type capture extension probe is shown as SEQ ID No. 322-349, the sequence of the high-risk HPV68 type K type marker extension probe is shown as SEQ ID No.330-349, and the sequence of the high-risk HPV68 type blocking probe is shown as SEQ ID No. 350-352;
the sequence of the high-risk HPV18 type capture extension probe is shown as SEQ ID No.353-357, the sequence of the high-risk HPV18 type K type marker extension probe is shown as SEQ ID No.358-379, and the sequence of the high-risk HPV18 type blocking probe is shown as SEQ ID No. 380-383;
the sequence of the high-risk HPV16 type capture extension probe is shown as SEQ ID No.384-390, the sequence of the high-risk HPV16 type K type marker extension probe is shown as SEQ ID No.391-410, and the sequence of the high-risk HPV16 type blocking probe is shown as SEQ ID No. 411-412.
Aiming at the problem that the specificity of related probes in the bDNA and QuantiMAT technologies is poor when detecting cervical cancer, the invention provides a group of artificially optimized high-specificity probes, which have excellent effects in terms of quantitative Limit (LOQ), detection Limit (LOD) and sensitivity, and have excellent linear relation between detection signals and positive cells. Therefore, the invention provides the application of the probe sequence in the preparation of a kit for detecting cervical cancer. Wherein, the cervical cancer comprises one or more of high-risk HPV16\18\31\33\35\39\45\51\52\56\58\59\66\ 68.
According to the application, the invention provides a kit for detecting cervical cancer, which comprises the probe sequence.
More specifically, the kit further comprises one or more than two of a signal amplification precursor, a signal amplification body, an Alkaline Phosphatase (AP) labeled reporter probe, a chemiluminescent substrate and a carrier coupled with a universal probe;
wherein the universal probe is complementary paired with a partial sequence of the capture extension probe of the invention;
the signal amplification precursor comprises an amplification precursor leader sequence and a multiply repeated amplicon leader complement sequence;
the signal amplifier comprises an amplifier preposition guide region sequence and a repeated reporting probe complementary sequence;
the sequence of the pre-boot region of the amplification precursor is complementary and matched with the partial sequence of the K-type labeled extension probe;
the magnifying glass pre-guide region sequence is complementarily paired with the repeated magnifying glass pre-guide region complementary sequence;
and the alkaline phosphatase-labeled report probe is complementarily paired with the repeated region complementary sequence of the repeated report probe.
According to various carrier forms commonly used in the art, the carrier of the present invention is preferably a magnetic bead or a cell culture plate, and the universal probe can be either coupled to a group on the surface of the magnetic bead or coated on the cell culture plate through some modification, such as amino modification.
In the specific embodiment of the invention, the invention provides a specific universal probe, and the sequence of the probe is shown as SEQ ID No. 413.
In the selection of luminescent substrates, the invention selects adamantane derivatives as luminescent substrates for AP reporter probes for detection in a chemiluminescent analyzer.
The signal amplification precursors, signal amplification entities, Alkaline Phosphatase (AP) -labeled reporter probes of the present invention may correspond to those described or specifically designed in the primary signal amplification strand, secondary signal amplification strand and AP-conjugated reporter probes disclosed in patent CN 105861669A.
Preferably, the plurality of repetitions of the present invention is 20 repetitions.
Preferably, the universal probe is complementary and matched with a partial sequence of the capture extension probe, wherein the partial sequence is a 16bp sequence from the 3 'end to the 5' direction of the capture extension probe; in a specific embodiment of the invention, all probes with terminal 16bp sequence CTCTTGGAAAGAAAGT belong to the capture extension probes, which can be complementarily paired and combined with the universal probe shown in SEQ ID No. 413.
Preferably, the pre-amplification leader sequence is complementary and paired with a partial sequence of the K-type labeled extension probe, wherein the partial sequence is a 14bp sequence from the 3 'end to the 5' direction of the K-type labeled extension probe; in a specific embodiment of the present invention, all probes having terminal 14bp sequences of ctgagtcaaagcat or gaagttaccgtttt belong to the class K-type labeled extension probes, which are capable of complementary pairing with the pre-amplimer leader sequence, and thus the pre-amplimer leader sequence can also be designed.
A set of QuantiMAT probe sequences aiming at high-risk HPV16\18\31\33\35\39\45\51\52\56\58\59\66\68 is designed through a ProbeDesigner V1.0 tool (http:// www.probedesigner.cn) as a control, in order to ensure the comparability, all probes with the terminal 16bp sequence of CTCTTGGAAAGAAAGT in the control probe belong to capture extension probes (CE), all probes with the terminal 14bp sequence of ctgagtcaaagcat or gaagttaccgtttt belong to K-type labeled extension probes (LE), and the rest are blocked probes (BL) specifically as follows:
HPV type 31:
NKV31001-CE：GTCTTTCTGCAGGATTTTTGAACTTTTTCTCTTGGAAAGAAAGT；NKV31002-CE：GCTTAGTTCATGCAATTTCCGAGTTTTTCTCTTGGAAAGAAAGT；NKV31003-CE：CCTCTGTTTCTGTTAACTGACCTTTGTTTTTCTCTTGGAAAGAAAGT；NKV31004-CE：ATCTAAATTCACTTACTTTTGAATAAAATTTTTTCTCTTGGAAAGAAAGT；NKV31005-CE：CATATACCTTTGTTTGTCAATTTTTCTTTTTTCTCTTGGAAAGAAAGT；NKV31006-CE：ACGCATGTTTACACTTGGGTTTTTTTTCTCTTGGAAAGAAAGT；NKV31007-CE：TCTGAGCTGTCGGGTAATTGCTTTTTCTCTTGGAAAGAAAGT；NKV31008-LE：GTAGGGTATTTCCAATGCCGATTTTTGAAGTTACCGTTTT；NKV31009-LE：CAGTAGACACAATTCAATCTTAGTTCATCTTTTTCTGAGTCAAAGCAT；NKV31010-LE：GTGGTGTGTCGTCCCTATATACTATTTTTTTGAAGTTACCGTTTT；NKV31011-LE：CTTAAACATTTTGTACACACTCCGTTTTTTCTGAGTCAAAGCAT；NKV31012-LE：ACACGTTATACACCTAATTAACAAATCATTTTTGAAGTTACCGTTTT；NKV31013-LE：TCTTCTGGACACAACGGTCTTTGTTTTTCTGAGTCAAAGCAT；NKV31014-LE：TCTTTTTATCCAAATGTCTTTGTTTTTTTTTGAAGTTACCGTTTT；NKV31015-LE：TTCCTCCTATGTTGTGGAATCGTTTTTTTCTGAGTCAAAGCAT；NKV31016-LE：CTTGCAACGTAGGTGTTTCTCCTTTTTGAAGTTACCGTTTT；NKV31017-LE：CTCAGGTTGCAAATCTAACACATAGTTTTTTCTGAGTCAAAGCAT；NKV31018-LE：GGACTGTCTATGACATCCTCCTCATTTTTGAAGTTACCGTTTT；NKV31019-LE：CCGGTTCTGCTTGTCCAGCTTTTTTCTGAGTCAAAGCAT；NKV31020-BL：GTTAAATCTGTAAATGCAAAATCTAATA；NKV31021-BL：AATGTTGTTCCATACACACTATATCTATACC；NKV31022-BL：CTATGCAACGTCCTGTCCACC；NKV31023-BL：CAGTACGAGGTCTTCTCCAACATG；NKV31024-BL：TCATAACAGTGGAGGTCAGTTGC；
HPV type 39:
NKV39001-CE：TACCTCGGTTTGCTGTAGTGGTTTTTCTCTTGGAAAGAAAGT；NKV39002-CE：GGTTCCCCGTCCCTATATACTATTTTTCTCTTGGAAAGAAAGT；NKV39003-CE：TTTATGAAATCTTCGTTTGCTATTTTTTTTCTCTTGGAAAGAAAGT；NKV39004-CE：GGTCCACGCATATCTGATGTTATATTTTTCTCTTGGAAAGAAAGT；NKV39005-CE：TTTCCTGCAAGGTGGGCTTTTTTTTCTCTTGGAAAGAAAGT；NKV39006-CE：CCGTGAGGCTTCTACTACCAGCTTTTTTCTCTTGGAAAGAAAGT；NKV39007-CE：ACAAATCCTAGTGAGTCCATAAACAGTTTTTCTCTTGGAAAGAAAGT；NKV39008-LE：CATGATTGGCATGCAGCTAGTTTTTTGAAGTTACCGTTTT；NKV39009-LE：CCCGTATTTTAGCATAAAATTTTATATTTTTCTGAGTCAAAGCAT；NKV39010-LE：CCGAGTCCGAGTAATATCGTAGCTTTTTTGAAGTTACCGTTTT；NKV39011-LE：TTAGTTATATTTTCTAATGTAGTTGCATACATTTTTCTGAGTCAAAGCAT；NKV39012-LE：CACAGCGGTTTCAGACAACACATTTTTGAAGTTACCGTTTT；NKV39013-LE：AGGTGTCTTAATTTTTCTGCTGGATTTTTCTGAGTCAAAGCAT；NKV39014-LE：TTCATTGTAAGGACATAAATCTAATACAATTTTTGAAGTTACCGTTTT；NKV39015-LE：CATACAAGGTCAACCGGCTGTATTTTTTCTGAGTCAAAGCAT；NKV39016-LE：GTCGGGTTCATCTATTTCATCCTTTTTTGAAGTTACCGTTTT；NKV39017-LE：TTGATGTTGGTGATTAACTGCATGTTTTTCTGAGTCAAAGCAT；NKV39018-LE：GGTTCATCCCGTCTGGCTAGTAGTTTTTGAAGTTACCGTTTT；NKV39019-LE：GAACACTGTATTGTGTGACGCTGTTTTTTCTGAGTCAAAGCAT；NKV39020-BL：CATATAAATCACTAAATGCAAATTCATA；NKV39021-BL：TGCACCTTATTAATAAATTATATAACTTTGTA；NKV39022-BL：ACTGTCCTGTATAGCTTCCTGCTAT；NKV39023-BL：TGGTCCAGCACCGTCGAC；NKV39024-BL：TGCGGTCCTCCCGTTTTG；NKV39025-BL：CTTGGGTTTCTCTTCGTGTTAGTC；NKV39026-BL：CTGACTCTCCTAATTGCTCGTGA；NKV39027-BL：GCAGTGTGTTGTTACACTTACAACAC；NKV39028-BL：CTGCTGTAGTTGTCGCAGAGTATC；
HPV type 33:
