CN108796134A - A kind of cervical carcinoma detection probe sequence and its application - Google Patents

A kind of cervical carcinoma detection probe sequence and its application Download PDF

Info

Publication number
CN108796134A
CN108796134A CN201810763465.0A CN201810763465A CN108796134A CN 108796134 A CN108796134 A CN 108796134A CN 201810763465 A CN201810763465 A CN 201810763465A CN 108796134 A CN108796134 A CN 108796134A
Authority
CN
China
Prior art keywords
artificial sequence
type
dna
seq
risk hpv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810763465.0A
Other languages
Chinese (zh)
Other versions
CN108796134B (en
Inventor
张鹭鹭
李先坤
田小强
徐文茹
李鑫
李小磊
孟歌
何丽
韩燃
郭曙光
苏芹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhengzhou Ke Ke Biotechnology Co Ltd
Original Assignee
Zhengzhou Ke Ke Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhengzhou Ke Ke Biotechnology Co Ltd filed Critical Zhengzhou Ke Ke Biotechnology Co Ltd
Priority to CN201810763465.0A priority Critical patent/CN108796134B/en
Publication of CN108796134A publication Critical patent/CN108796134A/en
Application granted granted Critical
Publication of CN108796134B publication Critical patent/CN108796134B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/708—Specific hybridization probes for papilloma
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Abstract

The present invention relates to gene engineering technology field, a kind of cervical carcinoma detection probe sequence and its application are disclosed.Probe sequence of the present invention includes the probe sequence of one or more of high-risk HPV 16,18,31,33,35,39,45,51,52,56,58,59,66 and 68 types；Each high-risk HPV probe sequence is made of capture extension probes, K-type label extension probes and closing probe three classes probe sequence.The present invention carries out extension capture probe, K-type label probe for a variety of regions high-risk human mammilla papillomavirus type E6E7 and closes the design of probe and artificial optimization, further improve the specificity detected to cervical cancer cell based on similar bDNA and QuantiMAT technologies, preferable quantitative limit, detection limit and sensitivity are shown, and can be applied in the preparation of such kit.

Description

A kind of cervical carcinoma detection probe sequence and its application
Technical field
The present invention relates to gene engineering technology fields, and in particular to a kind of cervical carcinoma detection probe sequence and its application.
Background technology
Human papilloma virus (HPV) and Cervical Cancer are close, and cervical carcinoma is the second largest lethal carninomatosis of women, clinic card Cases of cervical cancer and high-risk HPV the virus infection of bright 95-99.7% is related.It is observed in Electronic Speculum from Laverty in 1977 There are human papilloma virus (HPV) particles and Zur Hausen to propose HPV viruse and cervical carcinoma in cervical carcinoma biopsy After associated hypothesis of falling ill, domestic and foreign scholars have carried out a large amount of research to this problem, finally in the IARC of nineteen ninety-five special topics The main reason for by HPV infection being cervical carcinoma in discussion, i.e. HPV infection are that the prerequisite of uterine neck carcinogenesis necessary causes item Part.
HPV can be divided into two kinds of high-risk-type and low risk, and long-term persistent infection high-risk-type can be carcinogenic, life threatening.Low danger Type HPV can lead to genitals condyloma acuminatum, influence quality of life.Meanwhile there is a certain proportion of low risk infection also with high-risk Type mixed infection.Therefore, it is extremely important to jeopardize low danger HPV viruse detection for clinical patients with condyloma acuminatum progress height.High-risk HPV is led The chance of carcinogenic disease is higher, and scientific research finds at least 20 kinds of high-risk HPVs and 95% early stage infiltration and invasive endometrial Neck cancer is related.HPV infection, especially high-risk HPV infect, and there is definite relation with cervical carcinoma.From in the recent period in Europe And the random HPV the selection results of crowd of other various regions confirm that HPV can have found in 99.8% cervical cancer patient.
E6/E7 is oncogene, encodes oncoprotein, in the process of cell transformation and maintenance transforming tissue malignant phenotype In play a crucial role.Evolution and HPV genome conformity to host cell base of the cervical lesions up to infiltrating carcinoma It is closely related because organizing, along with the loss of raq gene and the overexpression of subsequent E6/E7 oncogene.E6/E7 gene codes Carcinogenic protein is the important factor for leading to epithelium of cervix uteri canceration, both albumen and intracellular two kinds main cancer suppressor protein p53 and The combination and regulation and control of pRb can substantially change cell growth cycle and DNA is repaired, and the unstability of genome is thus caused to be The necessary condition of cell transformation and immortalization.
During low level pathological development is cancer, HPV genomes can be integrated.In integration process, E6/E7 bases Because persistently existing, L1 genes may be lost.But since L1 genes are relatively conservative, more suitable for using universal primer as the inspection of target spot It surveys, due to being limited to existing technology platform, almost all of HPV detections product is detection target spot with L1.It is advanced in uterine neck In other lesion, since the integration of genome can make L1 genes have the possibility of loss, making detection target spot with L1 genes can be right HPV has the possibility of missing inspection.On the contrary, if detecting shot design in E6/E7 genes, no matter whether HPV genomes are integrated, all It can detect the patient of the HPV positives.
Existing patent CN105861669A discloses a kind of inspection of fast Acquisition hybridizing targets object branched chain DNA signals amplification Survey method (QuantiMAT technologies), sensitivity are superior to bDNA technologies with time-consuming.It is high-risk that detection is provided in embodiment The correlation test in 16 regions type E6E7 of type human papilloma virus (HPV), but QuantiMAT probe sequences are different for high-risk The specificity of type HPV has influence the most direct, is visited according to the QuantiMAT that ProbeDesigner V1.0 tool designs go out Needle sequence does not ensure that have higher specificity when detecting high-risk HPV, causes quantitative limit (LOQ), detection limit (LOD) and sensitivity is affected.
Invention content
In view of this, the purpose of the present invention is to provide a kind of cervical carcinoma detection probe sequence and its applications so that described Probe sequence can detect high-risk HPV 16 18 31 33 35 39 45 51 52 56 58 59 66 68 types, and have compared with High specificity can be applied in cervical carcinoma detection related application.
For achieving the above object, the present invention provides the following technical solutions：
A kind of cervical carcinoma detection probe sequence, including high-risk HPV 16,18,31,33,35,39,45,51,52,56,58, 59, the probe sequence of one or more of 66 and 68 types；Each high-risk HPV probe sequence is extended by capture to be visited Needle, K-type label extension probes and closing probe three classes probe sequence composition；
Wherein, 31 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.1-6, the high-risk-type HPV31 type K-types mark extension probes as shown in SEQ ID No.7-20, and 31 type of the high-risk HPV closes probe such as SEQ ID Shown in No.21-27；
33 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.28-33, the high-risk-type HPV33 type K-types mark extension probes as shown in SEQ ID No.34-49, and 33 type of the high-risk HPV closes probe such as SEQ ID Shown in No.50-55；
35 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.56-62, the high-risk-type HPV35 type K-types mark extension probes as shown in SEQ ID No.63-78, and 35 type of the high-risk HPV closes probe such as SEQ ID Shown in No.79-82；
39 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.83-90, the high-risk-type HPV39 type K-types mark extension probes as shown in SEQ ID No.91-112, and 39 type of the high-risk HPV closes probe such as SEQ Shown in ID No.113；
45 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.114-121, the high-risk-type HPV45 type K-types mark extension probes as shown in SEQ ID No.122-139, and 45 type of the high-risk HPV closes probe such as SEQ Shown in ID No.140-146；
51 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.147-153, the high-risk-type HPV51 type K-types mark extension probes as shown in SEQ ID No.154-173, and 51 type of the high-risk HPV closes probe such as SEQ Shown in ID No.174-175；
52 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.176-178, the high-risk-type HPV52 type K-types mark extension probes as shown in SEQ ID No.179-194, and 52 type of the high-risk HPV closes probe such as SEQ Shown in ID No.195-204；
56 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.205-208, the high-risk-type HPV56 type K-types mark extension probes as shown in SEQ ID No.209-228, and 56 type of the high-risk HPV closes probe such as SEQ Shown in ID No.229-234；
58 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.235-238, the high-risk-type HPV58 type K-types mark extension probes as shown in SEQ ID No.239-255, and 58 type of the high-risk HPV closes probe such as SEQ Shown in ID No.256-262；
59 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.263-267, the high-risk-type HPV59 type K-types mark extension probes as shown in SEQ ID No.268-289, and 59 type of the high-risk HPV closes probe such as SEQ Shown in ID No.290-292；
66 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.293-298, the high-risk-type HPV66 type K-types mark extension probes as shown in SEQ ID No.299-316, and 66 type of the high-risk HPV closes probe such as SEQ Shown in ID No.317-321；
68 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.322-329, the high-risk-type HPV68 type K-types mark extension probes as shown in SEQ ID No.330-349, and 68 type of the high-risk HPV closes probe such as SEQ Shown in ID No.350-352；
18 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.353-357, the high-risk-type HPV18 type K-types mark extension probes as shown in SEQ ID No.358-379, and 18 type of the high-risk HPV closes probe such as SEQ Shown in ID No.380-383；
16 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.384-390, the high-risk-type HPV16 type K-types mark extension probes as shown in SEQ ID No.391-410, and 16 type of the high-risk HPV closes probe such as SEQ Shown in ID No.411-412.
For similar to unrelated probe in bDNA and QuantiMAT technologies, when detecting cervical carcinoma, specificity bad is asked Topic, the high specific probe that the present invention provides one group after artificially optimizing can be in quantitative limit (LOQ), detection limit (LOD) And have more excellent effect in terms of sensitivity, while it is also more excellent to detect the linear relationship between signal and positive cell.By This, the present invention provides the probe sequences to prepare the application in detecting cervical carcinoma kit.Wherein, affiliated cervical carcinoma includes High-risk HPV 16 18 31 33 35 39 45 51 52 56 58 59 66 it is one or more in 68 types.
According to above application, the present invention provides a kind of kits of detection cervical carcinoma, including probe sequence of the present invention Row.
More specifically, the kit further includes signal amplification precursor, signal amplification body, alkaline phosphatase (AP) label Reporter probe, chemiluminescent substrate and coupling have one or more of carrier of general probe；
Wherein, the general probe and the partial sequence complementarity of capture extension probes of the present invention match；
The signal amplification precursor includes the amplification preposition guiding region sequence of precursor and the preposition guiding of repeated amplification body Area's complementary series；
The signal, which is put, generallys include the amplification preposition guiding region sequence of body and repeated reporter probe complementary series；
The preposition guiding region sequence of amplification precursor is matched with K-type of the present invention label extension probes partial sequence complementarity It is right；
The preposition guiding region sequence of amplification body and the repeated preposition boot section complementary series of amplification body are complementary Pairing；
The reporter probe of the alkali phosphatase enzyme mark and the repeated reporter probe duplicate block complementary series are mutual It recruits pair.
The various carrier formats being commonly used according to this field, carrier of the present invention are preferably magnetic bead or cell culture Plate, general probe can by some modification, such as it is amido modified both can be mutually coupled with the group of magnetic bead surfaces, can also pass through packet It is coated on tissue culture plate by liquid.
In the specific embodiment of the invention, the present invention provides a kind of specific general probe, sequence such as SEQ ID Shown in No.413.
In the selection of luminous substrate, the present invention selects adamantane derivative as the luminous substrate of AP reporter probes, uses It is detected in chemiluminescent analyzer.
Signal of the present invention, which amplifies the reporter probe that precursor, signal amplification body, alkaline phosphatase (AP) mark, to be corresponded to In primary signal amplifier chain, secondary signal amplifier chain disclosed in referenced patent CN105861669A and the reporter probe of AP couplings Description or specific sequence design.
Preferably, of the present invention be repeated several times is 20 repetitions.
Preferably, the general probe and the partial sequence complementarity of capture extension probes of the present invention match, wherein The partial sequence is the 16bp sequences in 3 ' end to 5 ' directions of capture extension probes of the present invention；It is embodied in the present invention In mode, all end 16bp sequences be CTCTTGGAAAGAAAGT probe belong to capture extension probes, can and SEQ General probe complementary pairing shown in ID No.413 combines.
Preferably, the preposition guiding region sequence of amplification precursor marks extension probes partial order with K-type of the present invention Row complementary pairing marks the 3 ' of extension probes to hold to the 14bp sequences in 5 ' directions wherein the partial sequence is K-type of the present invention Row；In the specific embodiment of the invention, all end 14bp sequences are ctgagtcaaagcat's or gaagttaccgtttt Probe belongs to K-type label extension probes, can be combined with the preposition guiding region sequence complementary pairing of the amplification precursor, thus The preposition guiding region sequence of amplification precursor can also be designed.