NKV333-BL：CAGATCGTTGCAAAGGTTTTTT；NKV338-BL：ATTTCCATATACAGAATAATTATAATGTCTAT；NKV339-BL：AAGGTTTTTTAACTGTTTGTTCTAATGT；NKV3310-BL：GACATATAATACACCTAATTAATATTTCATTTA；NKV3314-BL：CAGCGCCCTGCCCAAC；NKV3320-BL：CTCATAGCAGTATAGGTCAGTTGGTT；NKV3321-BL：CCTCATCTGAGCTGTCACTTAATTG；NKV3327-BL：TTGCTGTATGGTTCGTAGGTCAC；NKV334-CE：CTGCAAATGCAAAATCATATACCTTTTTTCTCTTGGAAAGAAAGT；NKV337-CE：ATTCACTAATTTTAGATAAGAACCGCTTTTTCTCTTGGAAAGAAAGT；NKV3313-CE：GACCCGAAATATTATGAAATCGTTTTTTTCTCTTGGAAAGAAAGT；NKV3315-CE：ACCTCCAACACGCCGCATTTTTCTCTTGGAAAGAAAGT；NKV3322-CE：GCCGGTCCAAGCCTTCATTTTTTCTCTTGGAAAGAAAGT；NKV3328-CE：CAATATTCACTGTGCCCATAAGTAGTTTTTCTCTTGGAAAGAAAGT；NKV331-LE：TGTTGTGTATAGTTGTCTCCAATGCTTTTTTGAAGTTACCGTTTT；NKV332-LE：GCATTCCACGCACTGTAGTTCAATTTTTCTGAGTCAAAGCAT；NKV335-LE：ATTTCCCTCTCTATATACAACTGTTAAATTTTTTGAAGTTACCGTTTT；NKV336-LE：AAACACAGTTTACATATTCCAAATGGTTTTTCTGAGTCAAAGCAT；NKV3311-LE：TTTCTTGAGGACACAAAGGTCTTTTTTTTGAAGTTACCGTTTT；NKV3312-LE：TGTTTAAATCCACATGTCGTTTTTTTTTTCTGAGTCAAAGCAT；NKV3316-LE：GTGCAGTTTCTCTACGTCGGGTTTTTGAAGTTACCGTTTT；NKV3317-LE：ATGGCGTTTTTACACGTCACATTTTTCTGAGTCAAAGCAT；NKV3318-LE：AACGTTGGCTTGTGTCCTCTCTTTTTGAAGTTACCGTTTT；NKV3319-LE：CAGGATATAAATCTAAAACATATTCCTTTTTTTTCTGAGTCAAAGCAT；NKV3323-LE：GCTGGTTGTGCTTGTCCATCTGTTTTTGAAGTTACCGTTTT；NKV3324-LE：CAGGTTACAATGTAGTAATCAGCTGTGTTTTTCTGAGTCAAAGCAT；NKV3325-LE：AACTGTGGTGTTACAAGTGTGACAATTTTTGAAGTTACCGTTTT；NKV3326-LE：TTGCTGTACTGTTGACACATAAACGTTTTTCTGAGTCAAAGCAT；
HPV type 35:
NKV356-BL：TCTATATACTATACACAAATCATAGCATGC；NKV358-BL：GAATAAAATTTTAAACATTTCATGCA；NKV359-BL：ACTATATCTATACCATCTATATTCACTTATTTTT；NKV3513-BL：TTGCTTTTCAACTGGACACAGC；NKV3514-BL：GAATCGTTTTTTTTCTTCTAAATGTCT；NKV3516-BL：AACAGGACATACACCGACCTGTC；NKV3517-BL：GGTTTCTCTACGTGTTGGTTTCC；NKV3518-BL：TTCTCCATGCATGATTACACCTC；NKV3526-BL：CAGACGTAGTGTCGCCTCACAT；NKV3527-BL：TGTCAATGTGTGTGCTCTGTACACA；NKV353-CE：CAAACAAATTTCATGGATGCTTTCTTTTTCTCTTGGAAAGAAAGT；NKV357-CE：TACTCCATATGGCTGGCCTTCTTTTTCTCTTGGAAAGAAAGT；NKV3510-CE：TGTTTTTCTAACGTTTCTCCATACACTTTTTCTCTTGGAAAGAAAGT；NKV3515-CE：CACCGTCCACCGATGTTATGTTTTTCTCTTGGAAAGAAAGT；NKV3523-CE：TCCAGCTGGACCGTCAATAGTATTTTTTCTCTTGGAAAGAAAGT；NKV3528-CE：CCATTAATAAATCTTCCAATTTACGTATTTTTCTCTTGGAAAGAAAGT；NKV351-LE：GCAGTTTGTAAGGTCGTTCAGCTTTTTTGAAGTTACCGTTTT；NKV352-LE：TTCTACCTCGTTGCACAAATCATTTTTTCTGAGTCAAAGCAT；NKV354-LE：TAATTCTTGTTTGCAGTATACACAATTTTTTTGAAGTTACCGTTTT；NKV355-LE：AAAGTCATATACCTCACTCCGCTGTTTTTCTGAGTCAAAGCAT；NKV3511-LE：AATAAATGACATAACTGTTTGTTGCATTTTTTGAAGTTACCGTTTT；NKV3512-LE：GGTTTTTGACATGTAATACACCTAATTTTTTTCTGAGTCAAAGCAT；NKV3519-LE：TCTAAAACATAGTCTTGCAATGTAGTTATTTTTTGAAGTTACCGTTTT；NKV3520-LE：AGTTGCCTCGGGTTCCAAATTTTTCTGAGTCAAAGCAT；NKV3521-LE：ACACAATTGCTCATAACAGTATAGGTCTTTTTGAAGTTACCGTTTT；NKV3522-LE：CTTCCTCCTCCTCTGAGCTGTCTTTTTCTGAGTCAAAGCAT；NKV3524-LE：GGAGGTGTCTGGTTTTGCTTGTTTTTGAAGTTACCGTTTT；NKV3525-LE：TTACAACAGGACGTTACAATATTATAATTTTTTTCTGAGTCAAAGCAT；
HPV type 45:
NKV45E6E75-BL：GCAGCATATGCTATACAGTCTCTATACAC；NKV45E6E76-BL：GGAATAAAAGTCTATACATTTATGGCAT；NKV45E6E77-BL：GAGTTTGAATAATATCTTAATTCTCTAATTCT；NKV45E6E78-BL：TTTTTTCCAGTGTCTCTCCATATACA；NKV45E6E79-BL：CTTATTAACAAATTATACAACTCTGTATTAGTTA；NKV45E6E710-BL：TCTGGCACCGCAGGCAC；NKV45E6E713-BL：TCCAGCTATGCTGTGGAATCTT；NKV45E6E726-BL：TTACAACATACACACAAAATTTTGTGA；NKV45E6E73-CE：TATACCTCTGTGCGTTCCAATGTTTTTTCTCTTGGAAAGAAAGT；NKV45E6E74-CE：TATAAATAAATCTTTAAAAGCAAATTGATTTTTCTCTTGGAAAGAAAGT；NKV45E6E718-CE：CAGTGTTGCTCGGGGTCCATTTTTCTCTTGGAAAGAAAGT；NKV45E6E723-CE：TGACTAACGCCATCTGCTTCATTTTTTCTCTTGGAAAGAAAGT；NKV45E6E727-CE：AGCTCAATTCTGCCGTCACACTTTTTCTCTTGGAAAGAAAGT；NKV45E6E728-CE：CATCTGCCGAGCTCTCTACTGTATTTTTCTCTTGGAAAGAAAGT；NKV45E6E711-LE：TTTCTGCTGGGTTCAATGGTTTTTTTGAAGTTACCGTTTT；NKV45E6E712-LE：CGTTTGTCCTTAAGGTGTCTACGTTTTTTTCTGAGTCAAAGCAT；NKV45E6E714-LE：TGTATTACACTGCCCTCGGTACTGTTTTTGAAGTTACCGTTTT；NKV45E6E715-LE：GCCGTGCCTGGTCACAACATTTTTCTGAGTCAAAGCAT；NKV45E6E716-LE：CCTACGTCTGCGAAGTCTTTCTTTTTTTGAAGTTACCGTTTT；NKV45E6E717-LE：TGCATACTTATTGCTATACTTGTGTTTCTTTTTCTGAGTCAAAGCAT；NKV45E6E719-LE：TTCCAAATGCAATACAATTTCTTGTTTTTGAAGTTACCGTTTT；NKV45E6E720-LE：CAACAGGATCTAATTCATTCTGAGGTTTTTCTGAGTCAAAGCAT；NKV45E6E721-LE：TTAATTGCTCGTAACACAACAGGTTTTTTGAAGTTACCGTTTT；NKV45E6E722-LE：CGTTTTCCTCCTCTGACTCGCTTTTTCTGAGTCAAAGCAT；NKV45E6E724-LE：TCGGGCTGGTAGTTGTGCATTTTTGAAGTTACCGTTTT；NKV45E6E725-LE：CGCTGTGGTTCGGCTCGTTTTTCTGAGTCAAAGCAT；
HPV type 52:
NKV526-BL：CTATTCGTAAATCTGTAAATAGAAACTTG；NKV527-BL：CGCCATATGGATTATTGTCTCTATATA；NKV528-BL：AAAAGCGTAGGCACATAATACACA；NKV529-BL：TGATAATGCCTATATTCACTTATCTTAGATA；NKV5210-BL：TCTAATGTTTTCCCATACAGTGAATAT；NKV5211-BL：CACTTAATGGTTTTTTTACCCTCTCT；NKV5212-BL：CGTTTGACAAATTATACATCTAATAGTTATTT；NKV5215-BL：CCAACGACCCATAATATTATGAAA；NKV5220-BL：TTGTTTCAGGTTGCAGATCTAATATAT；NKV5221-BL：AATTGCTCATAGCAGTGTAGGTCAG；NKV5222-BL：CCTCCTCATCTGAGCTGTCACCT；NKV5228-BL：TGTAGAGTACGAAGGTCCGTCG；NKV5230-BL：CCGGGGCACACAACTTGTAA；NKV5231-BL：GGTTGTTTATAGCCGTGCACAG；NKV521-CE：GTGCAGGGTCCGGGGTCTTTTTCTCTTGGAAAGAAAGT；NKV5216-CE：CACTCTGAACAGCGCCCTGTTTTTTCTCTTGGAAAGAAAGT；NKV5217-CE：CACAGGTCGGGGTCTCCAATTTTTCTCTTGGAAAGAAAGT；NKV5227-CE：CAGTGCTATGAATGCATAGCCGTTTTTCTCTTGGAAAGAAAGT；NKV5229-CE：TGTGCCCAACAGCATTTGCTTTTTCTCTTGGAAAGAAAGT；NKV5232-CE：TTCAGGGTCCTCCATTGCAGTTTTTCTCTTGGAAAGAAAGT；NKV522-LE：CTTCCAGCACCTCACACAATTCTTTTTGAAGTTACCGTTTT；NKV523-LE：GCCTTATTTCATGCACCGATTTTTTTCTGAGTCAAAGCAT；NKV524-LE：TTTGCACTGCACACACTGCATTTTTGAAGTTACCGTTTT；NKV525-LE：TATACCTCTCTTCGTTGTAGCTCTTTTTTTTCTGAGTCAAAGCAT；NKV5213-LE：TTTCTTTTTCTTCAGGACATAATGGTTTTTGAAGTTACCGTTTT；NKV5214-LE：TCGCTTGTTTGCATTAACATGTCTTTTTCTGAGTCAAAGCAT；NKV5218-LE：CGCATGACGTTACACTTGGGTTTTTTGAAGTTACCGTTTT；NKV5219-LE：AATCTTTTATAGTTGCTTTGTCTCCATTTTTCTGAGTCAAAGCAT；NKV5223-LE：GCCGGTCCACACCATCTGTATTTTTTGAAGTTACCGTTTT；NKV5224-LE：GCTTGTTCTGCTTGTCCATCTGTTTTTCTGAGTCAAAGCAT；NKV5225-LE：ATGTCACAATGTAGTAATTGCTTGTGTTTTTGAAGTTACCGTTTT；NKV5226-LE：TAGTGTGCTATCACAACTGTGACAATTTTTTCTGAGTCAAAGCAT；
HPV type 51:
NKV51001-CE：GGTCTTTCCCTCTTGTCTTCGAATTTTTCTCTTGGAAAGAAAGT；NKV51002-CE：TGCATAGAAACGTTCAAAGCTTCTTTTTCTCTTGGAAAGAAAGT；NKV51003-CE：TTTGAATAAAACAGTAAACATTGTTTGTTTTTCTCTTGGAAAGAAAGT；NKV51004-CE：TCGATAAATCATATAAGCTTTTTTTAGTAATTTTTCTCTTGGAAAGAAAGT；NKV51005-CE：CGCATTGCCCCGTCCAATTTTTCTCTTGGAAAGAAAGT；NKV51006-CE：CGTGTACGTTGCCAGCAATTAGTTTTTCTCTTGGAAAGAAAGT；NKV51007-CE：GGAGCTTCAATTCTGTAACACGTATTTTTCTCTTGGAAAGAAAGT；NKV51008-LE：TTACAATACACACACACTACCTGTATATTGTTTTTGAAGTTACCGTTTT；NKV51009-LE：TTATATACATCTGCTCTACATAATTCCTTTTTTTTCTGAGTCAAAGCAT；NKV51010-LE：ATACAATCTTAATTTCAGTAAATGCTACATTTTTGAAGTTACCGTTTT；NKV51011-LE：CATACTGCATATGGATTATTATCCCTATTTTTTCTGAGTCAAAGCAT；NKV51012-LE：ACCTGCTATAACGTCTATACTCTCTAATTTTTTTGAAGTTACCGTTTT；NKV51013-LE：TTGCCTCTAATGTAGTACCATACACAGTTTTTCTGAGTCAAAGCAT；NKV51014-LE：GTGGTCTTTGACATCTATGACACCTTATTTTTGAAGTTACCGTTTT；NKV51015-LE：TTTGCTTTTCTTCAGGCCCAATTTTTCTGAGTCAAAGCAT；NKV51016-LE：CACTTGGGTTTCGTTACGTTGTTTTTTGAAGTTACCGTTTT；NKV51017-LE：CATTACCACGCATGGCTTTATTATTTTTCTGAGTCAAAGCAT；NKV51018-LE：TGCAATACTACATCTTTTAATTGTGGTATTTTTGAAGTTACCGTTTT；NKV51019-LE：AGTCAATTTCAGTCTGTGGTGTTAAATTTTTCTGAGTCAAAGCAT；NKV51020-LE：TCAAATTGCTCGTAGCATTGCATTTTTGAAGTTACCGTTTT；NKV51021-LE：TACTTCATCCTCCTCCTCTGAGCTGTTTTTCTGAGTCAAAGCAT；NKV51022-BL：ACATAATTCATGCAGCGTTCGT；NKV51023-BL：CTTTTTTTTTCGTCCACCAATT；NKV51024-BL：CGTCCCGCTATTTCATGGAAC；NKV51025-BL：CTGGTAGCTGGTCACGCATATTATC；NKV51026-BL：GCCTGTCCAGCCCGTCTTT；
HPV type 56:
NKV56001-CE：GTTAGTTCTTTTTTGCAATATACACATGTTTTTCTCTTGGAAAGAAAGT；NKV56002-CE：ATGCAAAATTATATACCTCAGCACGTTTTTTCTCTTGGAAAGAAAGT；NKV56003-CE：GCACACTGCATAAGGAAAATCATTTTTCTCTTGGAAAGAAAGT；NKV56004-CE：CACAATGCAATTGCTTTTCCTCTTTTTCTCTTGGAAAGAAAGT；NKV56005-CE：CTATTAGATGAAATCGTCTTTTTCTGTTTTTTCTCTTGGAAAGAAAGT；NKV56006-CE：GTCTCCAGCACCCCAAACATTTTTTCTCTTGGAAAGAAAGT；NKV56007-CE：AGGTCAATTTCTGTTTGAGGTGTTATTTTTCTCTTGGAAAGAAAGT；NKV56008-LE：CATACACTGAATAGTCATAATACCTATATTTTTTTTGAAGTTACCGTTTT；NKV56009-LE：GTTTTTTAGTTATACTTTCTAGTGTAGCTCTTTTTCTGAGTCAAAGCAT；NKV56010-LE：GTAGCACCTTATTAATAAATCACATAACTTTTTTGAAGTTACCGTTTT；NKV56011-LE：CGGAGTTAACGGACTTTGACATCTTTTTTCTGAGTCAAAGCAT；NKV56012-LE：TGTAGATTCTCTAGGTTCTCTAGATGTTTTTTTTGAAGTTACCGTTTT；NKV56013-LE：TTGGTACTTTACCATGCATGATTATACTTTTTCTGAGTCAAAGCAT；NKV56014-LE：CCTCATCCTCATCCTCTGAGCTTTTTTGAAGTTACCGTTTT；NKV56015-LE：GCTCCTGCAAATGGTCTACTTCATTTTTTCTGAGTCAAAGCAT；NKV56016-LE：CTTGTCTAGCTTGCTGTGGCCTTTTTGAAGTTACCGTTTT；NKV56017-LE：GTGTATTAGGTAACACGTATGTTGTTTAGTTTTTCTGAGTCAAAGCAT；NKV56018-LE：CACAAACTTACACTCACAACAAGGTACTTTTTGAAGTTACCGTTTT；NKV56019-LE：GGTACTGTGAATGTCCAACTGCACTTTTTCTGAGTCAAAGCAT；NKV56020-BL：TCCCTATACACTAAGTTTAATTCAGTGC；NKV56021-BL：TCTAACTTTACTATAAAACAATAAACATACTCT；NKV56022-BL：GACCCGGTCCAACCATGTG；NKV56023-BL：GTTCTAATATAACGTCTTGCAGCG；NKV56024-BL：GTCCAATTGCTCATTGCACTGT；
HPV type 58:
NKV58001-CE：CTCCTCTGCGTCCTGGAACATTTTTCTCTTGGAAAGAAAGT；NKV58002-CE：TCAATTCGATTTCATGCACAGATTTTTCTCTTGGAAAGAAAGT；NKV58003-CE：GTCTTTTTGCATTCAACGCATTTTTTTCTCTTGGAAAGAAAGT；NKV58004-CE：CACTATTCTTAAATCTGCAAATACAAAGTTTTTCTCTTGGAAAGAAAGT；NKV58005-CE：AGCAATCGTAAGCACACTTTACATACTTTTTCTCTTGGAAAGAAAGT；NKV58006-CE：ATTAATATTTCATTTAAACACTTTTTTAGTGTTTTTTCTCTTGGAAAGAAAGT；NKV58007-CE：CCGTCCAAGCCTATTTCATCCTTTTTTCTCTTGGAAAGAAAGT；NKV58008-LE：ATCATGCAATGTCCGTGGTTTTTTTTGAAGTTACCGTTTT；NKV58009-LE：TGTCTCCAACGCCTGACACAATTTTTCTGAGTCAAAGCAT；NKV58010-LE：ATAATTATAATGTCTATACTCACTTATTTTAGATTTTTTGAAGTTACCGTTTT；NKV58011-LE：TTGTTCTAATGTGTCTCCATATAGCGATTTTTCTGAGTCAAAGCAT；NKV58012-LE：CAATGGTCTTTGACAAATAATACATCTATTTTTGAAGTTACCGTTTT；NKV58013-LE：TGCCTTTTTTTTTCTTGTGGACATTTTTCTGAGTCAAAGCAT；NKV58014-LE：CCTGTCCAACGACCCGAAATATTTTTTGAAGTTACCGTTTT；NKV58015-LE：TCCAACACACTGCACAGCGCTTTTTCTGAGTCAAAGCAT；NKV58016-LE：TGTGTTTGTCTACGTCGGGGTCTTTTTGAAGTTACCGTTTT；NKV58017-LE：ATGGCGTTGTTACAGGTTACACTTTTTTCTGAGTCAAAGCAT；NKV58018-LE：TCATAGCAGAATAGGTCAGTTGGTTTTTTGAAGTTACCGTTTT；NKV58019-LE：CGTCTGAGCTGTCACATAATTGCTTTTTCTGAGTCAAAGCAT；NKV58020-BL：TCATATACCTCAGATCGCTGCAAA；NKV58021-BL：TGCAAATGGATTTCCATCTCTATA；NKV58022-BL：TATGAAACCTTTTGTTTAAATCCACA；NKV58023-BL：GCGTTGGGTTGTTTCCTCTC；NKV58024-BL：TCAGGATGTAAATCTAAAATATATTCTCTTA；
HPV type 68:
NKV68001-CE：GTCATGCAATGTAGTGTCCAATGTTTTTTCTCTTGGAAAGAAAGT；NKV68002-CE：TGTTAGGTGCCTTAGTTTTTCTGCTTTTTCTCTTGGAAAGAAAGT；NKV68003-CE：CGCTTACTGGTCCAGCAGTGCTTTTTCTCTTGGAAAGAAAGT；NKV68004-CE：CGGTGGGCTTTGGTCCATGTTTTTCTCTTGGAAAGAAAGT；NKV68005-CE：ATAGCTCTAACACAATTTCCTGCATTTTTCTCTTGGAAAGAAAGT；NKV68006-CE：CCCGCGACGCTTCTACTACTTTTTTCTCTTGGAAAGAAAGT；NKV68007-CE：CAAAATTTAGTGAGTCCATAAACAGCTTTTTCTCTTGGAAAGAAAGT；NKV68008-LE：CTTCTGCAATAGACACAGTCTATTGTAACTTTTTGAAGTTACCGTTTT；NKV68009-LE：CATATACCTCTGTCCGTTGTAGTTGCTTTTTCTGAGTCAAAGCAT；NKV68010-LE：ATTTAATACATGATTGGCATGCAGTTTTTGAAGTTACCGTTTT；NKV68011-LE：CGTAGTTCCCGTATTTTAGCATAAATTTTTCTGAGTCAAAGCAT；NKV68012-LE：GCATACACCGATTCCGAGTAATATTTTTTGAAGTTACCGTTTT；NKV68013-LE：CTTTGTATTAGTTATGGTTTCTAATGTAGTTTTTTTCTGAGTCAAAGCAT；NKV68014-LE：ACTCATGCACCTTATCAATAAATTATATAATTTTTGAAGTTACCGTTTT；NKV68015-LE：TGGACACAATGGTTTCAGGCATTTTTCTGAGTCAAAGCAT；NKV68016-LE：CGGCTGTATTTCATTGTATGGACTTTTTGAAGTTACCGTTTT；NKV68017-LE：TGCTCGTGACATACAAGGTCAACTTTTTCTGAGTCAAAGCAT；NKV68018-LE：CTATTTCATCGTCTGAATCTCCTAATTTTTTGAAGTTACCGTTTT；NKV68019-LE：AACTGCATGGTCGGGTTCATTTTTTCTGAGTCAAAGCAT；NKV68020-LE：GCTGTTGTTCGTCCCGTCTGTTTTTGAAGTTACCGTTTT；NKV68021-LE：CAACACAGACACTGAATTCTGTGACTTTTTCTGAGTCAAAGCAT；NKV68022-BL：CTACACATAGGTCACTAAAGGCAAATT；NKV68023-BL：CAAATGGTACCCCGTCTCTATACA；NKV68024-BL：GCTATTTTATGTAATCTTCGTTTTGT；NKV68025-BL：CGACACTGTCCTGTAAAGTTTCCT；NKV68026-BL：GTATGCGTCTGCGGTCCTCT；NKV68027-BL：CATAGTTACTTAAACTTGTGTTTCTTGAC；NKV68028-BL：GCTAGTAGTAGATGTTGGTGGTGATT；NKV68029-BL：AGTTGCAGTGCCTTGTTACACTTA；NKV68030-BL：TGTTGTAGTGTCCGCAGGTTGT；
HPV type 59:
NKV592-BL：GGCAGTTTGTATGGTCGTTGTGTA；NKV593-BL：AATATTCAATGTTGTGCTCAAATCA；NKV597-BL：TACACTATAAATAAGTCATTAAAAGCAAAT；NKV598-BL：GCTGCATACGGTGTACAGTCTCTA；NKV599-BL：CATAAAATGAAATGCATTTCAGACAC；NKV5910-BL：AATCTCTATAATATCTTAATTCTCTTACTCTTG；NKV5915-BL：CTTTTTTCAGTTATATGCTTTAATTTATC；NKV5916-BL：TATATATTCCAGCTATATTATGGAATCTT；NKV5917-BL：GACACCCACGACACTGTCCTG；NKV5926-BL：GATGATTAACTCCATCTGGTTCATCT；NKV5927-BL：CAGCTCGTCTAGCTAGTAGCAAAG；NKV5928-BL：ACAATGTTGTGACGCTGTGGTT；NKV5929-BL：TTGATTATTACACTTACAACACACACAC；NKV591-CE：GGATCCTCAAAGCGTGCCATTTTTCTCTTGGAAAGAAAGT；NKV594-CE：TGATGCGAATATCATGCAGAGGTTTTTCTCTTGGAAAGAAAGT；NKV5913-CE：TCTATAACAGCGTATCAGCAGCTCTTTTTCTCTTGGAAAGAAAGT；NKV5914-CE：TGTTGGACATAGAGGTTTTAGGCATTTTTCTCTTGGAAAGAAAGT；NKV5918-CE：TAGGTGTCTTGCTCGGGTCCTTTTTCTCTTGGAAAGAAAGT；NKV5921-CE：AAAGTGTTGCTTTTGGTCCATGTTTTTCTCTTGGAAAGAAAGT；NKV595-LE：CCCCTTTGCAAAACACACAATTTTTTGAAGTTACCGTTTT；NKV596-LE：TCAAATACCTCTCTTTCTTGCAGTTTTTTTCTGAGTCAAAGCAT；NKV5911-LE：CCTCTAATGTTTCTCCATACACGGTTTTTGAAGTTACCGTTTT；NKV5912-LE：ATGTAACGGTGTCTTGGTTTCAGTTTTTCTGAGTCAAAGCAT；NKV5919-LE：GCGCTTGTCGTTGCTGTCTTTTTTGAAGTTACCGTTTT；NKV5920-LE：CATTGTTTTACACCAGTGTTTCACTACTTTTTCTGAGTCAAAGCAT；NKV5922-LE：GGTTCCAAATCTAAAACAATGTCACTTTTTGAAGTTACCGTTTT；NKV5923-LE：AAGGTCAACTTCCTCATAATTTTGTTTTTTCTGAGTCAAAGCAT；NKV5924-LE：TCAGGTAATTGCTCGTAGCACACTTTTTGAAGTTACCGTTTT；NKV5925-LE：TTTTCATTCTCGGAGTCGGAGTTTTTCTGAGTCAAAGCAT；NKV5930-LE：GCGAGGTTTCTACTACTAGCTGAAGTTTTTGAAGTTACCGTTTT；NKV5931-LE：AAGGCTCGCAATCCGTCTTTTTTTCTGAGTCAAAGCAT；
HPV type 16:
NKV161-LE：GTCTGCTTTTATACTAACCGGTTTCTTTTTGAAGTTACCGTTTT；NKV162-LE：GCAGTTCTCTTTTGGTGCATAAAATTTTTTCTGAGTCAAAGCAT；NKV163-CE：CTCCTGTGGGTCCTGAAACATTTTTTTCTCTTGGAAAGAAAGT；NKV164-LE：AACTGTGGTAACTTTCTGGGTCGTTTTTGAAGTTACCGTTTT；NKV165-LE：AGTTGTTTGCAGCTCTGTGCATTTTTTCTGAGTCAAAGCAT；NKV166-BL：GCAGTACACACATTCTAATATTATATCATGTAT；NKV167-CE：CACGTCGCAGTAACTGTTGCTTTTTTTCTCTTGGAAAGAAAGT；NKV168-BL：CCCGAAAAGCAAAGTCATATACCT；NKV169-LE：TTCCCATCTCTATATACTATGCATAAATTTTTTGAAGTTACCGTTTT；NKV1610-LE：AACATTTATCACATACAGCATATGGATTTTTCTGAGTCAAAGCAT；NKV1611-BL：GTCTATACTCACTAATTTTAGAATAAAACTTTA；NKV1612-CE：TGTTGTTCCATACAAACTATAACAATAATTTTTTCTCTTGGAAAGAAAGT；NKV1613-LE：CGGTTTGTTGTATTGCTGTTCTAATTTTTGAAGTTACCGTTTT；NKV1614-LE：TAATACACCTAATTAACAAATCACACAATTTTTCTGAGTCAAAGCAT；NKV1615-LE：GGACACAGTGGCTTTTGACAGTTTTTTGAAGTTACCGTTTT；NKV1616-LE：CCAGATGTCTTTGCTTTTCTTCATTTTTCTGAGTCAAAGCAT；NKV1617-BL：TTATATTATGGAATCTTTGCTTTTTGT；NKV1618-BL：CCGGTCCACCGACCCC；NKV1619-LE：GATCTGCAACAAGACATACATCGATTTTTGAAGTTACCGTTTT；NKV1620-LE：TGGGTTTCTCTACGTGTTCTTGATTTTTTCTGAGTCAAAGCAT；NKV1621-BL：TGTATCTCCATGCATGATTACAGC；NKV1622-CE：AATCTAACATATATTCATGCAATGTAGGTTTTTCTCTTGGAAAGAAAGT；NKV1623-LE：GAGATCAGTTGTCTCTGGTTGCATTTTTGAAGTTACCGTTTT；NKV1624-LE：GCTGTCATTTAATTGCTCATAACAGTATTTTTCTGAGTCAAAGCAT；NKV1625-BL：CATCTATTTCATCCTCCTCCTCTGA；NKV1626-BL：GTTCTGCTTGTCCAGCTGGAC；NKV1627-CE：ATATTGTAATGGGCTCTGTCCGTTTTTCTCTTGGAAAGAAAGT；NKV1628-LE：TCACACTTGCAACAAAAGGTTACATTTTTGAAGTTACCGTTTT；NKV1629-LE：CGCACAACCGAAGCGTAGAGTTTTTCTGAGTCAAAGCAT；NKV1630-BL：CGAATGTCTACGTGTGTGCTTTGTA；NKV1631-CE：CCCATTAACAGGTCTTCCAAAGTATTTTTCTCTTGGAAAGAAAGT；NKV1632-BL：GGGGCACACAATTCCTAGTGTG；NKV1633-CE：GGTAGATTATGGTTTCTGAGAACAGATTTTTTCTCTTGGAAAGAAAGT；NKV1634-BL：GGTACCTGCAGGATCAGCCAT；NKV1635-CE：CCCGTACCCTCTTCCCCATTTTTTTCTCTTGGAAAGAAAGT；
HPV type 18:
NKV181-CE：CGTTTTTCATTAAGGTGTCTAAGTTTTTTTTTTCTCTTGGAAAGAAAGT；NKV182-LE：CCCAGCTATGTTGTGGAATCGTTTTTTGAAGTTACCGTTTT；NKV183-LE：AATGGCACTGGCCTCTATAGTGTTTTTCTGAGTCAAAGCAT；NKV184-CE：TGCTCGGTTGCAGCACGTTTTTCTCTTGGAAAGAAAGT；NKV185-LE：TCGTTGGAGTCTTTCCTGTCGTTTTTGAAGTTACCGTTTT；NKV186-LE：CTTAATATTATACTTGTGTTTCTCTGCGTTTTTCTGAGTCAAAGCAT；NKV187-CE：TGTTGCCTTAGGTCCATGCATATTTTTCTCTTGGAAAGAAAGT；NKV188-LE：TAAATGCAATACAATGTCTTGCAATTTTTGAAGTTACCGTTTT；NKV189-LE：GGAATTTCATTTTGGGGCTCTTTTTCTGAGTCAAAGCAT；NKV1810-LE：GCTCGTGACATAGAAGGTCAACCTTTTTGAAGTTACCGTTTT；NKV1811-LE：TTTCTTCCTCTGAGTCGCTTAATTTTTTTCTGAGTCAAAGCAT；NKV1812-LE：ATGATTAACTCCATCTATTTCATCGTTTTTTGAAGTTACCGTTTT；NKV1813-LE：CGTCGGGCTGGTAAATGTTGTTTTTCTGAGTCAAAGCAT；NKV1814-BL：TGTGTGACGTTGTGGTTCAGCT；NKV1815-BL：TTCACACTTACAACACATACACAACAT；NKV1816-CE：GCTTTCTACTACTAGCTTAATTCTGGCTTTTTCTCTTGGAAAGAAAGT；NKV1817-LE：GCTCGAAGGTCGTCTGCTGATTTTTGAAGTTACCGTTTT；NKV1818-LE：TGTTCAGAAACAGCTGCTGGAATTTTTTCTGAGTCAAAGCAT；NKV1819-LE：CGGACACACAAAGGACAGGGTTTTTGAAGTTACCGTTTT；NKV1820-LE：ACTGCTGGGATGCACACCATTTTTCTGAGTCAAAGCAT；NKV1821-CE：CTGGATCAGCCATTGTTGCTTTTTTTCTCTTGGAAAGAAAGT；NKV1822-LE：CGTCAGTTTCCTCATCTGAAAACTTTTTTTGAAGTTACCGTTTT；NKV1823-LE：CGTCAAGTCATTTAAGCTTGGTACCTTTTTCTGAGTCAAAGCAT；NKV1824-CE：TACTACCTGCTAATCTTCTATGAGCTTTTTTTCTCTTGGAAAGAAAGT；NKV1825-BL：GAATTAGGAGTCAGCAGTCATTATTC；NKV1826-CE：TGGCCAGGGAAGATCCACTTTTTTCTCTTGGAAAGAAAGT；NKV1827-CE：TTGCAGCTCAATACAAAACGGTTTTTCTCTTGGAAAGAAAGT；
HPV type 66:
NKV66001-CE：CCTGTGTATTGCTGAATATGGAATCTTTTTCTCTTGGAAAGAAAGT；NKV66002-CE：GGCCAATTGTTTCTATATACTAGTTTTAACTTTTTCTCTTGGAAAGAAAGT；NKV66003-CE：ATGTTGCCCCATACACTGAATATTTTTTTCTCTTGGAAAGAAAGT；NKV66004-CE：CTTTTATGTTCACAGTGCAATTGTTTTTTTTCTCTTGGAAAGAAAGT；NKV66005-CE：CATGCATATGCTATATAATGAAATCGTTTTTCTCTTGGAAAGAAAGT；NKV66006-CE：GCATTGTAGGTCAATTTCCGTTTTTTTTCTCTTGGAAAGAAAGT；NKV66007-LE：TGCAGGCTTCGTGGACGTTTTTTTGAAGTTACCGTTTT；NKV66008-LE：TTTGTAATACCTCGCTCAGATGGTTTTTCTGAGTCAAAGCAT；NKV66009-LE：ATCAGATAACTGTTTTTTAGTTATACTTTCTATTTTTGAAGTTACCGTTTT；NKV66010-LE：TGACATCGGTAGCACCTTATTGATAATTTTTCTGAGTCAAAGCAT；NKV66011-LE：CTGCAAACATGACCCGGTCTTTTTGAAGTTACCGTTTT；NKV66012-LE：CTTGTCTACTCGTATGTCTCCAACATTTTTCTGAGTCAAAGCAT；NKV66013-LE：CTTGCAACGTTGGTACTTTACCATTTTTGAAGTTACCGTTTT；NKV66014-LE：GCGGTGCAAGTTCTAATATAACCTTTTTTCTGAGTCAAAGCAT；NKV66015-LE：CTGAGCTGTCCAATTGCTCATTTTTTTGAAGTTACCGTTTT；NKV66016-LE：TCTATTTCATCCTCATCCTCATCCTTTTTTCTGAGTCAAAGCAT；NKV66017-LE：GGCCGCTCCAGCAAATGGTTTTTGAAGTTACCGTTTT；NKV66018-LE：TGTTCAGCTTGTCTAGCTTGCTGTTTTTTCTGAGTCAAAGCAT；NKV66019-BL：CACATGATAATCTAAGATCAAGTAAAGGTA；NKV66020-BL：AACTTGTAAGTTCCTTTTTGCAGTATA；NKV66021-BL：TCAATACATGCAAACCTATATAGCTCTA；NKV66022-BL：CAATAAACATACCCTACATACTGCATAT；NKV66023-BL：TATAGTACCTATATTTTCTAACCTTACTATAAAA；NKV66024-BL：TTCCTCCGGTGTTAACGGACAT；NKV66025-BL：TGCATGGTTATACTGTAGATTCTGTAG；
on the premise that other universal probes, luminescent substrates, signal amplification precursors, signal amplification bodies and AP report probes are consistent, chemiluminescence detection is carried out by taking cervical cancer positive cells with different concentrations as test objects, and the result shows that the signal value of a positive cell specimen with the same concentration detected by adopting the probe sequence is obviously higher than that of a control probe sequence, so that the probe sequence has high specificity for detecting the cervical cancer cells, and the quantitative Limit (LOQ), the detection Limit (LOD) and the sensitivity of detection can be improved.