Pass through ProbeDesigner V1.0 tools (http://www.probedesigner.cn/) design a trocar To high-risk HPV 16 18 31 33 35 39 45 51 52 56 58 59 66 68 types QuantiMAT probe sequence conducts Control, to ensure comparability, all end 16bp sequences are that the probe of CTCTTGGAAAGAAAGT belongs in control probe Extension probes (CE) are captured, all end 14bp sequences are that the probe of ctgagtcaaagcat or gaagttaccgtttt belongs to K-type marks extension probes (LE), remaining is closing probe (BL), specific as follows：
HPV31 types：
NKV31001-CE：GTCTTTCTGCAGGATTTTTGAACTTTTTCTCTTGGAAAGAAAGT；NKV31002-CE： GCTTAGTTCATGCAATTTCCGAGTTTTTCTCTTGGAAAGAAAGT；NKV31003-CE： CCTCTGTTTCTGTTAACTGACCTTTGTTTTTCTCTTGGAAAGAAAGT；NKV31004-CE： ATCTAAATTCACTTACTTTTGAATAAAATTTTTTCTCTTGGAAAGAAAGT；NKV31005-CE： CATATACCTTTGTTTGTCAATTTTTCTTTTTTCTCTTGGAAAGAAAGT；NKV31006-CE： ACGCATGTTTACACTTGGGTTTTTTTTCTCTTGGAAAGAAAGT；NKV31007-CE： TCTGAGCTGTCGGGTAATTGCTTTTTCTCTTGGAAAGAAAGT；NKV31008-LE： GTAGGGTATTTCCAATGCCGATTTTTGAAGTTACCGTTTT；NKV31009-LE： CAGTAGACACAATTCAATCTTAGTTCATCTTTTTCTGAGTCAAAGCAT；NKV31010-LE： GTGGTGTGTCGTCCCTATATACTATTTTTTTGAAGTTACCGTTTT；NKV31011-LE： CTTAAACATTTTGTACACACTCCGTTTTTTCTGAGTCAAAGCAT；NKV31012-LE： ACACGTTATACACCTAATTAACAAATCATTTTTGAAGTTACCGTTTT；NKV31013-LE： TCTTCTGGACACAACGGTCTTTGTTTTTCTGAGTCAAAGCAT；NKV31014-LE： TCTTTTTATCCAAATGTCTTTGTTTTTTTTTGAAGTTACCGTTTT；NKV31015-LE： TTCCTCCTATGTTGTGGAATCGTTTTTTTCTGAGTCAAAGCAT；NKV31016-LE： CTTGCAACGTAGGTGTTTCTCCTTTTTGAAGTTACCGTTTT；NKV31017-LE： CTCAGGTTGCAAATCTAACACATAGTTTTTTCTGAGTCAAAGCAT；NKV31018-LE： GGACTGTCTATGACATCCTCCTCATTTTTGAAGTTACCGTTTT；NKV31019-LE： CCGGTTCTGCTTGTCCAGCTTTTTTCTGAGTCAAAGCAT；NKV31020-BL： GTTAAATCTGTAAATGCAAAATCTAATA；NKV31021-BL：AATGTTGTTCCATACACACTATATCTATACC； NKV31022-BL：CTATGCAACGTCCTGTCCACC；NKV31023-BL：CAGTACGAGGTCTTCTCCAACATG； NKV31024-BL：TCATAACAGTGGAGGTCAGTTGC；
HPV39 types：
NKV39001-CE：TACCTCGGTTTGCTGTAGTGGTTTTTCTCTTGGAAAGAAAGT；NKV39002-CE： GGTTCCCCGTCCCTATATACTATTTTTCTCTTGGAAAGAAAGT；NKV39003-CE： TTTATGAAATCTTCGTTTGCTATTTTTTTTCTCTTGGAAAGAAAGT；NKV39004-CE： GGTCCACGCATATCTGATGTTATATTTTTCTCTTGGAAAGAAAGT；NKV39005-CE： TTTCCTGCAAGGTGGGCTTTTTTTTCTCTTGGAAAGAAAGT；NKV39006-CE： CCGTGAGGCTTCTACTACCAGCTTTTTTCTCTTGGAAAGAAAGT；NKV39007-CE： ACAAATCCTAGTGAGTCCATAAACAGTTTTTCTCTTGGAAAGAAAGT；NKV39008-LE： CATGATTGGCATGCAGCTAGTTTTTTGAAGTTACCGTTTT；NKV39009-LE： CCCGTATTTTAGCATAAAATTTTATATTTTTCTGAGTCAAAGCAT；NKV39010-LE： CCGAGTCCGAGTAATATCGTAGCTTTTTTGAAGTTACCGTTTT；NKV39011-LE： TTAGTTATATTTTCTAATGTAGTTGCATACATTTTTCTGAGTCAAAGCAT；NKV39012-LE： CACAGCGGTTTCAGACAACACATTTTTGAAGTTACCGTTTT；NKV39013-LE： AGGTGTCTTAATTTTTCTGCTGGATTTTTCTGAGTCAAAGCAT；NKV39014-LE： TTCATTGTAAGGACATAAATCTAATACAATTTTTGAAGTTACCGTTTT；NKV39015-LE： CATACAAGGTCAACCGGCTGTATTTTTTCTGAGTCAAAGCAT；NKV39016-LE： GTCGGGTTCATCTATTTCATCCTTTTTTGAAGTTACCGTTTT；NKV39017-LE： TTGATGTTGGTGATTAACTGCATGTTTTTCTGAGTCAAAGCAT；NKV39018-LE： GGTTCATCCCGTCTGGCTAGTAGTTTTTGAAGTTACCGTTTT；NKV39019-LE： GAACACTGTATTGTGTGACGCTGTTTTTTCTGAGTCAAAGCAT；NKV39020-BL： CATATAAATCACTAAATGCAAATTCATA；NKV39021-BL：TGCACCTTATTAATAAATTATATAACTTTGTA； NKV39022-BL：ACTGTCCTGTATAGCTTCCTGCTAT；NKV39023-BL：TGGTCCAGCACCGTCGAC； NKV39024-BL：TGCGGTCCTCCCGTTTTG；NKV39025-BL：CTTGGGTTTCTCTTCGTGTTAGTC；NKV39026- BL：CTGACTCTCCTAATTGCTCGTGA；NKV39027-BL：GCAGTGTGTTGTTACACTTACAACAC；NKV39028- BL：CTGCTGTAGTTGTCGCAGAGTATC；
HPV33 types：
NKV333-BL：CAGATCGTTGCAAAGGTTTTTT；NKV338-BL： ATTTCCATATACAGAATAATTATAATGTCTAT；NKV339-BL：AAGGTTTTTTAACTGTTTGTTCTAATGT； NKV3310-BL：GACATATAATACACCTAATTAATATTTCATTTA；NKV3314-BL：CAGCGCCCTGCCCAAC； NKV3320-BL：CTCATAGCAGTATAGGTCAGTTGGTT；NKV3321-BL：CCTCATCTGAGCTGTCACTTAATTG； NKV3327-BL：TTGCTGTATGGTTCGTAGGTCAC；NKV334-CE： CTGCAAATGCAAAATCATATACCTTTTTTCTCTTGGAAAGAAAGT；NKV337-CE： ATTCACTAATTTTAGATAAGAACCGCTTTTTCTCTTGGAAAGAAAGT；NKV3313-CE： GACCCGAAATATTATGAAATCGTTTTTTTCTCTTGGAAAGAAAGT；NKV3315-CE： ACCTCCAACACGCCGCATTTTTCTCTTGGAAAGAAAGT；NKV3322-CE： GCCGGTCCAAGCCTTCATTTTTTCTCTTGGAAAGAAAGT；NKV3328-CE： CAATATTCACTGTGCCCATAAGTAGTTTTTCTCTTGGAAAGAAAGT；NKV331-LE： TGTTGTGTATAGTTGTCTCCAATGCTTTTTTGAAGTTACCGTTTT；NKV332-LE： GCATTCCACGCACTGTAGTTCAATTTTTCTGAGTCAAAGCAT；NKV335-LE： ATTTCCCTCTCTATATACAACTGTTAAATTTTTTGAAGTTACCGTTTT；NKV336-LE： AAACACAGTTTACATATTCCAAATGGTTTTTCTGAGTCAAAGCAT；NKV3311-LE： TTTCTTGAGGACACAAAGGTCTTTTTTTTGAAGTTACCGTTTT；NKV3312-LE： TGTTTAAATCCACATGTCGTTTTTTTTTTCTGAGTCAAAGCAT；NKV3316-LE： GTGCAGTTTCTCTACGTCGGGTTTTTGAAGTTACCGTTTT；NKV3317-LE： ATGGCGTTTTTACACGTCACATTTTTCTGAGTCAAAGCAT；NKV3318-LE： AACGTTGGCTTGTGTCCTCTCTTTTTGAAGTTACCGTTTT；NKV3319-LE： CAGGATATAAATCTAAAACATATTCCTTTTTTTTCTGAGTCAAAGCAT；NKV3323-LE： GCTGGTTGTGCTTGTCCATCTGTTTTTGAAGTTACCGTTTT；NKV3324-LE： CAGGTTACAATGTAGTAATCAGCTGTGTTTTTCTGAGTCAAAGCAT；NKV3325-LE： AACTGTGGTGTTACAAGTGTGACAATTTTTGAAGTTACCGTTTT；NKV3326-LE： TTGCTGTACTGTTGACACATAAACGTTTTTCTGAGTCAAAGCAT；
HPV35 types：
NKV356-BL：TCTATATACTATACACAAATCATAGCATGC；NKV358-BL： GAATAAAATTTTAAACATTTCATGCA；NKV359-BL：ACTATATCTATACCATCTATATTCACTTATTTTT； NKV3513-BL：TTGCTTTTCAACTGGACACAGC；NKV3514-BL：GAATCGTTTTTTTTCTTCTAAATGTCT； NKV3516-BL：AACAGGACATACACCGACCTGTC；NKV3517-BL：GGTTTCTCTACGTGTTGGTTTCC； NKV3518-BL：TTCTCCATGCATGATTACACCTC；NKV3526-BL：CAGACGTAGTGTCGCCTCACAT；NKV3527- BL：TGTCAATGTGTGTGCTCTGTACACA；NKV353-CE： CAAACAAATTTCATGGATGCTTTCTTTTTCTCTTGGAAAGAAAGT；NKV357-CE： TACTCCATATGGCTGGCCTTCTTTTTCTCTTGGAAAGAAAGT；NKV3510-CE： TGTTTTTCTAACGTTTCTCCATACACTTTTTCTCTTGGAAAGAAAGT；NKV3515-CE： CACCGTCCACCGATGTTATGTTTTTCTCTTGGAAAGAAAGT；NKV3523-CE： TCCAGCTGGACCGTCAATAGTATTTTTTCTCTTGGAAAGAAAGT；NKV3528-CE： CCATTAATAAATCTTCCAATTTACGTATTTTTCTCTTGGAAAGAAAGT；NKV351-LE： GCAGTTTGTAAGGTCGTTCAGCTTTTTTGAAGTTACCGTTTT；NKV352-LE： TTCTACCTCGTTGCACAAATCATTTTTTCTGAGTCAAAGCAT；NKV354-LE： TAATTCTTGTTTGCAGTATACACAATTTTTTTGAAGTTACCGTTTT；NKV355-LE： AAAGTCATATACCTCACTCCGCTGTTTTTCTGAGTCAAAGCAT；NKV3511-LE： AATAAATGACATAACTGTTTGTTGCATTTTTTGAAGTTACCGTTTT；NKV3512-LE： GGTTTTTGACATGTAATACACCTAATTTTTTTCTGAGTCAAAGCAT；NKV3519-LE： TCTAAAACATAGTCTTGCAATGTAGTTATTTTTTGAAGTTACCGTTTT；NKV3520-LE： AGTTGCCTCGGGTTCCAAATTTTTCTGAGTCAAAGCAT；NKV3521-LE： ACACAATTGCTCATAACAGTATAGGTCTTTTTGAAGTTACCGTTTT；NKV3522-LE： CTTCCTCCTCCTCTGAGCTGTCTTTTTCTGAGTCAAAGCAT；NKV3524-LE： GGAGGTGTCTGGTTTTGCTTGTTTTTGAAGTTACCGTTTT；NKV3525-LE： TTACAACAGGACGTTACAATATTATAATTTTTTTCTGAGTCAAAGCAT；
HPV45 types：
NKV45E6E75-BL：GCAGCATATGCTATACAGTCTCTATACAC；NKV45E6E76-BL： GGAATAAAAGTCTATACATTTATGGCAT；NKV45E6E77-BL：GAGTTTGAATAATATCTTAATTCTCTAATTCT； NKV45E6E78-BL：TTTTTTCCAGTGTCTCTCCATATACA；NKV45E6E79-BL： CTTATTAACAAATTATACAACTCTGTATTAGTTA；NKV45E6E710-BL：TCTGGCACCGCAGGCAC； NKV45E6E713-BL：TCCAGCTATGCTGTGGAATCTT；NKV45E6E726-BL： TTACAACATACACACAAAATTTTGTGA；NKV45E6E73-CE： TATACCTCTGTGCGTTCCAATGTTTTTTCTCTTGGAAAGAAAGT；NKV45E6E74-CE： TATAAATAAATCTTTAAAAGCAAATTGATTTTTCTCTTGGAAAGAAAGT；NKV45E6E718-CE： CAGTGTTGCTCGGGGTCCATTTTTCTCTTGGAAAGAAAGT；NKV45E6E723-CE： TGACTAACGCCATCTGCTTCATTTTTTCTCTTGGAAAGAAAGT；NKV45E6E727-CE： AGCTCAATTCTGCCGTCACACTTTTTCTCTTGGAAAGAAAGT；NKV45E6E728-CE： CATCTGCCGAGCTCTCTACTGTATTTTTCTCTTGGAAAGAAAGT；NKV45E6E711-LE： TTTCTGCTGGGTTCAATGGTTTTTTTGAAGTTACCGTTTT；NKV45E6E712-LE： CGTTTGTCCTTAAGGTGTCTACGTTTTTTTCTGAGTCAAAGCAT；NKV45E6E714-LE： TGTATTACACTGCCCTCGGTACTGTTTTTGAAGTTACCGTTTT；NKV45E6E715-LE： GCCGTGCCTGGTCACAACATTTTTCTGAGTCAAAGCAT；NKV45E6E716-LE： CCTACGTCTGCGAAGTCTTTCTTTTTTTGAAGTTACCGTTTT；NKV45E6E717-LE： TGCATACTTATTGCTATACTTGTGTTTCTTTTTCTGAGTCAAAGCAT；NKV45E6E719-LE： TTCCAAATGCAATACAATTTCTTGTTTTTGAAGTTACCGTTTT；NKV45E6E720-LE： CAACAGGATCTAATTCATTCTGAGGTTTTTCTGAGTCAAAGCAT；NKV45E6E721-LE： TTAATTGCTCGTAACACAACAGGTTTTTTGAAGTTACCGTTTT；NKV45E6E722-LE： CGTTTTCCTCCTCTGACTCGCTTTTTCTGAGTCAAAGCAT；NKV45E6E724-LE： TCGGGCTGGTAGTTGTGCATTTTTGAAGTTACCGTTTT；NKV45E6E725-LE： CGCTGTGGTTCGGCTCGTTTTTCTGAGTCAAAGCAT；
HPV52 types：