According to the technical scheme, the design and artificial optimization of the capture extension probe, the K-type labeling probe and the blocking probe are carried out aiming at various high-risk human papilloma virus type E6E7 regions, the specificity of the detection of cervical cancer cells based on similar bDNA and QuantiMAT technologies is further improved, a better quantitative limit, a better detection limit and a better sensitivity are shown, and the kit can be applied to the preparation of the kit.
Drawings
FIG. 1 is a schematic diagram of the working principle of the kit according to the present invention (the carrier is magnetic beads); wherein 1 represents a universal probe, 2 represents a capture extension probe, 3 represents a target RNA, 4 represents a K-type labeled probe, 5 represents a signal amplification precursor, 6 represents a signal amplification body, 7 represents an AP reporter probe, and 8 represents a blocking probe;
FIG. 2 is a schematic view showing the working principle of the kit according to the present invention (the carrier is a cell culture plate); wherein 1 represents a universal probe, 2 represents a capture extension probe, 3 represents a target RNA, 4 represents a K-type labeled probe, 5 represents a signal amplification precursor, 6 represents a signal amplification volume, 7 represents an AP reporter probe, 8 represents a blocking probe, and 9 represents a cell culture plate.
Detailed Description
The invention discloses a cervical cancer detection probe sequence and application thereof, and can be realized by appropriately improving process parameters by referring to the content in the text by the technical personnel in the field. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. The probe sequences and applications of the present invention have been described by way of example, and it will be apparent to those skilled in the art that the present technology can be implemented and applied by modifying or appropriately changing or combining the probe sequences and applications of the present invention without departing from the spirit and scope of the present invention.
According to the sequence probe and other kit components provided by the invention, the working steps and principles of the specific detection are as follows:
cracking a sample to be detected to release target RNA;
then adding the probe sequence of the invention, combining a part of the capture extension probe with a universal probe of a coupling carrier (magnetic beads or a cell culture plate similar to a 96-well plate), and combining the other part with the target RNA; binding the K-type labeled extension probe with the target RNA; the blocking probe is used for blocking some sites to improve the specificity;
after the probe sets are hybridized, a signal amplification precursor, an amplifier, an alkaline phosphatase-labeled probe and a chemiluminescent substrate are gradually added. According to the principle, a set of K-type labeled extension probes can amplify signals 400 times, and generally one target RNA will bind to 20 sets of K-type labeled extension probes, so that one RNA target will be amplified 8000 times. Finally, detecting with a chemiluminescence analyzer, and the schematic diagram is shown in figure 1 and figure 2.
The quantitative detection can obtain the actual multiple difference, and the result is more direct and accurate than the change result of CT in the conventional method TaqMan, and the sensitivity is 100-1000 times higher than that of TaqMan.
Unless otherwise stated, the test environment and conditions in the comparative test of the invention are consistent except for the differences of technical characteristics.
The cervical cancer detection probe sequence and the application thereof provided by the invention are further explained below.
Example 1: the kit for detecting the cervical cancer
1. Probe sequence
A capture extension probe, a K-type label extension probe and a blocking probe selected from one or more than two of the high risk types HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68 of the invention;
2. kit matching components
Universal probes coupled to carriers such as magnetic beads or cell culture plates: SEQ ID No. 413;
signal amplification precursor: ATGCTTTGACTCAG/AAAACGGTAACTTC (magnified prepro leader sequence, two) + AGGATCGTAAGTAACTAAGGACTACC (magnified prepro leader complement) +19 times magnified prepro leader complement (shown in SEQ ID Nos. 414-415);
the signal amplification is general: GGTAGTCCTTAGTTACTTACGATCCT (magnified preposition leader sequence) + GAATCCATTGAATCCTGTGATT (reporter repeat complement) +19 reporter repeat complements (SEQ ID No. 416);
AP-labeled probe: AATCACAGGATTCAATGGATTC-AP (shown in SEQ ID No. 417);
an adamantane derivative.
Example 2: specificity comparison test
1. Test method
Adopting HPV16\18 type cervical cancer positive cells (Caski and hela cells), preparing four cell sample solutions with the concentrations of 80/mL, 160/mL, 320/mL, 640/mL and 1280/mL by using cell sample preservation solution produced by Ketjian company;
and (3) specimen lysis:
after the cell specimen liquid is centrifuged, cell clusters are precipitated, and the following mixed liquid is added: 200. mu.l of lysate (lysate is placed in an incubator at 37 ℃ C. for 20 minutes in advance) and 400. mu.l of test water (mixing ratio 1: 2). The cell pellet was blown with a pipette to disperse and suspend the cells, and 5. mu.l of proteinase K was added. Standing for 1 hour at 65 ℃, and oscillating for 2-3 times in the cracking process. After 1 hour, the sample was taken out and the supernatant was used for detection.
Because the existing commercial cervical cancer positive cells only have HPV16\18 type, other cervical cancer subtypes (31\33\35\39\45\51\52\56\58\59\66\68) adopt the quality control armored RNA of respective viruses, and the RNA concentrations are set to be 0.12ng/ml, 0.25ng/ml, 0.5ng/ml, 1ng/ml and 2 ng/ml;
meanwhile, carrying out specificity comparison by adopting HPV negative cell C33-A and quality control armored RNA of cervical cancer low-risk type 6b/11/42/43/44/53/72 virus;
preparing a detection buffer solution:
taking out the detection probe, putting the closed reaction solution on ice for melting, and uniformly mixing and centrifuging after melting.
The specimen detection buffer was 50 ul/well. The configuration method comprises the following steps: 1ul of blocking reaction solution +17ul of lysis solution +31ul of test water +1ul of detection probe.
Preparing a probe: the concentration of each component requires that the CE probe in the probe group is as follows: LE probe: the approximate ratio of BL probes is 1:4: 2. The final concentration of each probe of each component is 1fmol/ul required by CE, 4fmol/ul required by LE and 2fmol/ul required by BL respectively.
Plate distribution:
and taking the 96-hole capture coating plate coated with the universal probe out of a 4-degree refrigerator, and rewarming at normal temperature. And (3) respectively adding the buffer solution and the supernatant to be detected into a 96-hole capture coated plate:
blank control wells: 98ul of blank buffer +2ul of water for the assay.
Test wells: 98ul of blank control buffer +2ul of test supernatant.
And (3) heat preservation conditions and time: the whole block was sealed with a sealing plate with paper and placed in a 55 ℃ incubator for 3.5 hours.
Signal amplification:
preheating the diluent and 10 Xeluent at 37 deg.C for 20 min; amplifying the precursor, taking out the signal amplifier, thawing on ice, shaking, mixing, and centrifuging.
Preparing required liquid: 1 × eluent: collecting 10 × eluate, and purifying with DDH2Diluting with O to 1 × eluent, wherein the volume ratio of the eluent to the DDH is 10 ×2O＝1:9。
Signal amplification precursor: the volume ratio of the solution is that of the signal amplification precursor: adding the signal amplification precursor prepared by the kit into a proper amount of diluent when the diluent is 1: 1000;
the signal amplification is general: the volume ratio of the solution is signal amplification volume: taking a signal prepared by the kit, amplifying and adding the signal into a proper amount of diluent when the diluent is 1: 1000;
AP-labeled probe: the volume ratio of the solution is AP labeled probe: adding the probe marker prepared by the kit into a proper amount of diluent when the diluent is 1: 1000;
(1) the 96-well capture coated plate was removed from the incubator, the seal plate sticker was lifted, the plate was emptied of liquid, and the plate was washed 3 times with 1 × 200ul of eluent per well. 100ul of the prepared signal amplification precursor was added to each well, and the mixture was placed in a 55 ℃ incubator and incubated for 40 minutes.
(2) The 96-well capture coated plate was removed from the incubator, the seal plate sticker was lifted, the plate was emptied of liquid, and the plate was washed 3 times with 1 × 200ul of eluent per well. The prepared signal is amplified to be 100ul per hole, and the mixture is placed into a 55-DEG C incubator for heat preservation for 40 minutes.
(3) The 96-well capture coated plate was removed from the incubator, the seal plate sticker was lifted, the plate was emptied of liquid, and the plate was washed 3 times with 1 × 200ul of eluent per well. 100ul of the prepared AP-labeled probe was added to each well, and the mixture was placed in a 50 ℃ incubator and incubated for 40 minutes.
Reading a plate:
the substrate adamantane derivative was taken out from the 4 ℃ refrigerator and allowed to rewet. Adding a substrate catalyst after rewarming, wherein the ratio of the substrate to the substrate catalyst is 1000:3, shaking and uniformly mixing, and blowing and uniformly mixing by a pipette again before use.
The 96-well capture coated plate was removed from the incubator, the seal plate sticker was lifted, the plate was emptied of liquid, and the plate was washed 3 times with 1 × 200ul of eluent per well. Adding 100ul of the prepared substrate into each hole, putting the substrate into a 46-DEG C incubator, preserving the heat for 20 minutes, taking the substrate out, and detecting the substrate by a cold light instrument.
2. Test object
The invention comprises the following steps: example 1 sequence probes and kit components thereof;
control group: the probe of the control group and the kit matching components in the embodiment 1 are provided by the invention;
3. results
TABLE 1
| Number of positive cells of HPV16 type (pieces/ml) | Mean value detection according to the invention | Control group detection mean value |
| 80 | 1.98 | 1.2 |
| 160 | 4.74 | 3.36 |
| 320 | 10.17 | 8.33 |
| 640 | 20.78 | 17.62 |
| 1280 | 47.52 | 35.33 |
TABLE 2
| Number of positive cells of HPV18 type (pieces/ml) | Mean value detection according to the invention | Control group detection mean value |
| 80 | 2.56 | 1.89 |
| 160 | 5.87 | 4.86 |
| 320 | 11.78 | 10.21 |
| 640 | 24.32 | 21.53 |
| 1280 | 60.78 | 56.33 |
TABLE 3
As is apparent from the data in tables 1 to 3, the probe sequence of the present invention can obtain higher detection signal values, which indicates that the probe sequence of the present invention has higher detection specificity. Meanwhile, in a linear relation, the R values of the invention are all larger than 0.99, and the invention has good linear relation and more accurate detection result.
In addition, the invention calculates the upper limit of 90% normal value of mRNA concentration of normal population to be 1.0 by detecting and analyzing 127 normal population samples and adopting a percentile method; in order to verify the validity of the normal reference value, 414 samples of patients with cervical cancer and other diseases are detected, and the positive rate of the samples is higher than that of data reported in the literature; 1.0 is considered as the upper limit of the normal value, and both theoretically and clinically practical. Therefore, the normal reference value of the human papilloma virus detection signal is determined to be 0-1.0, and when the detection result is more than or equal to 1.0, the HPV infection can be judged to exist, and the oncogene is in the transcription active stage.
Based on the judgment standard, the cervical cancer negative cells and low-risk type virus armored RNA are adopted as quality control substances, the probe sequences provided by the invention are respectively used for detection, the signal values are all less than 0.8, and the result is judged to be negative, which shows that the probe sequences have high specificity and false positive can not occur.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Zhengzhou Ketuya Biotechnology Co., Ltd
<120> cervical cancer detection probe sequence and application thereof
<130> MP1730589
<160> 417
<170> SIPOSequenceListing 1.0
<210> 1
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
ggaaattgca tgaactaagc tcggtttttc tcttggaaag aaagt 45
<210> 2
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
acagatttaa caatagtata tagggacgac tttttctctt ggaaagaaag t 51
<210> 3
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
gtgtccagaa gaaaaacaaa gacatttgtt tttctcttgg aaagaaagt 49
<210> 4
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
tactgaaacc caagtgtaaa catgcgtttt tctcttggaa agaaagt 47
<210> 5
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
aactgacctc cactgttatg agcatttttc tcttggaaag aaagt 45
<210> 6
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
gacaagcaaa accggacaca tcctttttct cttggaaaga aagt 44
<210> 7
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
attgaattgt gtctactgca aaggtcagtt tttgaagtta ccgtttt 47
<210> 8
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
ttaacagaaa cagaggtatt agattttgca ttttttttct gagtcaaagc at 52
<210> 9
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
acaccatacg gagtgtgtac aaaatgtttt tgaagttacc gtttt 45
<210> 10
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
tttaagattt tattctaaag taagtgaatt tagatggttt ttctgagtca aagcat 56
<210> 11
<211> 57
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
aaattgacaa acaaaggtat atgtgattta ttaattagtt tttgaagtta ccgtttt 57
<210> 12
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
gtgtataacg tgtcagagac cgtttttttc tgagtcaaag cat 43
<210> 13
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
tggagaaaca cctacattgc aagacttttt gaagttaccg tttt 44
<210> 14
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
tatgtgttag atttgcaacc tgaggctttt tctgagtcaa agcat 45
<210> 15
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
attacccgac agctcagatg aggtttttga agttaccgtt tt 42
<210> 16
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
aggatgttat agacagtcca gctgtttttc tgagtcaaag cat 43
<210> 17
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
aattacaata tcgttacctt ttgttgtcag tgtttttgaa gttaccgttt t 51
<210> 18
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
tgagtctaca cttcgtttgt gtgtactttt tctgagtcaa agcat 45
<210> 19
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
agagcacaca agtagatatt cgcatatttt tttgaagtta ccgtttt 47
<210> 20
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
gcaagagctg ttaatgggct catttttttc tgagtcaaag cat 43
<210> 21
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
atgttcaaaa atcctgcaga aagacctc 28
<210> 22
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
cattggaaat accctacgat gaactaag 28
<210> 23
<211> 33
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
tatagatata gtgtgtatgg aacaacatta gaa 33
<210> 24
<211> 29
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
gataaaaaga aacgattcca caacatagg 29
<210> 25
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
aggaaggtgg acaggacgtt g 21
<210> 26
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
catagtatgt tggagaagac ctcg 24
<210> 27
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
tggaatcgtg tgccccaact g 21
<210> 28
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
atgtttcaag acatgtttca agacactgtt tttctcttgg aaagaaagt 49
<210> 29
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
gtgccaagca ttggagacaa ctattttttc tcttggaaag aaagt 45
<210> 30
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
aggtatatga ttttgcattt gcagatttaa cagtttttct cttggaaaga aagt 54
<210> 31
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
ttgtatatag agagggaaat ccatttggtt tttctcttgg aaagaaagt 49
<210> 32
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
tatactgcta tgagcaatta agtgacagtt tttctcttgg aaagaaagt 49
<210> 33
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
tacagcaagt gacctacgaa ccattttttc tcttggaaag aaagt 45
<210> 34
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
acacaacatt gaactacagt gcgtgttttt gaagttaccg tttt 44
<210> 35
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
gaatgcaaaa aacctttgca acgatctgtt tttctgagtc aaagcat 47
<210> 36
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
aatatgtaaa ctgtgtttgc ggttcttatc tttttgaagt taccgtttt 49
<210> 37
<211> 60
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
taaaattagt gaatatagac attataatta ttctgtatat gtttttctga gtcaaagcat 60
<210> 38
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 38
gaaatacatt agaacaaaca gttaaaaaac ctttaaattt ttgaagttac cgtttt 56
<210> 39
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 39
tgaaatatta attaggtgta ttatatgtca aagacctttt tctgagtcaa agcat 55
<210> 40
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 40
ccgacgtaga gaaactgcac tgtttttgaa gttaccgttt t 41
<210> 41
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 41
tgacgtgtaa aaacgccatg agagtttttc tgagtcaaag cat 43
<210> 42
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 42
gacacaagcc aacgttaaag gaatatgttt ttgaagttac cgtttt 46
<210> 43
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 43
ttttagattt atatcctgaa ccaactgacc tttttctgag tcaaagcat 49
<210> 44
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 44
accggccaga tggacaagca tttttgaagt taccgtttt 39
<210> 45
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 45
caaccagcca cagctgatta ctactttttc tgagtcaaag cat 43
<210> 46
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 46
attgtaacct gttgtcacac ttgtaacatt tttgaagtta ccgtttt 47
<210> 47
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 47
ccacagttcg tttatgtgtc aacagttttt ctgagtcaaa gcat 44
<210> 48
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 48
acagcaacta cttatgggca cagttttttg aagttaccgt ttt 43
<210> 49
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 49
gaatattgtg tgccctacct gtgctttttc tgagtcaaag cat 43
<210> 50
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 50
aggaaaaacc acgaacattg catgattt 28
<210> 51
<211> 29
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 51
tttgtgtcct caagaaaaaa aacgacatg 29
<210> 52
<211> 33
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 52
tggatttaaa caaacgattt cataatattt cgg 33
<210> 53
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 53
gtcgttgggc agggcgc 17
<210> 54
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 54
tgtgcggcgt gttggaggtc 20
<210> 55
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 55
ctcagatgag gatgaaggct tgg 23
<210> 56
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 56
gaggtagaag aaagcatcca tgaaattttt tttctcttgg aaagaaagt 49
<210> 57
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 57
gtttgaattg tgtatactgc aaacaagaat tactttttct cttggaaaga aagt 54
<210> 58
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 58
ttttagattt ggaacccgag gcaacttttt ctcttggaaa gaaagt 46
<210> 59
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 59
agatactatt gacggtccag ctggtttttc tcttggaaag aaagt 45
<210> 60
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 60
acaagcaaaa ccagacacct ccaatttttc tcttggaaag aaagt 45
<210> 61
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 61
tacagagcac acacattgac atacgttttt ctcttggaaa gaaagt 46
<210> 62
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 62
aatagtgtgc cccggctgtt ctttttctct tggaaagaaa gt 42
<210> 63
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 63
atgtttcagg acccagctga acgtttttga agttaccgtt tt 42
<210> 64
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 64
accttacaaa ctgcatgatt tgtgcaactt tttctgagtc aaagcat 47
<210> 65
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 65
agcggagtga ggtatatgac tttgtttttg aagttaccgt ttt 43
<210> 66
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 66
catgctatga tttgtgtata gtatatagag aagtttttct gagtcaaagc at 52
<210> 67
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 67
gccagccata tggagtatgc atgtttttga agttaccgtt tt 42
<210> 68
<211> 61
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 68
aaatgtttaa aattttattc aaaaataagt gaatatagat ggtttttctg agtcaaagca 60
t 61
<210> 69
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 69
tatagatata gtgtgtatgg agaaacgtta gtttttgaag ttaccgtttt 50
<210> 70
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 70
aaaaacaatg caacaaacag ttatgtcatt tattaatttt ttctgagtca aagcat 56
<210> 71
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 71
taggtgtatt acatgtcaaa aaccgctgtt tttgaagtta ccgtttt 47
<210> 72
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 72
tgtccagttg aaaagcaaag acatttagtt tttctgagtc aaagcat 47
<210> 73
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 73
tagagaaacc gaggtgtaat catgcttttt gaagttaccg tttt 44
<210> 74
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 74
atggagaaat aactacattg caagactatg tttttctgag tcaaagcat 49
<210> 75
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 75
tgacctatac tgttatgagc aattgtgttt tttgaagtta ccgtttt 47
<210> 76
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 76
gacagctcag aggaggagga tttttctgag tcaaagcat 39
<210> 77
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 77
ttataatatt gtaacgtcct gttgtaaatg tgatttttga agttaccgtt tt 52
<210> 78
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 78
ggcgacacta cgtctgtgtg tttttctgag tcaaagcat 39
<210> 79
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 79
aagaaaaaaa acgattccat aacatcggtg 30
<210> 80
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 80
gacggtggac aggtcggtg 19
<210> 81
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 81
tatgtcctgt tggaaaccaa cacg 24
<210> 82
<211> 33
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 82
taaattggaa gatttattaa tgggcacatt tgg 33
<210> 83
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 83
atggcgcgat ttcacaatcc tgctttttct cttggaaaga aagt 44
<210> 84
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 84
ccaccttgca ggacattaca atagtttttc tcttggaaag aaagt 45
<210> 85
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 85
ccaatcatgt ataaaatttt atgctaaaat acggtttttc tcttggaaag aaagt 55
<210> 86
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 86
agaaaaatta agacacctaa atagcaaacg aagtttttct cttggaaaga aagt 54
<210> 87
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 87
ccacaaaacg ggaggaccgc tttttctctt ggaaagaaag t 41
<210> 88
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 88
cccaccttgc aggaaattgt attagttttt ctcttggaaa gaaagt 46
<210> 89
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 89
aacatcaact actagccaga cgggtttttc tcttggaaag aaagt 45
<210> 90
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 90
actgcagctg gtagtagaag cctttttctc ttggaaagaa agt 43
<210> 91
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 91
agaacggcca tacaaattgc cagatttttg aagttaccgt ttt 43
<210> 92
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 92
cctgtgcaca acgctggaca tttttctgag tcaaagcat 39
<210> 93
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 93
cctgtgtcta ttgcagacga cctttttgaa gttaccgttt t 41
<210> 94
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 94
actacagcaa accgaggtat atgaattttt tttctgagtc aaagcat 47
<210> 95
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 95
gcatttagtg atttatatgt agtatatagg gactttttga agttaccgtt tt 52
<210> 96
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 96
ggggaaccac tagctgcatg tttttctgag tcaaagcat 39
<210> 97
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 97
gagctacgat attactcgga ctcgtttttg aagttaccgt ttt 43
<210> 98
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 98
gtgtatgcaa ctacattaga aaatataact aatacttttt ctgagtcaaa gcat 54
<210> 99
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 99
aaagttatat aatttattaa taaggtgcat gtgttgtttt ttgaagttac cgtttt 56
<210> 100
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 100
ctgaaaccgc tgtgtccagc tttttctgag tcaaagcat 39
<210> 101
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 101
atttcataaa atagcaggaa gctatacagg tttttgaagt taccgtttt 49
<210> 102
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 102
acagtgtcga cggtgctgga tttttctgag tcaaagcat 39
<210> 103
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 103
agactaacac gaagagaaac ccaagttttt gaagttaccg tttt 44
<210> 104
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 104
tataacatca gatatgcgtg gaccaaagtt tttctgagtc aaagcat 47
<210> 105
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 105
atttatgtcc ttacaatgaa atacagccgt ttttgaagtt accgtttt 48
<210> 106
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 106
gttgaccttg tatgtcacga gcaatttttc tgagtcaaag cat 43
<210> 107
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 107
ttaggagagt cagaggatga aatagatgtt tttgaagtta ccgtttt 47
<210> 108
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 108
aacccgacca tgcagttaat cacctttttc tgagtcaaag cat 43
<210> 109
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 109
atgaaccaca gcgtcacaca atactttttg aagttaccgt ttt 43
<210> 110
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 110
agtgttcgtg ttgtaagtgt aacaacactt tttctgagtc aaagcat 47
<210> 111
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 111
tcacgggata ctctgcgaca actttttgaa gttaccgttt t 41
<210> 112
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 112
tacagcagct gtttatggac tcactttttc tgagtcaaag cat 43
<210> 113
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 113
taggatttgt gtgtccgtgg tgtg 24
<210> 114
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 114
atggcgcgct ttgacgatcc tttttctctt ggaaagaaag t 41
<210> 115
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 115
aacgcaacga ccctacaagc tactttttct cttggaaaga aagt 44
<210> 116
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 116
tatattgcaa agcaacattg gaacgcactt tttctcttgg aaagaaagt 49
<210> 117
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 117
agagacactg gaaaaaataa ctaatacaga gtttttctct tggaaagaaa gt 52
<210> 118
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 118
gcaagaaaga cttcgcagac gtagtttttc tcttggaaag aaagt 45
<210> 119
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 119
ggaaacacaa gtatagcaat aagtatgctt tttctcttgg aaagaaagt 49
<210> 120
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 120
agaggaggaa aacgatgaag cagatttttc tcttggaaag aaagt 45
<210> 121
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 121
cttacagtag agagctcggc agtttttctc ttggaaagaa agt 43
<210> 122
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 122
cagatttgtg cacagaattg aatacatctt tttgaagtta ccgtttt 47
<210> 123
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 123
actacaagac gtatctattg cctgtgtttt tctgagtcaa agcat 45
<210> 124
<211> 57
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 124
agaggtatat caatttgctt ttaaagattt atttatagtt tttgaagtta ccgtttt 57
<210> 125
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 125
tgtatagaga ctgtatagca tatgctgctt tttctgagtc aaagcat 47
<210> 126
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 126
atgccataaa tgtatagact tttattccag aattttttga agttaccgtt tt 52
<210> 127
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 127
tagagaatta agatattatt caaactctgt atatggtttt tctgagtcaa agcat 55
<210> 128
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 128
ttgtataatt tgttaataag gtgcctgcgt ttttgaagtt accgtttt 48
<210> 129
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 129
gtgccagaaa ccattgaacc cagtttttct gagtcaaagc at 42
<210> 130
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 130
cagaaaaacg tagacacctt aaggactttt tgaagttacc gtttt 45
<210> 131
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 131
aaacgaagat tccacagcat agctgttttt ctgagtcaaa gcat 44
<210> 132
<211> 38
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 132
ggcagtaccg agggcagtgt ttttgaagtt accgtttt 38
<210> 133
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 133
taatacatgt tgtgaccagg cacgtttttc tgagtcaaag cat 43
<210> 134