NKV526-BL：CTATTCGTAAATCTGTAAATAGAAACTTG；NKV527-BL： CGCCATATGGATTATTGTCTCTATATA；NKV528-BL：AAAAGCGTAGGCACATAATACACA；NKV529-BL： TGATAATGCCTATATTCACTTATCTTAGATA；NKV5210-BL：TCTAATGTTTTCCCATACAGTGAATAT； NKV5211-BL：CACTTAATGGTTTTTTTACCCTCTCT；NKV5212-BL： CGTTTGACAAATTATACATCTAATAGTTATTT；NKV5215-BL：CCAACGACCCATAATATTATGAAA；NKV5220- BL：TTGTTTCAGGTTGCAGATCTAATATAT；NKV5221-BL：AATTGCTCATAGCAGTGTAGGTCAG；NKV5222- BL：CCTCCTCATCTGAGCTGTCACCT；NKV5228-BL：TGTAGAGTACGAAGGTCCGTCG；NKV5230-BL： CCGGGGCACACAACTTGTAA；NKV5231-BL：GGTTGTTTATAGCCGTGCACAG；NKV521-CE： GTGCAGGGTCCGGGGTCTTTTTCTCTTGGAAAGAAAGT；NKV5216-CE： CACTCTGAACAGCGCCCTGTTTTTTCTCTTGGAAAGAAAGT；NKV5217-CE： CACAGGTCGGGGTCTCCAATTTTTCTCTTGGAAAGAAAGT；NKV5227-CE： CAGTGCTATGAATGCATAGCCGTTTTTCTCTTGGAAAGAAAGT；NKV5229-CE： TGTGCCCAACAGCATTTGCTTTTTCTCTTGGAAAGAAAGT；NKV5232-CE： TTCAGGGTCCTCCATTGCAGTTTTTCTCTTGGAAAGAAAGT；NKV522-LE： CTTCCAGCACCTCACACAATTCTTTTTGAAGTTACCGTTTT；NKV523-LE： GCCTTATTTCATGCACCGATTTTTTTCTGAGTCAAAGCAT；NKV524-LE： TTTGCACTGCACACACTGCATTTTTGAAGTTACCGTTTT；NKV525-LE： TATACCTCTCTTCGTTGTAGCTCTTTTTTTTCTGAGTCAAAGCAT；NKV5213-LE： TTTCTTTTTCTTCAGGACATAATGGTTTTTGAAGTTACCGTTTT；NKV5214-LE： TCGCTTGTTTGCATTAACATGTCTTTTTCTGAGTCAAAGCAT；NKV5218-LE： CGCATGACGTTACACTTGGGTTTTTTGAAGTTACCGTTTT；NKV5219-LE： AATCTTTTATAGTTGCTTTGTCTCCATTTTTCTGAGTCAAAGCAT；NKV5223-LE： GCCGGTCCACACCATCTGTATTTTTTGAAGTTACCGTTTT；NKV5224-LE： GCTTGTTCTGCTTGTCCATCTGTTTTTCTGAGTCAAAGCAT；NKV5225-LE： ATGTCACAATGTAGTAATTGCTTGTGTTTTTGAAGTTACCGTTTT；NKV5226-LE： TAGTGTGCTATCACAACTGTGACAATTTTTTCTGAGTCAAAGCAT；
HPV51 types：
NKV51001-CE：GGTCTTTCCCTCTTGTCTTCGAATTTTTCTCTTGGAAAGAAAGT；NKV51002-CE： TGCATAGAAACGTTCAAAGCTTCTTTTTCTCTTGGAAAGAAAGT；NKV51003-CE： TTTGAATAAAACAGTAAACATTGTTTGTTTTTCTCTTGGAAAGAAAGT；NKV51004-CE： TCGATAAATCATATAAGCTTTTTTTAGTAATTTTTCTCTTGGAAAGAAAGT；NKV51005-CE： CGCATTGCCCCGTCCAATTTTTCTCTTGGAAAGAAAGT；NKV51006-CE： CGTGTACGTTGCCAGCAATTAGTTTTTCTCTTGGAAAGAAAGT；NKV51007-CE： GGAGCTTCAATTCTGTAACACGTATTTTTCTCTTGGAAAGAAAGT；NKV51008-LE： TTACAATACACACACACTACCTGTATATTGTTTTTGAAGTTACCGTTTT；NKV51009-LE： TTATATACATCTGCTCTACATAATTCCTTTTTTTTCTGAGTCAAAGCAT；NKV51010-LE： ATACAATCTTAATTTCAGTAAATGCTACATTTTTGAAGTTACCGTTTT；NKV51011-LE： CATACTGCATATGGATTATTATCCCTATTTTTTCTGAGTCAAAGCAT；NKV51012-LE： ACCTGCTATAACGTCTATACTCTCTAATTTTTTTGAAGTTACCGTTTT；NKV51013-LE： TTGCCTCTAATGTAGTACCATACACAGTTTTTCTGAGTCAAAGCAT；NKV51014-LE： GTGGTCTTTGACATCTATGACACCTTATTTTTGAAGTTACCGTTTT；NKV51015-LE： TTTGCTTTTCTTCAGGCCCAATTTTTCTGAGTCAAAGCAT；NKV51016-LE： CACTTGGGTTTCGTTACGTTGTTTTTTGAAGTTACCGTTTT；NKV51017-LE： CATTACCACGCATGGCTTTATTATTTTTCTGAGTCAAAGCAT；NKV51018-LE： TGCAATACTACATCTTTTAATTGTGGTATTTTTGAAGTTACCGTTTT；NKV51019-LE： AGTCAATTTCAGTCTGTGGTGTTAAATTTTTCTGAGTCAAAGCAT；NKV51020-LE： TCAAATTGCTCGTAGCATTGCATTTTTGAAGTTACCGTTTT；NKV51021-LE： TACTTCATCCTCCTCCTCTGAGCTGTTTTTCTGAGTCAAAGCAT；NKV51022-BL： ACATAATTCATGCAGCGTTCGT；NKV51023-BL：CTTTTTTTTTCGTCCACCAATT；NKV51024-BL： CGTCCCGCTATTTCATGGAAC；NKV51025-BL：CTGGTAGCTGGTCACGCATATTATC；NKV51026-BL： GCCTGTCCAGCCCGTCTTT；
HPV56 types：
NKV56001-CE：GTTAGTTCTTTTTTGCAATATACACATGTTTTTCTCTTGGAAAGAAAGT； NKV56002-CE：ATGCAAAATTATATACCTCAGCACGTTTTTTCTCTTGGAAAGAAAGT；NKV56003-CE： GCACACTGCATAAGGAAAATCATTTTTCTCTTGGAAAGAAAGT；NKV56004-CE： CACAATGCAATTGCTTTTCCTCTTTTTCTCTTGGAAAGAAAGT；NKV56005-CE： CTATTAGATGAAATCGTCTTTTTCTGTTTTTTCTCTTGGAAAGAAAGT；NKV56006-CE： GTCTCCAGCACCCCAAACATTTTTTCTCTTGGAAAGAAAGT；NKV56007-CE： AGGTCAATTTCTGTTTGAGGTGTTATTTTTCTCTTGGAAAGAAAGT；NKV56008-LE： CATACACTGAATAGTCATAATACCTATATTTTTTTTGAAGTTACCGTTTT；NKV56009-LE： GTTTTTTAGTTATACTTTCTAGTGTAGCTCTTTTTCTGAGTCAAAGCAT；NKV56010-LE： GTAGCACCTTATTAATAAATCACATAACTTTTTTGAAGTTACCGTTTT；NKV56011-LE： CGGAGTTAACGGACTTTGACATCTTTTTTCTGAGTCAAAGCAT；NKV56012-LE： TGTAGATTCTCTAGGTTCTCTAGATGTTTTTTTTGAAGTTACCGTTTT；NKV56013-LE： TTGGTACTTTACCATGCATGATTATACTTTTTCTGAGTCAAAGCAT；NKV56014-LE： CCTCATCCTCATCCTCTGAGCTTTTTTGAAGTTACCGTTTT；NKV56015-LE： GCTCCTGCAAATGGTCTACTTCATTTTTTCTGAGTCAAAGCAT；NKV56016-LE： CTTGTCTAGCTTGCTGTGGCCTTTTTGAAGTTACCGTTTT；NKV56017-LE： GTGTATTAGGTAACACGTATGTTGTTTAGTTTTTCTGAGTCAAAGCAT；NKV56018-LE： CACAAACTTACACTCACAACAAGGTACTTTTTGAAGTTACCGTTTT；NKV56019-LE： GGTACTGTGAATGTCCAACTGCACTTTTTCTGAGTCAAAGCAT；NKV56020-BL： TCCCTATACACTAAGTTTAATTCAGTGC；NKV56021-BL：TCTAACTTTACTATAAAACAATAAACATACTCT； NKV56022-BL：GACCCGGTCCAACCATGTG；NKV56023-BL：GTTCTAATATAACGTCTTGCAGCG； NKV56024-BL：GTCCAATTGCTCATTGCACTGT；
HPV58 types：
NKV58001-CE：CTCCTCTGCGTCCTGGAACATTTTTCTCTTGGAAAGAAAGT；NKV58002-CE： TCAATTCGATTTCATGCACAGATTTTTCTCTTGGAAAGAAAGT；NKV58003-CE： GTCTTTTTGCATTCAACGCATTTTTTTCTCTTGGAAAGAAAGT；NKV58004-CE： CACTATTCTTAAATCTGCAAATACAAAGTTTTTCTCTTGGAAAGAAAGT；NKV58005-CE： AGCAATCGTAAGCACACTTTACATACTTTTTCTCTTGGAAAGAAAGT；NKV58006-CE： ATTAATATTTCATTTAAACACTTTTTTAGTGTTTTTTCTCTTGGAAAGAAAGT；NKV58007-CE： CCGTCCAAGCCTATTTCATCCTTTTTTCTCTTGGAAAGAAAGT；NKV58008-LE： ATCATGCAATGTCCGTGGTTTTTTTTGAAGTTACCGTTTT；NKV58009-LE： TGTCTCCAACGCCTGACACAATTTTTCTGAGTCAAAGCAT；NKV58010-LE： ATAATTATAATGTCTATACTCACTTATTTTAGATTTTTTGAAGTTACCGTTTT；NKV58011-LE： TTGTTCTAATGTGTCTCCATATAGCGATTTTTCTGAGTCAAAGCAT；NKV58012-LE： CAATGGTCTTTGACAAATAATACATCTATTTTTGAAGTTACCGTTTT；NKV58013-LE： TGCCTTTTTTTTTCTTGTGGACATTTTTCTGAGTCAAAGCAT；NKV58014-LE： CCTGTCCAACGACCCGAAATATTTTTTGAAGTTACCGTTTT；NKV58015-LE： TCCAACACACTGCACAGCGCTTTTTCTGAGTCAAAGCAT；NKV58016-LE： TGTGTTTGTCTACGTCGGGGTCTTTTTGAAGTTACCGTTTT；NKV58017-LE： ATGGCGTTGTTACAGGTTACACTTTTTTCTGAGTCAAAGCAT；NKV58018-LE： TCATAGCAGAATAGGTCAGTTGGTTTTTTGAAGTTACCGTTTT；NKV58019-LE： CGTCTGAGCTGTCACATAATTGCTTTTTCTGAGTCAAAGCAT；NKV58020-BL： TCATATACCTCAGATCGCTGCAAA；NKV58021-BL：TGCAAATGGATTTCCATCTCTATA；NKV58022-BL： TATGAAACCTTTTGTTTAAATCCACA；NKV58023-BL：GCGTTGGGTTGTTTCCTCTC；NKV58024-BL： TCAGGATGTAAATCTAAAATATATTCTCTTA；
HPV68 types：
NKV68001-CE：GTCATGCAATGTAGTGTCCAATGTTTTTTCTCTTGGAAAGAAAGT；NKV68002- CE：TGTTAGGTGCCTTAGTTTTTCTGCTTTTTCTCTTGGAAAGAAAGT；NKV68003-CE： CGCTTACTGGTCCAGCAGTGCTTTTTCTCTTGGAAAGAAAGT；NKV68004-CE： CGGTGGGCTTTGGTCCATGTTTTTCTCTTGGAAAGAAAGT；NKV68005-CE： ATAGCTCTAACACAATTTCCTGCATTTTTCTCTTGGAAAGAAAGT；NKV68006-CE： CCCGCGACGCTTCTACTACTTTTTTCTCTTGGAAAGAAAGT；NKV68007-CE： CAAAATTTAGTGAGTCCATAAACAGCTTTTTCTCTTGGAAAGAAAGT；NKV68008-LE： CTTCTGCAATAGACACAGTCTATTGTAACTTTTTGAAGTTACCGTTTT；NKV68009-LE： CATATACCTCTGTCCGTTGTAGTTGCTTTTTCTGAGTCAAAGCAT；NKV68010-LE： ATTTAATACATGATTGGCATGCAGTTTTTGAAGTTACCGTTTT；NKV68011-LE： CGTAGTTCCCGTATTTTAGCATAAATTTTTCTGAGTCAAAGCAT；NKV68012-LE： GCATACACCGATTCCGAGTAATATTTTTTGAAGTTACCGTTTT；NKV68013-LE： CTTTGTATTAGTTATGGTTTCTAATGTAGTTTTTTTCTGAGTCAAAGCAT；NKV68014-LE： ACTCATGCACCTTATCAATAAATTATATAATTTTTGAAGTTACCGTTTT；NKV68015-LE： TGGACACAATGGTTTCAGGCATTTTTCTGAGTCAAAGCAT；NKV68016-LE： CGGCTGTATTTCATTGTATGGACTTTTTGAAGTTACCGTTTT；NKV68017-LE： TGCTCGTGACATACAAGGTCAACTTTTTCTGAGTCAAAGCAT；NKV68018-LE： CTATTTCATCGTCTGAATCTCCTAATTTTTTGAAGTTACCGTTTT；NKV68019-LE： AACTGCATGGTCGGGTTCATTTTTTCTGAGTCAAAGCAT；NKV68020-LE： GCTGTTGTTCGTCCCGTCTGTTTTTGAAGTTACCGTTTT；NKV68021-LE： CAACACAGACACTGAATTCTGTGACTTTTTCTGAGTCAAAGCAT；NKV68022-BL： CTACACATAGGTCACTAAAGGCAAATT；NKV68023-BL：CAAATGGTACCCCGTCTCTATACA；NKV68024-BL： GCTATTTTATGTAATCTTCGTTTTGT；NKV68025-BL：CGACACTGTCCTGTAAAGTTTCCT；NKV68026-BL： GTATGCGTCTGCGGTCCTCT；NKV68027-BL：CATAGTTACTTAAACTTGTGTTTCTTGAC；NKV68028-BL： GCTAGTAGTAGATGTTGGTGGTGATT；NKV68029-BL：AGTTGCAGTGCCTTGTTACACTTA；NKV68030-BL： TGTTGTAGTGTCCGCAGGTTGT；
HPV59 types：
NKV592-BL：GGCAGTTTGTATGGTCGTTGTGTA；NKV593-BL： AATATTCAATGTTGTGCTCAAATCA；NKV597-BL：TACACTATAAATAAGTCATTAAAAGCAAAT；NKV598-BL： GCTGCATACGGTGTACAGTCTCTA；NKV599-BL：CATAAAATGAAATGCATTTCAGACAC；NKV5910-BL： AATCTCTATAATATCTTAATTCTCTTACTCTTG；NKV5915-BL：CTTTTTTCAGTTATATGCTTTAATTTATC； NKV5916-BL：TATATATTCCAGCTATATTATGGAATCTT；NKV5917-BL：GACACCCACGACACTGTCCTG； NKV5926-BL：GATGATTAACTCCATCTGGTTCATCT；NKV5927-BL：CAGCTCGTCTAGCTAGTAGCAAAG； NKV5928-BL：ACAATGTTGTGACGCTGTGGTT；NKV5929-BL：TTGATTATTACACTTACAACACACACAC； NKV591-CE：GGATCCTCAAAGCGTGCCATTTTTCTCTTGGAAAGAAAGT；NKV594-CE： TGATGCGAATATCATGCAGAGGTTTTTCTCTTGGAAAGAAAGT；NKV5913-CE： TCTATAACAGCGTATCAGCAGCTCTTTTTCTCTTGGAAAGAAAGT；NKV5914-CE： TGTTGGACATAGAGGTTTTAGGCATTTTTCTCTTGGAAAGAAAGT；NKV5918-CE： TAGGTGTCTTGCTCGGGTCCTTTTTCTCTTGGAAAGAAAGT；NKV5921-CE： AAAGTGTTGCTTTTGGTCCATGTTTTTCTCTTGGAAAGAAAGT；NKV595-LE： CCCCTTTGCAAAACACACAATTTTTTGAAGTTACCGTTTT；NKV596-LE： TCAAATACCTCTCTTTCTTGCAGTTTTTTTCTGAGTCAAAGCAT；NKV5911-LE： CCTCTAATGTTTCTCCATACACGGTTTTTGAAGTTACCGTTTT；NKV5912-LE： ATGTAACGGTGTCTTGGTTTCAGTTTTTCTGAGTCAAAGCAT；NKV5919-LE： GCGCTTGTCGTTGCTGTCTTTTTTGAAGTTACCGTTTT；NKV5920-LE： CATTGTTTTACACCAGTGTTTCACTACTTTTTCTGAGTCAAAGCAT；NKV5922-LE： GGTTCCAAATCTAAAACAATGTCACTTTTTGAAGTTACCGTTTT；NKV5923-LE： AAGGTCAACTTCCTCATAATTTTGTTTTTTCTGAGTCAAAGCAT；NKV5924-LE： TCAGGTAATTGCTCGTAGCACACTTTTTGAAGTTACCGTTTT；NKV5925-LE： TTTTCATTCTCGGAGTCGGAGTTTTTCTGAGTCAAAGCAT；NKV5930-LE： GCGAGGTTTCTACTACTAGCTGAAGTTTTTGAAGTTACCGTTTT；NKV5931-LE： AAGGCTCGCAATCCGTCTTTTTTTCTGAGTCAAAGCAT；
HPV16 types：
NKV161-LE：GTCTGCTTTTATACTAACCGGTTTCTTTTTGAAGTTACCGTTTT；NKV162-LE： GCAGTTCTCTTTTGGTGCATAAAATTTTTTCTGAGTCAAAGCAT；NKV163-CE： CTCCTGTGGGTCCTGAAACATTTTTTTCTCTTGGAAAGAAAGT；NKV164-LE： AACTGTGGTAACTTTCTGGGTCGTTTTTGAAGTTACCGTTTT；NKV165-LE： AGTTGTTTGCAGCTCTGTGCATTTTTTCTGAGTCAAAGCAT；NKV166-BL： GCAGTACACACATTCTAATATTATATCATGTAT；NKV167-CE： CACGTCGCAGTAACTGTTGCTTTTTTTCTCTTGGAAAGAAAGT；NKV168-BL： CCCGAAAAGCAAAGTCATATACCT；NKV169-LE： TTCCCATCTCTATATACTATGCATAAATTTTTTGAAGTTACCGTTTT；NKV1610-LE： AACATTTATCACATACAGCATATGGATTTTTCTGAGTCAAAGCAT；NKV1611-BL： GTCTATACTCACTAATTTTAGAATAAAACTTTA；NKV1612-CE： TGTTGTTCCATACAAACTATAACAATAATTTTTTCTCTTGGAAAGAAAGT；NKV1613-LE： CGGTTTGTTGTATTGCTGTTCTAATTTTTGAAGTTACCGTTTT；NKV1614-LE： TAATACACCTAATTAACAAATCACACAATTTTTCTGAGTCAAAGCAT；NKV1615-LE： GGACACAGTGGCTTTTGACAGTTTTTTGAAGTTACCGTTTT；NKV1616-LE： CCAGATGTCTTTGCTTTTCTTCATTTTTCTGAGTCAAAGCAT；NKV1617-BL： TTATATTATGGAATCTTTGCTTTTTGT；NKV1618-BL：CCGGTCCACCGACCCC；NKV1619-LE： GATCTGCAACAAGACATACATCGATTTTTGAAGTTACCGTTTT；NKV1620-LE： TGGGTTTCTCTACGTGTTCTTGATTTTTTCTGAGTCAAAGCAT；NKV1621-BL： TGTATCTCCATGCATGATTACAGC；NKV1622-CE： AATCTAACATATATTCATGCAATGTAGGTTTTTCTCTTGGAAAGAAAGT；NKV1623-LE： GAGATCAGTTGTCTCTGGTTGCATTTTTGAAGTTACCGTTTT；NKV1624-LE： GCTGTCATTTAATTGCTCATAACAGTATTTTTCTGAGTCAAAGCAT；NKV1625-BL： CATCTATTTCATCCTCCTCCTCTGA；NKV1626-BL：GTTCTGCTTGTCCAGCTGGAC；NKV1627-CE： ATATTGTAATGGGCTCTGTCCGTTTTTCTCTTGGAAAGAAAGT；NKV1628-LE： TCACACTTGCAACAAAAGGTTACATTTTTGAAGTTACCGTTTT；NKV1629-LE： CGCACAACCGAAGCGTAGAGTTTTTCTGAGTCAAAGCAT；NKV1630-BL：CGAATGTCTACGTGTGTGCTTTGTA； NKV1631-CE：CCCATTAACAGGTCTTCCAAAGTATTTTTCTCTTGGAAAGAAAGT；NKV1632-BL： GGGGCACACAATTCCTAGTGTG；NKV1633-CE： GGTAGATTATGGTTTCTGAGAACAGATTTTTTCTCTTGGAAAGAAAGT；NKV1634-BL： GGTACCTGCAGGATCAGCCAT；NKV1635-CE：CCCGTACCCTCTTCCCCATTTTTTTCTCTTGGAAAGAAAGT；
HPV18 types：
NKV181-CE：CGTTTTTCATTAAGGTGTCTAAGTTTTTTTTTTCTCTTGGAAAGAAAGT；NKV182- LE：CCCAGCTATGTTGTGGAATCGTTTTTTGAAGTTACCGTTTT；NKV183-LE： AATGGCACTGGCCTCTATAGTGTTTTTCTGAGTCAAAGCAT；NKV184-CE： TGCTCGGTTGCAGCACGTTTTTCTCTTGGAAAGAAAGT；NKV185-LE： TCGTTGGAGTCTTTCCTGTCGTTTTTGAAGTTACCGTTTT；NKV186-LE： CTTAATATTATACTTGTGTTTCTCTGCGTTTTTCTGAGTCAAAGCAT；NKV187-CE： TGTTGCCTTAGGTCCATGCATATTTTTCTCTTGGAAAGAAAGT；NKV188-LE： TAAATGCAATACAATGTCTTGCAATTTTTGAAGTTACCGTTTT；NKV189-LE： GGAATTTCATTTTGGGGCTCTTTTTCTGAGTCAAAGCAT；NKV1810-LE： GCTCGTGACATAGAAGGTCAACCTTTTTGAAGTTACCGTTTT；NKV1811-LE： TTTCTTCCTCTGAGTCGCTTAATTTTTTTCTGAGTCAAAGCAT；NKV1812-LE： ATGATTAACTCCATCTATTTCATCGTTTTTTGAAGTTACCGTTTT；NKV1813-LE： CGTCGGGCTGGTAAATGTTGTTTTTCTGAGTCAAAGCAT；NKV1814-BL：TGTGTGACGTTGTGGTTCAGCT； NKV1815-BL：TTCACACTTACAACACATACACAACAT；NKV1816-CE： GCTTTCTACTACTAGCTTAATTCTGGCTTTTTCTCTTGGAAAGAAAGT；NKV1817-LE： GCTCGAAGGTCGTCTGCTGATTTTTGAAGTTACCGTTTT；NKV1818-LE： TGTTCAGAAACAGCTGCTGGAATTTTTTCTGAGTCAAAGCAT；NKV1819-LE： CGGACACACAAAGGACAGGGTTTTTGAAGTTACCGTTTT；NKV1820-LE： ACTGCTGGGATGCACACCATTTTTCTGAGTCAAAGCAT；NKV1821-CE： CTGGATCAGCCATTGTTGCTTTTTTTCTCTTGGAAAGAAAGT；NKV1822-LE： CGTCAGTTTCCTCATCTGAAAACTTTTTTTGAAGTTACCGTTTT；NKV1823-LE： CGTCAAGTCATTTAAGCTTGGTACCTTTTTCTGAGTCAAAGCAT；NKV1824-CE： TACTACCTGCTAATCTTCTATGAGCTTTTTTTCTCTTGGAAAGAAAGT；NKV1825-BL： GAATTAGGAGTCAGCAGTCATTATTC；NKV1826-CE： TGGCCAGGGAAGATCCACTTTTTTCTCTTGGAAAGAAAGT；NKV1827-CE： TTGCAGCTCAATACAAAACGGTTTTTCTCTTGGAAAGAAAGT；
HPV66 types：
NKV66001-CE：CCTGTGTATTGCTGAATATGGAATCTTTTTCTCTTGGAAAGAAAGT；NKV66002- CE：GGCCAATTGTTTCTATATACTAGTTTTAACTTTTTCTCTTGGAAAGAAAGT；NKV66003-CE： ATGTTGCCCCATACACTGAATATTTTTTTCTCTTGGAAAGAAAGT；NKV66004-CE： CTTTTATGTTCACAGTGCAATTGTTTTTTTTCTCTTGGAAAGAAAGT；NKV66005-CE： CATGCATATGCTATATAATGAAATCGTTTTTCTCTTGGAAAGAAAGT；NKV66006-CE： GCATTGTAGGTCAATTTCCGTTTTTTTTCTCTTGGAAAGAAAGT；NKV66007-LE： TGCAGGCTTCGTGGACGTTTTTTTGAAGTTACCGTTTT；NKV66008-LE： TTTGTAATACCTCGCTCAGATGGTTTTTCTGAGTCAAAGCAT；NKV66009-LE： ATCAGATAACTGTTTTTTAGTTATACTTTCTATTTTTGAAGTTACCGTTTT；NKV66010-LE： TGACATCGGTAGCACCTTATTGATAATTTTTCTGAGTCAAAGCAT；NKV66011-LE： CTGCAAACATGACCCGGTCTTTTTGAAGTTACCGTTTT；NKV66012-LE： CTTGTCTACTCGTATGTCTCCAACATTTTTCTGAGTCAAAGCAT；NKV66013-LE： CTTGCAACGTTGGTACTTTACCATTTTTGAAGTTACCGTTTT；NKV66014-LE： GCGGTGCAAGTTCTAATATAACCTTTTTTCTGAGTCAAAGCAT；NKV66015-LE： CTGAGCTGTCCAATTGCTCATTTTTTTGAAGTTACCGTTTT；NKV66016-LE： TCTATTTCATCCTCATCCTCATCCTTTTTTCTGAGTCAAAGCAT；NKV66017-LE： GGCCGCTCCAGCAAATGGTTTTTGAAGTTACCGTTTT；NKV66018-LE： TGTTCAGCTTGTCTAGCTTGCTGTTTTTTCTGAGTCAAAGCAT；NKV66019-BL： CACATGATAATCTAAGATCAAGTAAAGGTA；NKV66020-BL：AACTTGTAAGTTCCTTTTTGCAGTATA； NKV66021-BL：TCAATACATGCAAACCTATATAGCTCTA；NKV66022-BL： CAATAAACATACCCTACATACTGCATAT；NKV66023-BL：TATAGTACCTATATTTTCTAACCTTACTATAAAA； NKV66024-BL：TTCCTCCGGTGTTAACGGACAT；NKV66025-BL：TGCATGGTTATACTGTAGATTCTGTAG；
It is consistent in other general probes, luminous substrate, signal amplification precursor, signal amplification body and AP reporter probes Under the premise of, chemiluminescence detection is carried out by subjects of each cervical carcinoma positive cell of various concentration, the results show that same dense The positive cell sample of degree is apparently higher than control probe sequence, this table using the signal value detected by probe sequence of the present invention Probe sequence of the present invention is illustrated has very high specificity for detection cervical cancer cell, can improve the quantitative limit of detection (LOQ), detection limit (LOD) and sensitivity.
By above technical scheme it is found that the present invention is captured for a variety of regions high-risk human mammilla papillomavirus type E6E7 Extension probes, K-type label probe and close the design of probe and artificial optimization, further improve based on similar bDNA and The specificity that QuantiMAT technologies detect cervical cancer cell shows preferable quantitative limit, detection limit and sensitivity, and It can be applied in the preparation of such kit.
Description of the drawings
Fig. 1 show kit operation principle schematic diagram of the present invention (carrier is magnetic bead)；Wherein, 1 general spy is indicated Needle, 2 indicate capture extension probes, and 3 indicate target RNA, and 4 indicate K-type label probe, and 5 indicate that signal amplifies precursor, and 6 indicate letter Number amplification body, 7 indicate AP reporter probes, 8 indicate closing probes；
Fig. 2 show kit operation principle schematic diagram of the present invention (carrier is tissue culture plate)；Wherein, it 1 indicates General probe, 2 expression capture extension probes, 3 expression target RNA, 4 expression K-type label probes, 5 expression signals amplification precursors, 6 Indicate that signal amplifies body, 7 indicate AP reporter probes, and 8 indicate closing probe, and 9 indicate tissue culture plate.
Specific implementation mode
The invention discloses a kind of cervical carcinoma detection probe sequence and its application, those skilled in the art can use for reference herein Content is suitably modified technological parameter realization.In particular, it should be pointed out that all similar substitutions and modifications are to people in the art It is it will be apparent that they are considered as being included in the present invention for member.Probe sequence of the present invention and its application have been led to Embodiment is crossed to be described, related personnel obviously can not depart from the content of present invention, in spirit and scope to spy described herein Needle sequence and its application are modified or suitably change and combine, to realize and apply the technology of the present invention.