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 134
agaatgaatt agatcctgtt gacctgtttt tttgaagtta ccgtttt 47
<210> 135
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 135
gtgttacgag caattaagcg agtctttttc tgagtcaaag cat 43
<210> 136
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 136
acagcgtcac aaaattttgt gtgtatgttt tttgaagtta ccgtttt 47
<210> 137
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 137
tgtaagtgtg acggcagaat tgagtttttc tgagtcaaag cat 43
<210> 138
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 138
atgaccttag aacactacag cagctttttg aagttaccgt ttt 43
<210> 139
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 139
tgtttttgag caccttgtcc tttgtgtttt tctgagtcaa agcat 45
<210> 140
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 140
atggacccca ggcaacactg 20
<210> 141
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 141
caagaaattg tattgcattt ggaacctc 28
<210> 142
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 142
tggcgttagt catgcacaac tacc 24
<210> 143
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 143
agcccgacga gccgaacc 18
<210> 144
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 144
acagcgtcac aaaattttgt gtgtatgt 28
<210> 145
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 145
tgtaagtgtg acggcagaat tgag 24
<210> 146
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 146
tgtccgtggt gtgcaactaa cc 22
<210> 147
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 147
atgttcgaag acaatgttcg aagacaagtt tttctcttgg aaagaaagt 49
<210> 148
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 148
agggaaagac cacgaacgct gtttttctct tggaaagaaa gt 42
<210> 149
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 149
ggataataat ccatatgcag tatgcaaact ttttctcttg gaaagaaagt 50
<210> 150
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 150
aaagaccact tgggcctgaa gaaatttttc tcttggaaag aaagt 45
<210> 151
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 151
acggggcaat gcgctaattg ctttttctct tggaaagaaa gt 42
<210> 152
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 152
tagataatat gcgtgaccag ctaccttttt ctcttggaaa gaaagt 46
<210> 153
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 153
agaaagacgg gctggacagg tttttctctt ggaaagaaag t 41
<210> 154
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 154
catgaattat gtgaagcttt gaacgtttct ttttgaagtt accgtttt 48
<210> 155
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 155
tatgcacaat atacaggtag tgtgtgtgtt tttctgagtc aaagcat 47
<210> 156
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 156
tattgtaaaa aggaattatg tagagcagat gtatttttga agttaccgtt tt 52
<210> 157
<211> 57
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 157
tataatgtag catttactga aattaagatt gtatatagtt tttctgagtc aaagcat 57
<210> 158
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 158
aatgtttact gttttattca aaaattagag agtatagttt ttgaagttac cgtttt 56
<210> 159
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 159
acgttatagc aggtctgtgt atggtttttc tgagtcaaag cat 43
<210> 160
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 160
tactacatta gaggcaatta ctaaaaaaag ctttttttga agttaccgtt tt 52
<210> 161
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 161
atatgattta tcgataaggt gtcatagatg tctttttctg agtcaaagca t 51
<210> 162
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 162
agcaaaaatt ggtggacgaa aaaaaaaggt ttttgaagtt accgtttt 48
<210> 163
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 163
ttccatgaaa tagcgggacg ttggtttttc tgagtcaaag cat 43
<210> 164
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 164
tggcaacgta cacgacaacg taactttttg aagttaccgt ttt 43
<210> 165
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 165
gaaacccaag tgtaataaag ccatgctttt tctgagtcaa agcat 45
<210> 166
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 166
gtggtaatgt accacaatta aaagatgtag tttttgaagt taccgtttt 49
<210> 167
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 167
tattgcattt aacaccacag actgaaattg tttttctgag tcaaagcat 49
<210> 168
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 168
acttgcaatg ctacgagcaa tttgactttt tgaagttacc gtttt 45
<210> 169
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 169
agctcagagg aggaggatga agtttttctg agtcaaagca t 41
<210> 170
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 170
ctacgtgtta cagaattgaa gctccttttt gaagttaccg tttt 44
<210> 171
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 171
gtgttgcagg tgttcaagtg tagttttttc tgagtcaaag cat 43
<210> 172
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 172
cagatgttaa tgggcgaact gagctttttg aagttaccgt ttt 43
<210> 173
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 173
ctggtttgcc cgtgttgtgc tttttctgag tcaaagcat 39
<210> 174
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 174
acaactggca gtggaaagca gtg 23
<210> 175
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 175
gagacactct tcgcgttgta cag 23
<210> 176
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 176
ggtgcatgaa ataaggctgc agtgtttttc tcttggaaag aaagt 45
<210> 177
<211> 57
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 177
atttacgaat agtatataga gacaataatc catatgtttt tctcttggaa agaaagt 57
<210> 178
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 178
ggtaagaaaa ccattaagtg aaataactat tagtttttct cttggaaaga aagt 54
<210> 179
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 179
tgtgcagtgc aaaaaagagc tacaactttt tgaagttacc gtttt 45
<210> 180
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 180
gaagagaggt atacaagttt ctatttacag tttttctgag tcaaagcat 49
<210> 181
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 181
gcgtgtgtat tatgtgccta cgctttttga agttaccgtt tt 42
<210> 182
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 182
tttttatcta agataagtga atataggcat tatcaatttt ttctgagtca aagcat 56
<210> 183
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 183
gcgatttcat aatattatgg gtcgttggtt tttgaagtta ccgtttt 47
<210> 184
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 184
acagggcgct gttcagagtg tttttctgag tcaaagcat 39
<210> 185
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 185
cccaagtgta acgtcatgcg tgtttttgaa gttaccgttt t 41
<210> 186
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 186
gagacaaagc aactataaaa gattatatat tagatctttt tctgagtcaa agcat 55
<210> 187
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 187
tgcaacctga aacaactgac ctactttttg aagttaccgt ttt 43
<210> 188
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 188
actgctatga gcaattaggt gacagttttt ctgagtcaaa gcat 44
<210> 189
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 189
ctcagatgag gaggatacag atggtttttg aagttaccgt ttt 43
<210> 190
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 190
tgtggaccgg ccagatggac tttttctgag tcaaagcat 39
<210> 191
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 191
aagcagaaca agccacaagc aattactttt tgaagttacc gtttt 45
<210> 192
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 192
tacattgtga catattgtca cagttgtgtt tttctgagtc aaagcat 47
<210> 193
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 193
cactgcgacg gaccttcgta tttttgaagt taccgtttt 39
<210> 194
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 194
ctctacagca gatgctgttg ggtttttctg agtcaaagca t 41
<210> 195
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 195
atgtttgagg atccagcaac acga 24
<210> 196
<211> 16
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 196
ccccggaccc tgcacg 16
<210> 197
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 197
aattgtgtga ggtgctggaa gaatc 25
<210> 198
<211> 31
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 198
attcacttta tgggaaaaca ttagaagaga g 31
<210> 199
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 199
atgtataatt tgtcaaacgc cattatgtcc 30
<210> 200
<211> 33
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 200
tgaagaaaaa gaaagacatg ttaatgcaaa caa 33
<210> 201
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 201
ttggagaccc cgacctgtga 20
<210> 202
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 202
ctcagatgag gaggatacag atgg 24
<210> 203
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 203
tgtggaccgg ccagatggac 20
<210> 204
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 204
cacattacaa gttgtgtgcc ccg 23
<210> 205
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 205
aaaaaagaac taacacgtgc tgaggtattt tttctcttgg aaagaaagt 49
<210> 206
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 206
aacgctgcaa gaagttatat tagaactaac tttttctctt ggaaagaaag t 51
<210> 207
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 207
acctcaaaca gaaattgacc tacagtgttt ttctcttgga aagaaagt 48
<210> 208
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 208
agcaagctag acaagctaaa caacatactt tttctcttgg aaagaaagt 49
<210> 209
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 209
atggagccac aattcaacaa tccacttttt gaagttaccg tttt 44
<210> 210
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 210
aggaacgtcc acgaagcctg tttttctgag tcaaagcat 39
<210> 211
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 211
caccacttga gtgaggtatt agaaatactt tttgaagtta ccgtttt 47
<210> 212
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 212
ctttaattga tcttagatta tcatgtgtat attgcttttt ctgagtcaaa gcat 54
<210> 213
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 213
ataattttgc atgcactgaa ttaaaattag tgtatagttt ttgaagttac cgtttt 56
<210> 214
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 214
ggataatttt ccttatgcag tgtgcagttt ttctgagtca aagcat 46
<210> 215
<211> 59
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 215
agtatgttta ttgttttata gtaaagttag aaaatatagg tttttgaagt taccgtttt 59
<210> 216
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 216
tattatgact attcagtgta tggagctact ttttctgagt caaagcat 48
<210> 217
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 217
tgcattgtga cagaaaaaga cgatttcatt tttgaagtta ccgtttt 47
<210> 218
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 218
gtcatgtttg gggtgctgga gtttttctga gtcaaagcat 40
<210> 219
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 219
acaaacatct agagaaccta gagaatcttt tttgaagtta ccgtttt 47
<210> 220
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 220
acagtataat catgcatggt aaagtacctt tttctgagtc aaagcat 47
<210> 221
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 221
ggatgaggat gaggatgaag tagatttttg aagttaccgt ttt 43
<210> 222
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 222
ccatttgcag gagcggccac tttttctgag tcaaagcat 39
<210> 223
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 223
gtgttaccta atacacgtac cttgttgttt ttgaagttac cgtttt 46
<210> 224
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 224
tcagtgtaag tttgtggtgc agttgttttt ctgagtcaaa gcat 44
<210> 225
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 225
gacattcaga gtaccaaaga ggactttttg aagttaccgt ttt 43
<210> 226
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 226
ctgcgtgttg tacaacagct gctttttctg agtcaaagca t 41
<210> 227
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 227
ttatgggtgc gttaacagta acgtgttttt gaagttaccg tttt 44
<210> 228
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 228
cccactctgc gcatcaagta actttttctg agtcaaagca t 41
<210> 229
<211> 37
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 229
actagaaagt ataactaaaa aacagttatg tgattta 37
<210> 230
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 230
ttaataaggt gctacagatg tcaaagtc 28
<210> 231
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 231
cgttaactcc ggaggaaaag caat 24
<210> 232
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 232
tgcattgtga cagaaaaaga cgatttca 28
<210> 233
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 233
tctaatagca catggttgga ccgg 24
<210> 234
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 234
caatgagcaa ttggacagct caga 24
<210> 235
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 235
gtatatgact ttacatttgc agatttaaga atagtttttc tcttggaaag aaagt 55
<210> 236
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 236
gagacacatt agaacaaaca ctaaaaaagc tttttctctt ggaaagaaag t 51
<210> 237
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 237
aagaccattg tgtccacaag aaaaaaaaag tttttctctt ggaaagaaag t 51
<210> 238
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 238
agcacaaccg gccacagcta tttttctctt ggaaagaaag t 41
<210> 239
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 239
atgttccagg acgcagagga gtttttgaag ttaccgtttt 40
<210> 240
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 240
aaaccacgga cattgcatga tttgtgtttt tctgagtcaa agcat 45
<210> 241
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 241
catgaaatcg aattgaaatg cgttgaatgt ttttgaagtt accgtttt 48
<210> 242
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 242
caaaaagact ttgcagcgat ctgagttttt ctgagtcaaa gcat 44
<210> 243
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 243
atgtaaagtg tgtttacgat tgctatctaa aattttttga agttaccgtt tt 52
<210> 244
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 244
aagtgagtat agacattata attattcgct atatgttttt ctgagtcaaa gcat 54
<210> 245
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 245
cccgacgtag acaaacacaa gtgtttttga agttaccgtt tt 42
<210> 246
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 246
taacctgtaa caacgccatg agagtttttc tgagtcaaag cat 43
<210> 247
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 247
gaaacaaccc aacgctaaga gaatatattt tttgaagtta ccgtttt 47
<210> 248
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 248
tttagattta catcctgaac caactgactt tttctgagtc aaagcat 47
<210> 249
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 249
ctattctgct atgagcaatt atgtgacatt tttgaagtta ccgtttt 47
<210> 250
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 250
gctcagacga ggatgaaata ggctttttct gagtcaaagc at 42
<210> 251
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 251
attactacat tgtaacgtgt tgttacactt gtttttgaag ttaccgtttt 50
<210> 252
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 252
tgacgccacg gttcgtttgt gtttttctga gtcaaagcat 40
<210> 253
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 253
tatcaacagt acagcaactg aagtacgttt ttgaagttac cgtttt 46
<210> 254
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 254
aaccctacag cagctgctta tggtttttct gagtcaaagc at 42
<210> 255
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 255
gcacatgtac tattgtgtgc cctatttttg aagttaccgt ttt 43
<210> 256
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 256
tcaggcgttg gagacatctg tg 22
<210> 257
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 257
tgtatagaga tggaaatcca tttgcagt 28
<210> 258
<211> 37
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 258
gtttagagga aatattaatt agatgtatta tttgtca 37
<210> 259
<211> 33
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 259
gcatgtggat ttaaacaaaa ggtttcataa tat 33
<210> 260
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 260
ttcgggtcgt tggacagggc 20
<210> 261
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 261
gctgtgcagt gtgttggaga c 21
<210> 262
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 262
ttggacgggc cagatggaca 20
<210> 263
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 263
caaaggggaa ctgcaagaaa gagatttttc tcttggaaag aaagt 45
<210> 264
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 264
taagacagca acgacaagcg cgtttttctc ttggaaagaa agt 43
<210> 265
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 265
gaagttgacc ttgtgtgcta cgagtttttc tcttggaaag aaagt 45
<210> 266
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 266
caattacctg actccgactc cgtttttctc ttggaaagaa agt 43
<210> 267
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 267
agctgaacca cagcgtcaca actttttctc ttggaaagaa agt 43
<210> 268
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 268
atggcacgct ttgaggatcc tactttttga agttaccgtt tt 42
<210> 269
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 269
acaacgacca tacaaactgc ctgatttttc tgagtcaaag cat 43
<210> 270
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 270
cttgagcaca acattgaata ttcctctgtt tttgaagtta ccgtttt 47
<210> 271
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 271
catgatattc gcatcaattg tgtgttttgt ttttctgagt caaagcat 48
<210> 272
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 272
ggtatttgaa tttgctttta atgacttatt tatagtgttt ttgaagttac cgtttt 56
<210> 273
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 273