According to sequence probes provided by the present invention and other matched reagent box components, the job step in specific detection Rapid and principle is as follows：
Crack sample to be tested release target RNA；
Then probe sequence of the present invention is added, capturing the parts of extension probes, (magnetic bead is similar with coupling carrier The tissue culture plate of 96 orifice plates) general probe combine, another part combined with target RNA；K-type marks extension probes and target RNA is combined；Closing probe is used for closing some sites and improves specificity；
After probe set hybridisation, it is gradually added signal amplification precursor, amplification body, the probe of alkali phosphatase enzyme mark and chemistry hair Light substrate.According to above-mentioned principle, signal can be amplified 400 times by one group of K-type label extension probes, and a general target RNA can be tied 20 groups of K-type label extension probes are closed, so a RNA target can be amplified 8000 times.Finally detected with chemiluminescent analyzer, Principle schematic is shown in Fig. 1 and Fig. 2.
Quantitative detection can obtain actual fold difference, rather than in conventional method TaqMan CT result of variations, knot Fruit is more directly accurate, 100~1000 times of remolding sensitivity TaqMan high.
If not otherwise specified, in contrast test of the present invention in addition to due technical characteristic is distinguished, remaining experimental enviroment and item Part is consistent.
Just a kind of cervical carcinoma detection probe sequence provided by the present invention and its application are described further below.
Embodiment 1：The kit of detection cervical carcinoma of the present invention
1, probe sequence
In high-risk HPV 16,18,31,33,35,39,45,51,52,56,58,59,66 of the present invention and 68 types One or more kinds of capture extension probes, K-type label extension probes and closing probes；
2, the mating component of kit
With the general probe of the carrier conjugations such as magnetic bead or tissue culture plate：Shown in SEQIDNo.413；
Signal amplifies precursor：ATGCTTTGACTCAG/AAAACGGTAACTTC (the amplification preposition guiding region sequence of precursor, two Kind)+19 preposition boot sections of amplification body+AGGATCGTAAGTAACTAAGGACTACC (the preposition boot section complementary series of amplification body) Complementary series (shown in SEQIDNo.414-415)；
Signal amplifies body：GGTAGTCCTTAGTTACTTACGATCCT (the preposition guiding region sequence of amplification body)+ + 19 reporter probe duplicate block complementary series of GAATCCATTGAATCCTGTGATT (reporter probe duplicate block complementary series) (shown in SEQIDNo.416)；
The probe of AP labels：AATCACAGGATTCAATGGATTC-AP (shown in SEQIDNo.417)；
Adamantane derivative.
Embodiment 2：Specific contrast test
1, test method
Using 18 type cervical carcinoma positive cells (Caski and hela cells) of HPV16, the cell produced with Ke Diya companies Specimen preserving liquid is configured to a concentration of 80/mL, 160/mL, 320/mL, four kinds of cells of 640/mL and 1280/mL Specimen fluids；
Sample cracks：
Cell specimen liquid centrifuged deposit cell mass, is added following mixed liquor：(lysate need to be put 200 μ l lysates in advance Set 37 DEG C of insulating boxs 20 minutes) and 400 μ l test water (mixed proportions 1：2).Cell mass is blown and beaten with liquid-transfering gun, makes cell point It dissipates and suspends, add 5 μ l Proteinase Ks.It is placed 1 hour in 65 DEG C, 2~3 concussions is carried out in cracking process.It is taken out after 1 hour, Take supernatant for detecting.
Because presently commercially available cervical carcinoma positive cell only have HPV16 18 types, other cervical carcinoma hypotypes (31 33 35 39 45 51 52 56 58 59 66 68) using respectively virus Quality Control armored RNA, RNA concentration be set as 0.12ng/ml, 0.25ng/ml, 0.5ng/ml, 1ng/ml and 2ng/ml；
Meanwhile using the cell C33-A of HPV feminine genders and cervical carcinoma low risk 6b/11/42/43/44/53/72 viruses Quality Control armored RNA carry out specific comparison；
Detect buffer：
Taking-up detection probe, capping liquid are placed on and melt on ice, need mixing to centrifuge after melting.
The holes Samples detection buffer solution 50ul/.Configuration method is as follows：+ 31ul the experiments of 1ul capping liquid+17ul lysates With water+1ul detection probes.
Probe is prepared：Each component concentration requirement, CE probes in probe groups：LE probes：The general proportions of BL probes are 1:4: 2.Every probe final concentration of each component is that CE requires 1fmol/ul, LE that 4fmol/ul, BL is required to require 2fmol/ul respectively.
Fabric swatch：
96 holes for being coated with general probe are captured coating plate to take out from 4 degree of refrigerators, at normal temperatures rewarming.It will be above-mentioned slow Fliud flushing and supernatant to be measured are added separately in 96 holes capture coating plate：
Blank control wells：98ul blank control buffer solution+2ul test waters.
Test hole：98ul blank control buffer solution+2ul supernatants to be measured.
Heat-retaining condition and time：It is tamping entire plate with sealing plate paster, 55 degree of incubators is put into and keeps the temperature 3.5 hours.
Signal amplifies：
Dilution, 10 × eluent are set 37 DEG C to preheat 20 minutes；Signal amplifies precursor, and signal amplification body taking-up is placed on ice On melt, shake mixing, gentle centrifugation.
Liquid needed for configuration：1 × eluent：10 × eluent is taken, DDH is used2O is diluted to 1 × eluent, and volume ratio is 10 × eluent:DDH2O=1:9.
Signal amplifies precursor：Liquor capacity proportioning is that signal amplifies precursor：Dilution=1:1000, take kit to match letter Number amplification precursor be added in appropriate dilution；
Signal amplifies body：Liquor capacity proportioning is that signal amplifies body：Dilution=1:1000, take kit to be put with signal It is substantially added in appropriate dilution；
AP label probes：Liquor capacity proportioning is AP label probes：Dilution=1:1000, take the matched probe mark of kit Note object is added in appropriate dilution；
(1) 96 holes are captured coating plate to take out from incubator, raises sealing plate paster, liquid in evacuation plate, with 1 × eluent The holes 200ul/ board-washing is washed 3 times.100ul is added per hole for matched signal amplification precursor, 55 degree of incubators is put into and keeps the temperature 40 minutes.
(2) 96 holes are captured coating plate to take out from incubator, raises sealing plate paster, liquid in evacuation plate, with 1 × eluent The holes 200ul/ board-washing is washed 3 times.100ul is added per hole for matched signal amplification body, 55 degree of incubators is put into and keeps the temperature 40 minutes.
(3) 96 holes are captured coating plate to take out from incubator, raises sealing plate paster, liquid in evacuation plate, with 1 × eluent The holes 200ul/ board-washing is washed 3 times.100ul is added per hole for matched AP label probes, 50 degree of incubators is put into and keeps the temperature 40 minutes.
Read plate：
Substrate adamantane derivative rewarming is taken out from 4 degree of refrigerators.Substrate catalyst is added after rewarming, substrate is catalyzed with substrate Agent proportioning is 1000:3, mixing is shaken, mixing is blown and beaten using preceding pipettor again.
96 holes are captured coating plate to take out from incubator, raise sealing plate paster, liquid in evacuation plate, with 1 × eluent The holes 200ul/ board-washing is washed 3 times.100ul is added per hole for matched substrate, 46 degree of incubator heat preservations is put into and takes out after twenty minutes, upper cold light Instrument detects.
2, subjects
The present invention：1 sequence probes of embodiment and its mating component of kit；
Control group：The mating component of kit in control group probe provided by the invention and embodiment 1；
3, result
Table 1
HPV16 types positive cell number (a/ml) The present invention detects average value Control group detects average value
80 1.98 1.2
160 4.74 3.36
320 10.17 8.33
640 20.78 17.62
1280 47.52 35.33
Table 2
HPV18 types positive cell number (a/ml) The present invention detects average value Control group detects average value
80 2.56 1.89
160 5.87 4.86
320 11.78 10.21
640 24.32 21.53
1280 60.78 56.33
Table 3
According to 3 data of table 1- tables, it is apparent that higher detection signal can be obtained using probe sequence of the present invention Value, this shows that probe sequence of the present invention has higher detection specificity.Meanwhile in linear relationship, R values of the invention It is all higher than 0.99, has a good linear relationship, result is more accurate when detection.
In addition, the present invention calculates normal population by the detection and analysis to 127 normal person's samples, using method of percentiles 90% Upper Limit of Normal Value of mRNA concentration is 1.0；To verify the validity of the normal reference value, the present invention has detected 414 palaces The Diseases sample such as neck cancer, positive rate are above the data of document report；Using 1.0 as Upper Limit of Normal Value in theory and It is feasible in clinical practice.Therefore, present invention determine that the normal reference value of Subclinical papillomavirus infection detection signal is 0~1.0, when It can determine that when testing result >=1.0 and exist for HPV infection, oncogene is in the transcription activity phase.
Based on above-mentioned criterion, the present invention uses cervical carcinoma negative cells and each low risk virus armored RNA For quality-control product, it is detected respectively with each probe sequence provided by the invention, signal value is respectively less than 0.8, and result judgement is feminine gender, This shows that probe sequence specificity of the present invention is high, is not in false positive.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.
Sequence table
<110>Zhengzhou Ke Diya Bioisystech Co., Ltd
<120>A kind of cervical carcinoma detection probe sequence and its application
<130> MP1730589
<160> 417
<170> SIPOSequenceListing 1.0
<210> 1
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 1
ggaaattgca tgaactaagc tcggtttttc tcttggaaag aaagt 45
<210> 2
<211> 51
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 2
acagatttaa caatagtata tagggacgac tttttctctt ggaaagaaag t 51
<210> 3
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 3
gtgtccagaa gaaaaacaaa gacatttgtt tttctcttgg aaagaaagt 49
<210> 4
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 4
tactgaaacc caagtgtaaa catgcgtttt tctcttggaa agaaagt 47
<210> 5
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 5
aactgacctc cactgttatg agcatttttc tcttggaaag aaagt 45
<210> 6
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 6
gacaagcaaa accggacaca tcctttttct cttggaaaga aagt 44
<210> 7
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 7
attgaattgt gtctactgca aaggtcagtt tttgaagtta ccgtttt 47
<210> 8
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 8
ttaacagaaa cagaggtatt agattttgca ttttttttct gagtcaaagc at 52
<210> 9
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 9
acaccatacg gagtgtgtac aaaatgtttt tgaagttacc gtttt 45
<210> 10
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 10
tttaagattt tattctaaag taagtgaatt tagatggttt ttctgagtca aagcat 56
<210> 11
<211> 57
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 11
aaattgacaa acaaaggtat atgtgattta ttaattagtt tttgaagtta ccgtttt 57
<210> 12
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 12
gtgtataacg tgtcagagac cgtttttttc tgagtcaaag cat 43
<210> 13
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 13
tggagaaaca cctacattgc aagacttttt gaagttaccg tttt 44
<210> 14
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 14
tatgtgttag atttgcaacc tgaggctttt tctgagtcaa agcat 45
<210> 15
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 15
attacccgac agctcagatg aggtttttga agttaccgtt tt 42
<210> 16
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 16
aggatgttat agacagtcca gctgtttttc tgagtcaaag cat 43
<210> 17
<211> 51
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 17
aattacaata tcgttacctt ttgttgtcag tgtttttgaa gttaccgttt t 51
<210> 18
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 18
tgagtctaca cttcgtttgt gtgtactttt tctgagtcaa agcat 45
<210> 19
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 19
agagcacaca agtagatatt cgcatatttt tttgaagtta ccgtttt 47
<210> 20
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 20
gcaagagctg ttaatgggct catttttttc tgagtcaaag cat 43
<210> 21
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 21
atgttcaaaa atcctgcaga aagacctc 28
<210> 22
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 22
cattggaaat accctacgat gaactaag 28
<210> 23
<211> 33
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 23
tatagatata gtgtgtatgg aacaacatta gaa 33
<210> 24
<211> 29
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 24
gataaaaaga aacgattcca caacatagg 29
<210> 25
<211> 21
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 25
aggaaggtgg acaggacgtt g 21
<210> 26
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 26
catagtatgt tggagaagac ctcg 24
<210> 27
<211> 21
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 27
tggaatcgtg tgccccaact g 21
<210> 28
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 28
atgtttcaag acatgtttca agacactgtt tttctcttgg aaagaaagt 49
<210> 29
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 29
gtgccaagca ttggagacaa ctattttttc tcttggaaag aaagt 45
<210> 30
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 30
aggtatatga ttttgcattt gcagatttaa cagtttttct cttggaaaga aagt 54
<210> 31
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 31
ttgtatatag agagggaaat ccatttggtt tttctcttgg aaagaaagt 49
<210> 32
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 32
tatactgcta tgagcaatta agtgacagtt tttctcttgg aaagaaagt 49
<210> 33
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 33
tacagcaagt gacctacgaa ccattttttc tcttggaaag aaagt 45
<210> 34
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 34
acacaacatt gaactacagt gcgtgttttt gaagttaccg tttt 44
<210> 35
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 35
gaatgcaaaa aacctttgca acgatctgtt tttctgagtc aaagcat 47
<210> 36
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 36
aatatgtaaa ctgtgtttgc ggttcttatc tttttgaagt taccgtttt 49
<210> 37
<211> 60
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 37
taaaattagt gaatatagac attataatta ttctgtatat gtttttctga gtcaaagcat 60
<210> 38
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 38
gaaatacatt agaacaaaca gttaaaaaac ctttaaattt ttgaagttac cgtttt 56
<210> 39
<211> 55
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 39
tgaaatatta attaggtgta ttatatgtca aagacctttt tctgagtcaa agcat 55
<210> 40
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 40
ccgacgtaga gaaactgcac tgtttttgaa gttaccgttt t 41
<210> 41
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 41
tgacgtgtaa aaacgccatg agagtttttc tgagtcaaag cat 43
<210> 42
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 42
gacacaagcc aacgttaaag gaatatgttt ttgaagttac cgtttt 46
<210> 43
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 43
ttttagattt atatcctgaa ccaactgacc tttttctgag tcaaagcat 49
<210> 44
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 44
accggccaga tggacaagca tttttgaagt taccgtttt 39
<210> 45
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 45
caaccagcca cagctgatta ctactttttc tgagtcaaag cat 43
<210> 46
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 46
attgtaacct gttgtcacac ttgtaacatt tttgaagtta ccgtttt 47
<210> 47
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 47
ccacagttcg tttatgtgtc aacagttttt ctgagtcaaa gcat 44
<210> 48
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 48
acagcaacta cttatgggca cagttttttg aagttaccgt ttt 43
<210> 49
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 49
gaatattgtg tgccctacct gtgctttttc tgagtcaaag cat 43
<210> 50
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 50
aggaaaaacc acgaacattg catgattt 28
<210> 51
<211> 29
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 51
tttgtgtcct caagaaaaaa aacgacatg 29
<210> 52
<211> 33
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 52
tggatttaaa caaacgattt cataatattt cgg 33
<210> 53
<211> 17
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 53
gtcgttgggc agggcgc 17
<210> 54
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 54
tgtgcggcgt gttggaggtc 20
<210> 55
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 55
ctcagatgag gatgaaggct tgg 23
<210> 56
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 56
gaggtagaag aaagcatcca tgaaattttt tttctcttgg aaagaaagt 49
<210> 57
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 57
gtttgaattg tgtatactgc aaacaagaat tactttttct cttggaaaga aagt 54
<210> 58
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 58
ttttagattt ggaacccgag gcaacttttt ctcttggaaa gaaagt 46
<210> 59
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 59
agatactatt gacggtccag ctggtttttc tcttggaaag aaagt 45
<210> 60
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 60
acaagcaaaa ccagacacct ccaatttttc tcttggaaag aaagt 45
<210> 61
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 61
tacagagcac acacattgac atacgttttt ctcttggaaa gaaagt 46
<210> 62
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 62
aatagtgtgc cccggctgtt ctttttctct tggaaagaaa gt 42
<210> 63
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 63
atgtttcagg acccagctga acgtttttga agttaccgtt tt 42
<210> 64
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 64
accttacaaa ctgcatgatt tgtgcaactt tttctgagtc aaagcat 47
<210> 65
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 65
agcggagtga ggtatatgac tttgtttttg aagttaccgt ttt 43
<210> 66
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 66
catgctatga tttgtgtata gtatatagag aagtttttct gagtcaaagc at 52
<210> 67
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 67
gccagccata tggagtatgc atgtttttga agttaccgtt tt 42
<210> 68
<211> 61
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 68
aaatgtttaa aattttattc aaaaataagt gaatatagat ggtttttctg agtcaaagca 60
t 61
<210> 69
<211> 50
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 69
tatagatata gtgtgtatgg agaaacgtta gtttttgaag ttaccgtttt 50
<210> 70
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 70
aaaaacaatg caacaaacag ttatgtcatt tattaatttt ttctgagtca aagcat 56
<210> 71
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 71
taggtgtatt acatgtcaaa aaccgctgtt tttgaagtta ccgtttt 47
<210> 72
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 72
tgtccagttg aaaagcaaag acatttagtt tttctgagtc aaagcat 47
<210> 73
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 73
tagagaaacc gaggtgtaat catgcttttt gaagttaccg tttt 44
<210> 74
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 74
atggagaaat aactacattg caagactatg tttttctgag tcaaagcat 49
<210> 75
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 75
tgacctatac tgttatgagc aattgtgttt tttgaagtta ccgtttt 47
<210> 76
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 76
gacagctcag aggaggagga tttttctgag tcaaagcat 39
<210> 77
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 77
ttataatatt gtaacgtcct gttgtaaatg tgatttttga agttaccgtt tt 52
<210> 78
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 78
ggcgacacta cgtctgtgtg tttttctgag tcaaagcat 39
<210> 79
<211> 30
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 79
aagaaaaaaa acgattccat aacatcggtg 30
<210> 80
<211> 19
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 80
gacggtggac aggtcggtg 19
<210> 81
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 81
tatgtcctgt tggaaaccaa cacg 24
<210> 82
<211> 33
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 82
taaattggaa gatttattaa tgggcacatt tgg 33
<210> 83
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 83
atggcgcgat ttcacaatcc tgctttttct cttggaaaga aagt 44
<210> 84
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 84
ccaccttgca ggacattaca atagtttttc tcttggaaag aaagt 45
<210> 85
<211> 55
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 85
ccaatcatgt ataaaatttt atgctaaaat acggtttttc tcttggaaag aaagt 55
<210> 86
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 86
agaaaaatta agacacctaa atagcaaacg aagtttttct cttggaaaga aagt 54
<210> 87
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 87
ccacaaaacg ggaggaccgc tttttctctt ggaaagaaag t 41
<210> 88
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 88
cccaccttgc aggaaattgt attagttttt ctcttggaaa gaaagt 46
<210> 89
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 89
aacatcaact actagccaga cgggtttttc tcttggaaag aaagt 45
<210> 90
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 90
actgcagctg gtagtagaag cctttttctc ttggaaagaa agt 43
<210> 91
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 91
agaacggcca tacaaattgc cagatttttg aagttaccgt ttt 43
<210> 92
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 92
cctgtgcaca acgctggaca tttttctgag tcaaagcat 39
<210> 93
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 93
cctgtgtcta ttgcagacga cctttttgaa gttaccgttt t 41
<210> 94
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 94
actacagcaa accgaggtat atgaattttt tttctgagtc aaagcat 47
<210> 95
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 95
gcatttagtg atttatatgt agtatatagg gactttttga agttaccgtt tt 52
<210> 96
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 96
ggggaaccac tagctgcatg tttttctgag tcaaagcat 39
<210> 97
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 97
gagctacgat attactcgga ctcgtttttg aagttaccgt ttt 43
<210> 98
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 98
gtgtatgcaa ctacattaga aaatataact aatacttttt ctgagtcaaa gcat 54
<210> 99
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 99
aaagttatat aatttattaa taaggtgcat gtgttgtttt ttgaagttac cgtttt 56
<210> 100
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 100
ctgaaaccgc tgtgtccagc tttttctgag tcaaagcat 39
<210> 101
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 101
atttcataaa atagcaggaa gctatacagg tttttgaagt taccgtttt 49
<210> 102
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 102
acagtgtcga cggtgctgga tttttctgag tcaaagcat 39
<210> 103
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 103
agactaacac gaagagaaac ccaagttttt gaagttaccg tttt 44
<210> 104
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 104