tatagagact gtacaccgta tgcagttttt ctgagtcaaa gcat 44
<210> 274
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 274
cgtgtctgaa atgcatttca ttttatgctt tttgaagtta ccgtttt 47
<210> 275
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 275
aagagtaaga gaattaagat attatagaga ttctgttttt ctgagtcaaa gcat 54
<210> 276
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 276
tgtatggaga aacattagag gctgaaactt tttgaagtta ccgtttt 47
<210> 277
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 277
caagacaccg ttacatgagc tgctttttct gagtcaaagc at 42
<210> 278
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 278
tgatacgctg ttatagatgc ctaaaacctt tttgaagtta ccgtttt 47
<210> 279
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 279
tctatgtcca acagacaaat taaagcatat aactttttct gagtcaaagc at 52
<210> 280
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 280
atatacagga cagtgtcgtg ggtgtttttg aagttaccgt ttt 43
<210> 281
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 281
tcggacccga gcaagacacc tttttctgag tcaaagcat 39
<210> 282
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 282
tagtgaaaca ctggtgtaaa acaatgcatt tttgaagtta ccgtttt 47
<210> 283
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 283
tggaccaaaa gcaacacttt gtgacttttt ctgagtcaaa gcat 44
<210> 284
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 284
agaatgaaaa agatgaacca gatggagttt tttgaagtta ccgtttt 47
<210> 285
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 285
taatcatcct ttgctactag ctagacgttt ttctgagtca aagcat 46
<210> 286
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 286
attgtgtgtg tgtgttgtaa gtgtaataat ctttttgaag ttaccgtttt 50
<210> 287
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 287
aacttcagct agtagtagaa acctcgtttt tctgagtcaa agcat 45
<210> 288
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 288
caagacggat tgcgagcctt actttttgaa gttaccgttt t 41
<210> 289
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 289
agcagctgtt tatggacgca ctattttttc tgagtcaaag cat 43
<210> 290
<211> 33
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 290
tgaaaaaaga agattccata atatagctgg aat 33
<210> 291
<211> 33
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 291
attgttttag atttggaacc acacaatttt gag 33
<210> 292
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 292
cctttgtgtg tcctttgtgt gcag 24
<210> 293
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 293
catctgagcg aggtattaca aatacctttt tctcttggaa agaaagt 47
<210> 294
<211> 58
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 294
acattagaaa gtataactaa aaaacagtta tctgattttt ttctcttgga aagaaagt 58
<210> 295
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 295
aagtagacaa gctacagaat ctacagtatt tttctcttgg aaagaaagt 49
<210> 296
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 296
cgcaaacgga aattgaccta caatgttttt ctcttggaaa gaaagt 46
<210> 297
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 297
gcaagctaga caagctgaac aacatttttc tcttggaaag aaagt 45
<210> 298
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 298
tgcccactct gcgcatcatc tttttctctt ggaaagaaag t 41
<210> 299
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 299
atggattcca tattcagcaa tacacaggtt tttgaagtta ccgtttt 47
<210> 300
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 300
aacgtccacg aagcctgcac tttttctgag tcaaagcat 39
<210> 301
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 301
tttacttgat cttagattat catgtgtata ctgtttttga agttaccgtt tt 52
<210> 302
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 302
caaaaaggaa cttacaagtt tagagttata tagtttttct gagtcaaagc at 52
<210> 303
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 303
gtttgcatgt attgagttaa aactagtata tagtttttga agttaccgtt tt 52
<210> 304
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 304
aaacaattgg ccatatgcag tatgtaggtt tttctgagtc aaagcat 47
<210> 305
<211> 57
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 305
gtatgtttat tgttttatag taaggttaga aaatatagtt tttgaagtta ccgtttt 57
<210> 306
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 306
gtactataaa tattcagtgt atggggcatt tttctgagtc aaagcat 47
<210> 307
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 307
attgcactgt gaacataaaa gacgatttct ttttgaagtt accgtttt 48
<210> 308
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 308
attatatagc atatgcatgg accgggtttt tctgagtcaa agcat 45
<210> 309
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 309
taaccatgca tggtaaagta ccaacgtttt tgaagttacc gtttt 45
<210> 310
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 310
ttgcaagagg ttatattaga acttgcactt tttctgagtc aaagcat 47
<210> 311
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 311
ggatgaggat gaggatgaaa tagacttttt gaagttaccg tttt 44
<210> 312
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 312
catttgctgg agcggccaca tttttctgag tcaaagcat 39
<210> 313
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 313
taagtgttac ctaattcacg taccttgttt tttgaagtta ccgtttt 47
<210> 314
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 314
tgtaagtgtg agttggtggt gcagtttttc tgagtcaaag cat 43
<210> 315
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 315
agctacgtgt ggtacaacag ctgtttttga agttaccgtt tt 42
<210> 316
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 316
cttatgggtg cgttaacagt aacgtttttc tgagtcaaag cat 43
<210> 317
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 317
tatcaataag gtgctaccga tgtcaatg 28
<210> 318
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 318
tccgttaaca ccggaggaaa aaca 24
<210> 319
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 319
tcatgtttgc agtgttggag acatac 26
<210> 320
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 320
caatgagcaa ttggacagct caga 24
<210> 321
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 321
ttggacattc agagtaccaa agagg 25
<210> 322
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 322
ggacattgga caccacattg catgtttttc tcttggaaag aaagt 45
<210> 323
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 323
gaatcggtgt atgcaacaac attagaaatt tttctcttgg aaagaaagt 49
<210> 324
<211> 58
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 324
ccataactaa tacaaagtta tatgatttat caataagttt ttctcttgga aagaaagt 58
<210> 325
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 325
cctaaattca aaacgaagat ttcataaaat agctttttct cttggaaaga aagt 54
<210> 326
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 326
ggcaggaaac acaagtttaa ctaactattt tttctcttgg aaagaaagt 49
<210> 327
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 327
atcaactact agccagacgg gactttttct cttggaaaga aagt 44
<210> 328
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 328
gaacaacagc gtcacacaat tcagtttttc tcttggaaag aaagt 45
<210> 329
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 329
gggagaacct gcggaagcta tttttctctt ggaaagaaag t 41
<210> 330
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 330
tcacaaccct gaggaacggc tttttgaagt taccgtttt 39
<210> 331
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 331
catacaaatt gccagacctg tgcatttttc tgagtcaaag cat 43
<210> 332
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 332
acgttacaat agactgtgtc tattgcagtt tttgaagtta ccgtttt 47
<210> 333
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 333
aaggcaacta caacggacag aggtttttct gagtcaaagc at 42
<210> 334
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 334
tatatgaatt tgcctttggt gacttaaatg tagtttttga agttaccgtt tt 52
<210> 335
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 335
tatataggga cggggtacca ttagtttttc tgagtcaaag cat 43
<210> 336
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 336
ctgcatgcca atcatgtatt aaattttatg ctttttgaag ttaccgtttt 50
<210> 337
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 337
gaaaatacgg gaactacgat attactcatt tttctgagtc aaagcat 47
<210> 338
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 338
gtgcatgtgt tgcctgaaac catttttttg aagttaccgt ttt 43
<210> 339
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 339
gagtcctgct gaaaaactaa ggcatttttc tgagtcaaag cat 43
<210> 340
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 340
ccactgctgg accagtaaac gtttttgaag ttaccgtttt 40
<210> 341
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 341
agaggaccgc agacgcacac tttttctgag tcaaagcat 39
<210> 342
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 342
atgcaatgaa atagagccgg ttgacttttt gaagttaccg tttt 44
<210> 343
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 343
cttgtatgtc acgagcaatt aggagttttt ctgagtcaaa gcat 44
<210> 344
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 344
attcagacga tgaaatagat gaacccgttt ttgaagttac cgtttt 46
<210> 345
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 345
accatgcagt taatcaccac caactttttc tgagtcaaag cat 43
<210> 346
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 346
tgtacgtgtt gtaagtgtaa caacctactt tttgaagtta ccgtttt 47
<210> 347
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 347
tgcaactagt agtagaagcg tcgctttttc tgagtcaaag cat 43
<210> 348
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 348
gaactgctgt ttatggactc actaaatttt tttgaagtta ccgtttt 47
<210> 349
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 349
ttgtgtgtcc gtggtgtgca actttttctg agtcaaagca t 41
<210> 350
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 350
aggaaacttt acaggacagt gtcg 24
<210> 351
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 351
gcatggacca aagcccaccg 20
<210> 352
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 352
tgcaggaaat tgtgttagag ttatgtcc 28
<210> 353
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 353
cttacagagg tatttgaatt tgcatttaaa gattttttct cttggaaaga aagt 54
<210> 354
<211> 60
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 354
atttttattc tagaattaga gaattaagac attattcagt ttttctcttg gaaagaaagt 60
<210> 355
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 355
aaggtgcctg cggtgccagt ttttctcttg gaaagaaagt 40
<210> 356
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 356
caacatagct gggcactata gaggtttttc tcttggaaag aaagt 45
<210> 357
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 357
ctccaacgac gcagagaaac actttttctc ttggaaagaa agt 43
<210> 358
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 358
atggcgcgct ttgaggatcc tttttgaagt taccgtttt 39
<210> 359
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 359
aacacggcga ccctacaagc tttttctgag tcaaagcat 39
<210> 360
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 360
tacctgatct gtgcacggaa ctgtttttga agttaccgtt tt 42
<210> 361
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 361
aacacttcac tgcaagacat agaaataact ttttctgagt caaagcat 48
<210> 362
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 362
ttatttgtgg tgtatagaga cagtatacct ttttgaagtt accgtttt 48
<210> 363
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 363
gcatgctgca tgccataaat gtatagtttt tctgagtcaa agcat 45
<210> 364
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 364
actctgtgta tggagacaca ttggtttttg aagttaccgt ttt 43
<210> 365
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 365
aaaaactaac taacactggg ttatacaatt tattaatttt ttctgagtca aagcat 56
<210> 366
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 366
aaaccgttga atccagcaga aaaacttatt tttgaagtta ccgtttt 47
<210> 367
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 367
gacaccttaa tgaaaaacga cgatttcatt tttctgagtc aaagcat 47
<210> 368
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 368
ccagtgccat tcgtgctgca tttttgaagt taccgtttt 39
<210> 369
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 369
accgagcacg acaggaacga tttttctgag tcaaagcat 39
<210> 370
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 370
aagtataata ttaagtatgc atggacctaa ggtttttgaa gttaccgttt t 51
<210> 371
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 371
caacattgca agacattgta ttgcatttag tttttctgag tcaaagcat 49
<210> 372
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 372
agccccaaaa tgaaattccg gttgtttttg aagttaccgt ttt 43
<210> 373
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 373
accttctatg tcacgagcaa ttaagctttt tctgagtcaa agcat 45
<210> 374
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 374
atggagttaa tcatcaacat ttaccagctt tttgaagtta ccgtttt 47
<210> 375
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 375
ccgacgagcc gaaccacaac tttttctgag tcaaagcat 39
<210> 376
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 376
gtcacacaat gttgtgtatg tgttgtaatt tttgaagtta ccgtttt 47
<210> 377
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 377
gtgtgaagcc agaattgagc tagttttttc tgagtcaaag cat 43
<210> 378
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 378
ttcgagcatt ccagcagctg tttctttttg aagttaccgt ttt 43
<210> 379
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 379
tgaacaccct gtcctttgtg tgtctttttc tgagtcaaag cat 43
<210> 380
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 380
ctgtgtatat tgcaagacag tattggaa 28
<210> 381
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 381
gactcagagg aagaaaacga tgaaatag 28
<210> 382
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 382
agtagaaagc tcagcagacg acc 23
<210> 383
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 383
cgtggtgtgc atcccagcag 20
<210> 384
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 384
ggagcgaccc agaaagttac ctttttctct tggaaagaaa gt 42
<210> 385
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 385
acagttatgc acagagctgc aaactttttc tcttggaaag aaagt 45
<210> 386
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 386
tggaacaaca ttagaacagc aatacaactt tttctcttgg aaagaaagt 49
<210> 387
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 387
tgaagaaaag caaagacatc tggacaaatt tttctcttgg aaagaaagt 49
<210> 388
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 388
tcttgttgca gatcatcaag aacacgtttt tctcttggaa agaaagt 47
<210> 389
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 389
tagagaaacc cagctgtaat catgcttttt ctcttggaaa gaaagt 46
<210> 390
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 390
aatattgtaa ccttttgttg caagtgtgac tttttctctt ggaaagaaag t 51
<210> 391
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 391
atgcaccaaa agatgcacca aaagagtttt tgaagttacc gtttt 45
<210> 392
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 392
aactgcaatg tttcaggacc cacatttttc tgagtcaaag cat 43
<210> 393
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 393
aactatacat gatataatat tagaatgtgt gtactgtttt tgaagttacc gtttt 55
<210> 394
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 394
caagcaacag ttactgcgac gtgtttttct gagtcaaagc at 42
<210> 395
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 395
aggtatatga ctttgctttt cgggattttt tttgaagtta ccgtttt 47
<210> 396
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 396
atgcatagta tatagagatg ggaatccatt tttctgagtc aaagcat 47
<210> 397
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 397
tatgctgtat gtgataaatg tttaaagttt tattctattt ttgaagttac cgtttt 56
<210> 398
<211> 56
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 398
aaattagtga gtatagacat tattgttata gtttgtattt ttctgagtca aagcat 56
<210> 399
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 399
aaaccgttgt gtgatttgtt aattaggtgt ttttgaagtt accgtttt 48
<210> 400
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 400
tattaactgt caaaagccac tgtgtccttt ttctgagtca aagcat 46
<210> 401
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 401
aagcaaagat tccataatat aaggggtctt tttgaagtta ccgtttt 47
<210> 402
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 402
ggtggaccgg tcgatgtatg tttttctgag tcaaagcat 39
<210> 403
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 403
atggagatac acctacattg catgaatatt tttgaagtta ccgtttt 47
<210> 404
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 404
tatgttagat ttgcaaccag agacaacttt tttctgagtc aaagcat 47
<210> 405
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 405
gatctctact gttatgagca attaaatgac tttttgaagt taccgtttt 49
<210> 406
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 406
agctcagagg aggaggatga aatatttttc tgagtcaaag cat 43
<210> 407
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 407
gatggtccag ctggacaagc tttttgaagt taccgtttt 39
<210> 408
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 408
agaaccggac agagcccatt actttttctg agtcaaagca t 41
<210> 409
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 409