tataacatca gatatgcgtg gaccaaagtt tttctgagtc aaagcat 47
<210> 105
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 105
atttatgtcc ttacaatgaa atacagccgt ttttgaagtt accgtttt 48
<210> 106
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 106
gttgaccttg tatgtcacga gcaatttttc tgagtcaaag cat 43
<210> 107
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 107
ttaggagagt cagaggatga aatagatgtt tttgaagtta ccgtttt 47
<210> 108
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 108
aacccgacca tgcagttaat cacctttttc tgagtcaaag cat 43
<210> 109
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 109
atgaaccaca gcgtcacaca atactttttg aagttaccgt ttt 43
<210> 110
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 110
agtgttcgtg ttgtaagtgt aacaacactt tttctgagtc aaagcat 47
<210> 111
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 111
tcacgggata ctctgcgaca actttttgaa gttaccgttt t 41
<210> 112
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 112
tacagcagct gtttatggac tcactttttc tgagtcaaag cat 43
<210> 113
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 113
taggatttgt gtgtccgtgg tgtg 24
<210> 114
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 114
atggcgcgct ttgacgatcc tttttctctt ggaaagaaag t 41
<210> 115
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 115
aacgcaacga ccctacaagc tactttttct cttggaaaga aagt 44
<210> 116
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 116
tatattgcaa agcaacattg gaacgcactt tttctcttgg aaagaaagt 49
<210> 117
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 117
agagacactg gaaaaaataa ctaatacaga gtttttctct tggaaagaaa gt 52
<210> 118
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 118
gcaagaaaga cttcgcagac gtagtttttc tcttggaaag aaagt 45
<210> 119
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 119
ggaaacacaa gtatagcaat aagtatgctt tttctcttgg aaagaaagt 49
<210> 120
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 120
agaggaggaa aacgatgaag cagatttttc tcttggaaag aaagt 45
<210> 121
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 121
cttacagtag agagctcggc agtttttctc ttggaaagaa agt 43
<210> 122
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 122
cagatttgtg cacagaattg aatacatctt tttgaagtta ccgtttt 47
<210> 123
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 123
actacaagac gtatctattg cctgtgtttt tctgagtcaa agcat 45
<210> 124
<211> 57
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 124
agaggtatat caatttgctt ttaaagattt atttatagtt tttgaagtta ccgtttt 57
<210> 125
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 125
tgtatagaga ctgtatagca tatgctgctt tttctgagtc aaagcat 47
<210> 126
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 126
atgccataaa tgtatagact tttattccag aattttttga agttaccgtt tt 52
<210> 127
<211> 55
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 127
tagagaatta agatattatt caaactctgt atatggtttt tctgagtcaa agcat 55
<210> 128
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 128
ttgtataatt tgttaataag gtgcctgcgt ttttgaagtt accgtttt 48
<210> 129
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 129
gtgccagaaa ccattgaacc cagtttttct gagtcaaagc at 42
<210> 130
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 130
cagaaaaacg tagacacctt aaggactttt tgaagttacc gtttt 45
<210> 131
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 131
aaacgaagat tccacagcat agctgttttt ctgagtcaaa gcat 44
<210> 132
<211> 38
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 132
ggcagtaccg agggcagtgt ttttgaagtt accgtttt 38
<210> 133
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 133
taatacatgt tgtgaccagg cacgtttttc tgagtcaaag cat 43
<210> 134
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 134
agaatgaatt agatcctgtt gacctgtttt tttgaagtta ccgtttt 47
<210> 135
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 135
gtgttacgag caattaagcg agtctttttc tgagtcaaag cat 43
<210> 136
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 136
acagcgtcac aaaattttgt gtgtatgttt tttgaagtta ccgtttt 47
<210> 137
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 137
tgtaagtgtg acggcagaat tgagtttttc tgagtcaaag cat 43
<210> 138
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 138
atgaccttag aacactacag cagctttttg aagttaccgt ttt 43
<210> 139
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 139
tgtttttgag caccttgtcc tttgtgtttt tctgagtcaa agcat 45
<210> 140
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 140
atggacccca ggcaacactg 20
<210> 141
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 141
caagaaattg tattgcattt ggaacctc 28
<210> 142
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 142
tggcgttagt catgcacaac tacc 24
<210> 143
<211> 18
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 143
agcccgacga gccgaacc 18
<210> 144
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 144
acagcgtcac aaaattttgt gtgtatgt 28
<210> 145
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 145
tgtaagtgtg acggcagaat tgag 24
<210> 146
<211> 22
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 146
tgtccgtggt gtgcaactaa cc 22
<210> 147
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 147
atgttcgaag acaatgttcg aagacaagtt tttctcttgg aaagaaagt 49
<210> 148
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 148
agggaaagac cacgaacgct gtttttctct tggaaagaaa gt 42
<210> 149
<211> 50
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 149
ggataataat ccatatgcag tatgcaaact ttttctcttg gaaagaaagt 50
<210> 150
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 150
aaagaccact tgggcctgaa gaaatttttc tcttggaaag aaagt 45
<210> 151
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 151
acggggcaat gcgctaattg ctttttctct tggaaagaaa gt 42
<210> 152
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 152
tagataatat gcgtgaccag ctaccttttt ctcttggaaa gaaagt 46
<210> 153
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 153
agaaagacgg gctggacagg tttttctctt ggaaagaaag t 41
<210> 154
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 154
catgaattat gtgaagcttt gaacgtttct ttttgaagtt accgtttt 48
<210> 155
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 155
tatgcacaat atacaggtag tgtgtgtgtt tttctgagtc aaagcat 47
<210> 156
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 156
tattgtaaaa aggaattatg tagagcagat gtatttttga agttaccgtt tt 52
<210> 157
<211> 57
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 157
tataatgtag catttactga aattaagatt gtatatagtt tttctgagtc aaagcat 57
<210> 158
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 158
aatgtttact gttttattca aaaattagag agtatagttt ttgaagttac cgtttt 56
<210> 159
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 159
acgttatagc aggtctgtgt atggtttttc tgagtcaaag cat 43
<210> 160
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 160
tactacatta gaggcaatta ctaaaaaaag ctttttttga agttaccgtt tt 52
<210> 161
<211> 51
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 161
atatgattta tcgataaggt gtcatagatg tctttttctg agtcaaagca t 51
<210> 162
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 162
agcaaaaatt ggtggacgaa aaaaaaaggt ttttgaagtt accgtttt 48
<210> 163
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 163
ttccatgaaa tagcgggacg ttggtttttc tgagtcaaag cat 43
<210> 164
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 164
tggcaacgta cacgacaacg taactttttg aagttaccgt ttt 43
<210> 165
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 165
gaaacccaag tgtaataaag ccatgctttt tctgagtcaa agcat 45
<210> 166
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 166
gtggtaatgt accacaatta aaagatgtag tttttgaagt taccgtttt 49
<210> 167
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 167
tattgcattt aacaccacag actgaaattg tttttctgag tcaaagcat 49
<210> 168
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 168
acttgcaatg ctacgagcaa tttgactttt tgaagttacc gtttt 45
<210> 169
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 169
agctcagagg aggaggatga agtttttctg agtcaaagca t 41
<210> 170
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 170
ctacgtgtta cagaattgaa gctccttttt gaagttaccg tttt 44
<210> 171
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 171
gtgttgcagg tgttcaagtg tagttttttc tgagtcaaag cat 43
<210> 172
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 172
cagatgttaa tgggcgaact gagctttttg aagttaccgt ttt 43
<210> 173
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 173
ctggtttgcc cgtgttgtgc tttttctgag tcaaagcat 39
<210> 174
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 174
acaactggca gtggaaagca gtg 23
<210> 175
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 175
gagacactct tcgcgttgta cag 23
<210> 176
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 176
ggtgcatgaa ataaggctgc agtgtttttc tcttggaaag aaagt 45
<210> 177
<211> 57
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 177
atttacgaat agtatataga gacaataatc catatgtttt tctcttggaa agaaagt 57
<210> 178
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 178
ggtaagaaaa ccattaagtg aaataactat tagtttttct cttggaaaga aagt 54
<210> 179
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 179
tgtgcagtgc aaaaaagagc tacaactttt tgaagttacc gtttt 45
<210> 180
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 180
gaagagaggt atacaagttt ctatttacag tttttctgag tcaaagcat 49
<210> 181
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 181
gcgtgtgtat tatgtgccta cgctttttga agttaccgtt tt 42
<210> 182
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 182
tttttatcta agataagtga atataggcat tatcaatttt ttctgagtca aagcat 56
<210> 183
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 183
gcgatttcat aatattatgg gtcgttggtt tttgaagtta ccgtttt 47
<210> 184
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 184
acagggcgct gttcagagtg tttttctgag tcaaagcat 39
<210> 185
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 185
cccaagtgta acgtcatgcg tgtttttgaa gttaccgttt t 41
<210> 186
<211> 55
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 186
gagacaaagc aactataaaa gattatatat tagatctttt tctgagtcaa agcat 55
<210> 187
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 187
tgcaacctga aacaactgac ctactttttg aagttaccgt ttt 43
<210> 188
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 188
actgctatga gcaattaggt gacagttttt ctgagtcaaa gcat 44
<210> 189
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 189
ctcagatgag gaggatacag atggtttttg aagttaccgt ttt 43
<210> 190
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 190
tgtggaccgg ccagatggac tttttctgag tcaaagcat 39
<210> 191
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 191
aagcagaaca agccacaagc aattactttt tgaagttacc gtttt 45
<210> 192
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 192
tacattgtga catattgtca cagttgtgtt tttctgagtc aaagcat 47
<210> 193
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 193
cactgcgacg gaccttcgta tttttgaagt taccgtttt 39
<210> 194
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 194
ctctacagca gatgctgttg ggtttttctg agtcaaagca t 41
<210> 195
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 195
atgtttgagg atccagcaac acga 24
<210> 196
<211> 16
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 196
ccccggaccc tgcacg 16
<210> 197
<211> 25
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 197
aattgtgtga ggtgctggaa gaatc 25
<210> 198
<211> 31
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 198
attcacttta tgggaaaaca ttagaagaga g 31
<210> 199
<211> 30
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 199
atgtataatt tgtcaaacgc cattatgtcc 30
<210> 200
<211> 33
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 200
tgaagaaaaa gaaagacatg ttaatgcaaa caa 33
<210> 201
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 201
ttggagaccc cgacctgtga 20
<210> 202
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 202
ctcagatgag gaggatacag atgg 24
<210> 203
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 203
tgtggaccgg ccagatggac 20
<210> 204
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 204
cacattacaa gttgtgtgcc ccg 23
<210> 205
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 205
aaaaaagaac taacacgtgc tgaggtattt tttctcttgg aaagaaagt 49
<210> 206
<211> 51
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 206
aacgctgcaa gaagttatat tagaactaac tttttctctt ggaaagaaag t 51
<210> 207
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 207
acctcaaaca gaaattgacc tacagtgttt ttctcttgga aagaaagt 48
<210> 208
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 208
agcaagctag acaagctaaa caacatactt tttctcttgg aaagaaagt 49
<210> 209
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 209
atggagccac aattcaacaa tccacttttt gaagttaccg tttt 44
<210> 210
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 210
aggaacgtcc acgaagcctg tttttctgag tcaaagcat 39
<210> 211
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 211
caccacttga gtgaggtatt agaaatactt tttgaagtta ccgtttt 47
<210> 212
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 212
ctttaattga tcttagatta tcatgtgtat attgcttttt ctgagtcaaa gcat 54
<210> 213
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 213
ataattttgc atgcactgaa ttaaaattag tgtatagttt ttgaagttac cgtttt 56
<210> 214
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 214
ggataatttt ccttatgcag tgtgcagttt ttctgagtca aagcat 46
<210> 215
<211> 59
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 215
agtatgttta ttgttttata gtaaagttag aaaatatagg tttttgaagt taccgtttt 59
<210> 216
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 216
tattatgact attcagtgta tggagctact ttttctgagt caaagcat 48
<210> 217
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 217
tgcattgtga cagaaaaaga cgatttcatt tttgaagtta ccgtttt 47
<210> 218
<211> 40
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 218
gtcatgtttg gggtgctgga gtttttctga gtcaaagcat 40
<210> 219
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 219
acaaacatct agagaaccta gagaatcttt tttgaagtta ccgtttt 47
<210> 220
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 220
acagtataat catgcatggt aaagtacctt tttctgagtc aaagcat 47
<210> 221
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 221
ggatgaggat gaggatgaag tagatttttg aagttaccgt ttt 43
<210> 222
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 222
ccatttgcag gagcggccac tttttctgag tcaaagcat 39
<210> 223
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 223
gtgttaccta atacacgtac cttgttgttt ttgaagttac cgtttt 46
<210> 224
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 224
tcagtgtaag tttgtggtgc agttgttttt ctgagtcaaa gcat 44
<210> 225
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 225
gacattcaga gtaccaaaga ggactttttg aagttaccgt ttt 43
<210> 226
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 226
ctgcgtgttg tacaacagct gctttttctg agtcaaagca t 41
<210> 227
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 227
ttatgggtgc gttaacagta acgtgttttt gaagttaccg tttt 44
<210> 228
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 228
cccactctgc gcatcaagta actttttctg agtcaaagca t 41
<210> 229
<211> 37
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 229
actagaaagt ataactaaaa aacagttatg tgattta 37
<210> 230
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 230
ttaataaggt gctacagatg tcaaagtc 28
<210> 231
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 231
cgttaactcc ggaggaaaag caat 24
<210> 232
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 232
tgcattgtga cagaaaaaga cgatttca 28
<210> 233
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 233
tctaatagca catggttgga ccgg 24
<210> 234
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 234
caatgagcaa ttggacagct caga 24
<210> 235
<211> 55
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 235
gtatatgact ttacatttgc agatttaaga atagtttttc tcttggaaag aaagt 55
<210> 236
<211> 51
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 236
gagacacatt agaacaaaca ctaaaaaagc tttttctctt ggaaagaaag t 51
<210> 237
<211> 51
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 237
aagaccattg tgtccacaag aaaaaaaaag tttttctctt ggaaagaaag t 51
<210> 238
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 238
agcacaaccg gccacagcta tttttctctt ggaaagaaag t 41
<210> 239
<211> 40
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 239
atgttccagg acgcagagga gtttttgaag ttaccgtttt 40
<210> 240
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 240
aaaccacgga cattgcatga tttgtgtttt tctgagtcaa agcat 45
<210> 241
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 241
catgaaatcg aattgaaatg cgttgaatgt ttttgaagtt accgtttt 48
<210> 242
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 242
caaaaagact ttgcagcgat ctgagttttt ctgagtcaaa gcat 44
<210> 243
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 243
atgtaaagtg tgtttacgat tgctatctaa aattttttga agttaccgtt tt 52
<210> 244
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 244
aagtgagtat agacattata attattcgct atatgttttt ctgagtcaaa gcat 54
<210> 245
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 245
cccgacgtag acaaacacaa gtgtttttga agttaccgtt tt 42
<210> 246
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 246
taacctgtaa caacgccatg agagtttttc tgagtcaaag cat 43
<210> 247
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 247
gaaacaaccc aacgctaaga gaatatattt tttgaagtta ccgtttt 47
<210> 248
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 248
tttagattta catcctgaac caactgactt tttctgagtc aaagcat 47
<210> 249
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 249
ctattctgct atgagcaatt atgtgacatt tttgaagtta ccgtttt 47
<210> 250
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 250
gctcagacga ggatgaaata ggctttttct gagtcaaagc at 42
<210> 251
<211> 50
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 251
attactacat tgtaacgtgt tgttacactt gtttttgaag ttaccgtttt 50
<210> 252
<211> 40
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 252
tgacgccacg gttcgtttgt gtttttctga gtcaaagcat 40
<210> 253
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 253
tatcaacagt acagcaactg aagtacgttt ttgaagttac cgtttt 46
<210> 254
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 254
aaccctacag cagctgctta tggtttttct gagtcaaagc at 42
<210> 255
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 255
gcacatgtac tattgtgtgc cctatttttg aagttaccgt ttt 43
<210> 256
<211> 22
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 256
tcaggcgttg gagacatctg tg 22
<210> 257
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 257
tgtatagaga tggaaatcca tttgcagt 28
<210> 258
<211> 37
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 258
gtttagagga aatattaatt agatgtatta tttgtca 37
<210> 259
<211> 33
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 259
gcatgtggat ttaaacaaaa ggtttcataa tat 33
<210> 260
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 260
ttcgggtcgt tggacagggc 20
<210> 261
<211> 21
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 261
gctgtgcagt gtgttggaga c 21
<210> 262
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 262
ttggacgggc cagatggaca 20
<210> 263
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 263
caaaggggaa ctgcaagaaa gagatttttc tcttggaaag aaagt 45
<210> 264
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 264
taagacagca acgacaagcg cgtttttctc ttggaaagaa agt 43
<210> 265
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 265
gaagttgacc ttgtgtgcta cgagtttttc tcttggaaag aaagt 45
<210> 266
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 266
caattacctg actccgactc cgtttttctc ttggaaagaa agt 43
<210> 267
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 267
agctgaacca cagcgtcaca actttttctc ttggaaagaa agt 43
<210> 268
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 268
atggcacgct ttgaggatcc tactttttga agttaccgtt tt 42
<210> 269
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 269
acaacgacca tacaaactgc ctgatttttc tgagtcaaag cat 43
<210> 270
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 270
cttgagcaca acattgaata ttcctctgtt tttgaagtta ccgtttt 47
<210> 271
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 271
catgatattc gcatcaattg tgtgttttgt ttttctgagt caaagcat 48
<210> 272
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 272
ggtatttgaa tttgctttta atgacttatt tatagtgttt ttgaagttac cgtttt 56
<210> 273
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 273
tatagagact gtacaccgta tgcagttttt ctgagtcaaa gcat 44
<210> 274
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 274
cgtgtctgaa atgcatttca ttttatgctt tttgaagtta ccgtttt 47
<210> 275
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 275
aagagtaaga gaattaagat attatagaga ttctgttttt ctgagtcaaa gcat 54
<210> 276
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 276
tgtatggaga aacattagag gctgaaactt tttgaagtta ccgtttt 47
<210> 277
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 277
caagacaccg ttacatgagc tgctttttct gagtcaaagc at 42
<210> 278
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 278
tgatacgctg ttatagatgc ctaaaacctt tttgaagtta ccgtttt 47
<210> 279
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 279
tctatgtcca acagacaaat taaagcatat aactttttct gagtcaaagc at 52
<210> 280
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 280
atatacagga cagtgtcgtg ggtgtttttg aagttaccgt ttt 43
<210> 281
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 281
tcggacccga gcaagacacc tttttctgag tcaaagcat 39
<210> 282
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 282
tagtgaaaca ctggtgtaaa acaatgcatt tttgaagtta ccgtttt 47
<210> 283
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 283
tggaccaaaa gcaacacttt gtgacttttt ctgagtcaaa gcat 44
<210> 284
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 284
agaatgaaaa agatgaacca gatggagttt tttgaagtta ccgtttt 47
<210> 285
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 285
taatcatcct ttgctactag ctagacgttt ttctgagtca aagcat 46
<210> 286
<211> 50
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 286
attgtgtgtg tgtgttgtaa gtgtaataat ctttttgaag ttaccgtttt 50
<210> 287
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 287
aacttcagct agtagtagaa acctcgtttt tctgagtcaa agcat 45
<210> 288
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 288
caagacggat tgcgagcctt actttttgaa gttaccgttt t 41
<210> 289
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 289
agcagctgtt tatggacgca ctattttttc tgagtcaaag cat 43
<210> 290
<211> 33
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 290
tgaaaaaaga agattccata atatagctgg aat 33
<210> 291
<211> 33
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 291
attgttttag atttggaacc acacaatttt gag 33
<210> 292
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 292
cctttgtgtg tcctttgtgt gcag 24
<210> 293
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 293
catctgagcg aggtattaca aatacctttt tctcttggaa agaaagt 47
<210> 294
<211> 58
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 294
acattagaaa gtataactaa aaaacagtta tctgattttt ttctcttgga aagaaagt 58
<210> 295
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 295
aagtagacaa gctacagaat ctacagtatt tttctcttgg aaagaaagt 49
<210> 296
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 296
cgcaaacgga aattgaccta caatgttttt ctcttggaaa gaaagt 46
<210> 297
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 297
gcaagctaga caagctgaac aacatttttc tcttggaaag aaagt 45
<210> 298
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 298
tgcccactct gcgcatcatc tttttctctt ggaaagaaag t 41
<210> 299
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 299
atggattcca tattcagcaa tacacaggtt tttgaagtta ccgtttt 47
<210> 300
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 300
aacgtccacg aagcctgcac tttttctgag tcaaagcat 39
<210> 301
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 301
tttacttgat cttagattat catgtgtata ctgtttttga agttaccgtt tt 52
<210> 302
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 302
caaaaaggaa cttacaagtt tagagttata tagtttttct gagtcaaagc at 52
<210> 303
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 303
gtttgcatgt attgagttaa aactagtata tagtttttga agttaccgtt tt 52
<210> 304
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 304
aaacaattgg ccatatgcag tatgtaggtt tttctgagtc aaagcat 47
<210> 305
<211> 57
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 305
gtatgtttat tgttttatag taaggttaga aaatatagtt tttgaagtta ccgtttt 57
<210> 306
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 306
gtactataaa tattcagtgt atggggcatt tttctgagtc aaagcat 47
<210> 307
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 307
attgcactgt gaacataaaa gacgatttct ttttgaagtt accgtttt 48
<210> 308
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 308
attatatagc atatgcatgg accgggtttt tctgagtcaa agcat 45
<210> 309
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 309
taaccatgca tggtaaagta ccaacgtttt tgaagttacc gtttt 45
<210> 310
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 310
ttgcaagagg ttatattaga acttgcactt tttctgagtc aaagcat 47
<210> 311
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 311
ggatgaggat gaggatgaaa tagacttttt gaagttaccg tttt 44
<210> 312
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 312
catttgctgg agcggccaca tttttctgag tcaaagcat 39
<210> 313
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 313
taagtgttac ctaattcacg taccttgttt tttgaagtta ccgtttt 47
<210> 314
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 314
tgtaagtgtg agttggtggt gcagtttttc tgagtcaaag cat 43
<210> 315
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 315
agctacgtgt ggtacaacag ctgtttttga agttaccgtt tt 42
<210> 316
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 316
cttatgggtg cgttaacagt aacgtttttc tgagtcaaag cat 43
<210> 317
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 317
tatcaataag gtgctaccga tgtcaatg 28
<210> 318
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 318
tccgttaaca ccggaggaaa aaca 24
<210> 319
<211> 26
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 319
tcatgtttgc agtgttggag acatac 26
<210> 320
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 320
caatgagcaa ttggacagct caga 24
<210> 321
<211> 25
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 321
ttggacattc agagtaccaa agagg 25
<210> 322
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 322
ggacattgga caccacattg catgtttttc tcttggaaag aaagt 45
<210> 323
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 323
gaatcggtgt atgcaacaac attagaaatt tttctcttgg aaagaaagt 49
<210> 324
<211> 58
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 324
ccataactaa tacaaagtta tatgatttat caataagttt ttctcttgga aagaaagt 58
<210> 325
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 325
cctaaattca aaacgaagat ttcataaaat agctttttct cttggaaaga aagt 54
<210> 326
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 326
ggcaggaaac acaagtttaa ctaactattt tttctcttgg aaagaaagt 49
<210> 327
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 327
atcaactact agccagacgg gactttttct cttggaaaga aagt 44
<210> 328
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 328
gaacaacagc gtcacacaat tcagtttttc tcttggaaag aaagt 45
<210> 329
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 329
gggagaacct gcggaagcta tttttctctt ggaaagaaag t 41
<210> 330
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 330
tcacaaccct gaggaacggc tttttgaagt taccgtttt 39
<210> 331
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 331
catacaaatt gccagacctg tgcatttttc tgagtcaaag cat 43
<210> 332
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 332
acgttacaat agactgtgtc tattgcagtt tttgaagtta ccgtttt 47
<210> 333
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 333
aaggcaacta caacggacag aggtttttct gagtcaaagc at 42
<210> 334
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 334
tatatgaatt tgcctttggt gacttaaatg tagtttttga agttaccgtt tt 52
<210> 335
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 335
tatataggga cggggtacca ttagtttttc tgagtcaaag cat 43
<210> 336
<211> 50
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 336
ctgcatgcca atcatgtatt aaattttatg ctttttgaag ttaccgtttt 50
<210> 337
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 337
gaaaatacgg gaactacgat attactcatt tttctgagtc aaagcat 47
<210> 338
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 338
gtgcatgtgt tgcctgaaac catttttttg aagttaccgt ttt 43
<210> 339
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 339
gagtcctgct gaaaaactaa ggcatttttc tgagtcaaag cat 43
<210> 340
<211> 40
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 340
ccactgctgg accagtaaac gtttttgaag ttaccgtttt 40
<210> 341
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 341
agaggaccgc agacgcacac tttttctgag tcaaagcat 39
<210> 342
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 342
atgcaatgaa atagagccgg ttgacttttt gaagttaccg tttt 44
<210> 343
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 343
cttgtatgtc acgagcaatt aggagttttt ctgagtcaaa gcat 44
<210> 344
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 344
attcagacga tgaaatagat gaacccgttt ttgaagttac cgtttt 46
<210> 345
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 345
accatgcagt taatcaccac caactttttc tgagtcaaag cat 43
<210> 346
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 346
tgtacgtgtt gtaagtgtaa caacctactt tttgaagtta ccgtttt 47
<210> 347
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 347
tgcaactagt agtagaagcg tcgctttttc tgagtcaaag cat 43
<210> 348
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 348
gaactgctgt ttatggactc actaaatttt tttgaagtta ccgtttt 47
<210> 349
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 349
ttgtgtgtcc gtggtgtgca actttttctg agtcaaagca t 41
<210> 350
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 350
aggaaacttt acaggacagt gtcg 24
<210> 351
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 351