tctacgcttc ggttgtgcgt actttttgaa gttaccgttt t 41
<210> 410
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 410
aaagcacaca cgtagacatt cgtacttttt ctgagtcaaa gcat 44
<210> 411
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 411
tttggaagac ctgttaatgg gcac 24
<210> 412
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 412
actaggaatt gtgtgcccca tctg 24
<210> 413
<211> 16
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 413
actttctttc caagag 16
<210> 414
<211> 534
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 414
atgctttgac tcagaggatc gtaagtaact aaggactacc aggatcgtaa gtaactaagg 60
actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa ggactaccag 120
gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc aggatcgtaa 180
gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa 240
ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc 300
aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt 360
aagtaactaa ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact 420
aaggactacc aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta 480
ccaggatcgt aagtaactaa ggactaccag gatcgtaagt aactaaggac tacc 534
<210> 415
<211> 534
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 415
aaaacggtaa cttcaggatc gtaagtaact aaggactacc aggatcgtaa gtaactaagg 60
actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa ggactaccag 120
gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc aggatcgtaa 180
gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa 240
ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc 300
aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt 360
aagtaactaa ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact 420
aaggactacc aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta 480
ccaggatcgt aagtaactaa ggactaccag gatcgtaagt aactaaggac tacc 534
<210> 416
<211> 466
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 416
ggtagtcctt agttacttac gatcctgaat ccattgaatc ctgtgattga atccattgaa 60
tcctgtgatt gaatccattg aatcctgtga ttgaatccat tgaatcctgt gattgaatcc 120
attgaatcct gtgattgaat ccattgaatc ctgtgattga atccattgaa tcctgtgatt 180
gaatccattg aatcctgtga ttgaatccat tgaatcctgt gattgaatcc attgaatcct 240
gtgattgaat ccattgaatc ctgtgattga atccattgaa tcctgtgatt gaatccattg 300
aatcctgtga ttgaatccat tgaatcctgt gattgaatcc attgaatcct gtgattgaat 360
ccattgaatc ctgtgattga atccattgaa tcctgtgatt gaatccattg aatcctgtga 420
ttgaatccat tgaatcctgt gattgaatcc attgaatcct gtgatt 466
<210> 417
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 417
aatcacagga ttcaatggat tc 22
Claims (10)
1. A cervical cancer detection probe, which is characterized by comprising one or more probes of high-risk HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68; each high-risk HPV probe consists of a capture extension probe, a K-type label extension probe and a closed probe;
wherein the sequence of the high-risk HPV31 type capture extension probe is shown as SEQ ID No.1-6, the sequence of the high-risk HPV31 type K type marker extension probe is shown as SEQ ID No.7-20, and the sequence of the high-risk HPV31 type blocking probe is shown as SEQ ID No. 21-27;
the sequence of the high-risk HPV33 type capture extension probe is shown as SEQ ID No.28-33, the sequence of the high-risk HPV33 type K type marker extension probe is shown as SEQ ID No.34-49, and the sequence of the high-risk HPV33 type blocking probe is shown as SEQ ID No. 50-55;
the sequence of the high-risk HPV35 type capture extension probe is shown as SEQ ID No.56-62, the sequence of the high-risk HPV35 type K type marker extension probe is shown as SEQ ID No.63-78, and the sequence of the high-risk HPV35 type blocking probe is shown as SEQ ID No. 79-82;
the sequence of the high-risk HPV39 type capture extension probe is shown as SEQ ID No.83-90, the sequence of the high-risk HPV39 type K type marker extension probe is shown as SEQ ID No.91-112, and the sequence of the high-risk HPV39 type blocking probe is shown as SEQ ID No. 113;
the sequence of the high-risk HPV45 type capture extension probe is shown as SEQ ID No. 114-139, the sequence of the high-risk HPV45 type K type marker extension probe is shown as SEQ ID No.122-139, and the sequence of the high-risk HPV45 type blocking probe is shown as SEQ ID No. 140-146;
the sequence of the high-risk HPV51 type capture extension probe is shown as SEQ ID No.147-153, the sequence of the high-risk HPV51 type K type marker extension probe is shown as SEQ ID No.154-173, and the sequence of the high-risk HPV51 type blocking probe is shown as SEQ ID No. 174-175;
the sequence of the high-risk HPV52 type capture extension probe is shown as SEQ ID No.176-178, the sequence of the high-risk HPV52 type K type marker extension probe is shown as SEQ ID No.179-194, and the sequence of the high-risk HPV52 type blocking probe is shown as SEQ ID No. 195-204;
the sequence of the high-risk HPV56 type capture extension probe is shown as SEQ ID No. 205-234, the sequence of the high-risk HPV56 type K type marker extension probe is shown as SEQ ID No.209-228, and the sequence of the high-risk HPV56 type blocking probe is shown as SEQ ID No. 229-234;
the sequence of the high-risk HPV58 type capture extension probe is shown as SEQ ID No.235-238, the sequence of the high-risk HPV58 type K-labeled extension probe is shown as SEQ ID No.239-255, and the sequence of the high-risk HPV58 type blocking probe is shown as SEQ ID No. 256-262;
the sequence of the high-risk HPV59 type capture extension probe is shown as SEQ ID No.263-267, the sequence of the high-risk HPV59 type K type marker extension probe is shown as SEQ ID No.268-289, and the sequence of the high-risk HPV59 type blocking probe is shown as SEQ ID No. 290-292;
the sequence of the high-risk HPV66 type capture extension probe is shown as SEQ ID No.293-298, the sequence of the high-risk HPV66 type K-type marker extension probe is shown as SEQ ID No.299-316, and the sequence of the high-risk HPV66 type blocking probe is shown as SEQ ID No. 317-321;
the sequence of the high-risk HPV68 type capture extension probe is shown as SEQ ID No. 322-349, the sequence of the high-risk HPV68 type K type marker extension probe is shown as SEQ ID No.330-349, and the sequence of the high-risk HPV68 type blocking probe is shown as SEQ ID No. 350-352;
the sequence of the high-risk HPV18 type capture extension probe is shown as SEQ ID No.353-357, the sequence of the high-risk HPV18 type K type marker extension probe is shown as SEQ ID No.358-379, and the sequence of the high-risk HPV18 type blocking probe is shown as SEQ ID No. 380-383;
the sequence of the high-risk HPV16 type capture extension probe is shown as SEQ ID No.384-390, the sequence of the high-risk HPV16 type K type marker extension probe is shown as SEQ ID No.391-410, and the sequence of the high-risk HPV16 type blocking probe is shown as SEQ ID No. 411-412.
2. Use of the probe of claim 1 in the preparation of a kit for detecting cervical cancer.
3. A kit for detecting cervical cancer, comprising the probe according to claim 1.
4. The kit of claim 3, further comprising one or more of a signal amplification precursor, a signal amplification entity, an Alkaline Phosphatase (AP) -labeled reporter probe, a chemiluminescent substrate, and a universal probe-coupled carrier;
wherein the universal probe is complementary paired to the partial sequence of the capture extension probe of claim 1;
the signal amplification precursor comprises an amplification precursor leader sequence and a multiply repeated amplicon leader complement sequence;
the signal amplifier comprises an amplifier preposition guide region sequence and a repeated reporting probe complementary sequence;
the pre-amplification leader sequence is complementary paired with the sequence of the K-type labelled extension probe moiety of claim 1;
the magnifying glass pre-guide region sequence is complementarily paired with the repeated magnifying glass pre-guide region complementary sequence;
and the alkaline phosphatase-labeled report probe is complementarily paired with the repeated report probe complementary sequence.
5. The kit of claim 4, wherein the carrier is a magnetic bead or a cell culture plate.
6. The kit according to claim 4, wherein the sequence of the universal probe is shown in SEQ ID No. 413.
7. The kit of claim 4, wherein the chemiluminescent substrate is an adamantane derivative.
8. The kit of claim 4, wherein the plurality of repeats is 20 repeats.
9. The kit of claim 4, wherein the universal probe is complementary paired with a partial sequence of the capture extension probe of claim 1, wherein the partial sequence is a 16bp sequence from the 3 'end to the 5' end of the capture extension probe of claim 1.
10. The kit of claim 4, wherein the pre-amplification leader sequence is complementary to a partial sequence of the K-type labeled extension probe of claim 1, wherein the partial sequence is a 14bp sequence from the 3 'end to the 5' end of the K-type labeled extension probe of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810763465.0A CN108796134B (en) | 2018-07-12 | 2018-07-12 | Cervical cancer detection probe sequence and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810763465.0A CN108796134B (en) | 2018-07-12 | 2018-07-12 | Cervical cancer detection probe sequence and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108796134A CN108796134A (en) | 2018-11-13 |
| CN108796134B true CN108796134B (en) | 2021-09-10 |
Family
ID=64076263
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810763465.0A Active CN108796134B (en) | 2018-07-12 | 2018-07-12 | Cervical cancer detection probe sequence and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108796134B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109456886A (en) * | 2018-12-12 | 2019-03-12 | 郑州科蒂亚生物技术有限公司 | A kind of full-automatic nucleic acid signal amplification detection automatic work station |
| CN109943665B (en) * | 2019-04-15 | 2023-05-16 | 郑州科蒂亚生物技术有限公司 | Probe sequence for detecting head and neck squamous carcinoma oncogene, kit and application thereof |
| CN110592279B (en) * | 2019-09-11 | 2023-04-07 | 圣湘生物科技股份有限公司 | Compositions, kits and methods for detecting HPV |
| CN110938712A (en) * | 2019-12-27 | 2020-03-31 | 苏州药明检测检验有限责任公司 | Primer, probe, kit and method for detecting human papilloma virus based on real-time fluorescent quantitative PCR technology |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010129941A1 (en) * | 2009-05-08 | 2010-11-11 | Becton, Dickinson And Company | Correlation of hpv e6 and e7 expression with progression of cervical disease |
| CN103114132A (en) * | 2012-12-20 | 2013-05-22 | 张鹭鹭 | Primer probe and kit for detecting oncogene of cervical cancer and detection method for non-detection disease purpose |
| CN105861669A (en) * | 2016-04-22 | 2016-08-17 | 科蒂亚(新乡)生物技术有限公司 | Amplificatory detection method for quickly capturing branched-chain DNA (Deoxyribonucleic Acid) signal of hybrid target substance |
| CN105886501A (en) * | 2016-04-26 | 2016-08-24 | 科蒂亚(新乡)生物技术有限公司 | Nucleic acid signal amplification sequence and method |
| US9512471B2 (en) * | 2010-06-30 | 2016-12-06 | Diacarta Inc | Methods and kits for detecting human papillomavirus |
| CN106701984A (en) * | 2017-02-07 | 2017-05-24 | 华南师范大学 | Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal |
-
2018
- 2018-07-12 CN CN201810763465.0A patent/CN108796134B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010129941A1 (en) * | 2009-05-08 | 2010-11-11 | Becton, Dickinson And Company | Correlation of hpv e6 and e7 expression with progression of cervical disease |
| US9512471B2 (en) * | 2010-06-30 | 2016-12-06 | Diacarta Inc | Methods and kits for detecting human papillomavirus |
| CN103114132A (en) * | 2012-12-20 | 2013-05-22 | 张鹭鹭 | Primer probe and kit for detecting oncogene of cervical cancer and detection method for non-detection disease purpose |
| CN105861669A (en) * | 2016-04-22 | 2016-08-17 | 科蒂亚(新乡)生物技术有限公司 | Amplificatory detection method for quickly capturing branched-chain DNA (Deoxyribonucleic Acid) signal of hybrid target substance |
| CN105886501A (en) * | 2016-04-26 | 2016-08-24 | 科蒂亚(新乡)生物技术有限公司 | Nucleic acid signal amplification sequence and method |
| CN106701984A (en) * | 2017-02-07 | 2017-05-24 | 华南师范大学 | Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal |
Non-Patent Citations (3)
| Title |
|---|
| "The HPV E6/E7 Oncogenes:Key Factors for Viral Carcinogenesis and Therapeutic Targets ";Karin Hoppe-Seyler et al.;《Trends in Microbiology》;20180228;第26卷(第2期);第158-168页 * |
| "人乳头状瘤病毒核酸检测试剂盒用于宫颈癌及癌前病变筛查的临床价值";尚乐乐等;《实用临床医药杂志》;20171231;第21卷(第19期);第99-102页 * |
| "人乳头瘤病毒E6/E7 mRNA bDNA检测在宫颈疾病筛查中的应用";王少蕾等;《医学理论与实践》;20140831;第27卷(第15期);第2058-2061页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108796134A (en) | 2018-11-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108796134B (en) | Cervical cancer detection probe sequence and application thereof | |
| US11624096B2 (en) | Detection of nucleic acids from multiple types of human papillomavirus | |
| Zambrano et al. | Detection of human polyomaviruses and papillomaviruses in prostatic tissue reveals the prostate as a habitat for multiple viral infections | |
| US9096910B2 (en) | Set of probes for the detection and typing of 46 human papillomavirus mucosal types | |
| ES2615728T3 (en) | Methods and compositions for purification and specific multiple nucleic acid sequence analysis | |
| US10988816B2 (en) | Compositions and methods for detecting human papillomavirus nucleic acid | |
| PT1463839E (en) | Method for detecting human papillomavirus mrna | |
| Jacquin et al. | Methylation of human papillomavirus type 16 CpG sites at E2-binding site 1 (E2BS1), E2BS2, and the Sp1-binding site in cervical cancer samples as determined by high-resolution melting analysis–PCR | |
| CN108546785B (en) | Method for detecting DNA of pathogenic microorganisms in genital tract | |
| Nunobiki et al. | MDM2 SNP 309 human papillomavirus infection in cervical carcinogenesis | |
| Marincevic-Zuniga et al. | Multiply-primed rolling circle amplification of human papillomavirus using sequence-specific primers | |
| Tekin et al. | Human papillomavirus associated with bladder carcinoma? Analysis by polymerase chain reaction | |
| US20060134615A1 (en) | Method for the simultaneous detection of HPV RNA and DNA in a sample | |
| CN112391495A (en) | High-risk human papilloma virus typing detection method and kit | |
| Lowe et al. | HPV genotype detection using hybrid capture sample preparation combined with whole genome amplification and multiplex detection with Luminex XMAP | |
| Yang et al. | Triple signal amplification strategy for the ultrasensitive electrochemical detection of human papillomavirus 16 E6/E7 mRNA | |
| EP1373575A2 (en) | Methods for detection of human papillomavirus mrna | |
| CN114164305A (en) | Primer and typing probe combination for detecting human papilloma virus and application thereof | |
| CN114196786A (en) | Poultry adenovirus type 4 and 8 dual fluorescent quantitative PCR rapid detection kit and method | |
| Chaiwongkot et al. | Detection of the human papillomavirus 58 physical state using the amplification of papillomavirus oncogene transcripts assay | |
| JP2006500064A (en) | Method for detecting and classifying cutaneous HPV and primers and probes used therefor | |
| CN117625844A (en) | Multiplex Q-PCR detection kit for HPV virus and preparation thereof | |
| NZ568290A (en) | Method of detecting pathogens and in particular human papilloma virus (HPV) | |
| AC | The role of p53 codon 72 and human papilloma virus status of cutaneous squamous cell carcinoma in the Swedish population | |
| CN117327734A (en) | Positive quality control product for genotyping detection of high-risk human papilloma virus, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Xiankun Inventor after: Li Xin Inventor after: Meng Ge Inventor after: He Li Inventor after: Guo Shuguang Inventor after: Su Qin Inventor before: Zhang Lulu Inventor before: Guo Shuguang Inventor before: Su Qin Inventor before: Li Xiankun Inventor before: Tian Xiaoqiang Inventor before: Xu Wenru Inventor before: Li Xin Inventor before: Li Xiaolei Inventor before: Meng Ge Inventor before: He Li Inventor before: Han Ran |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |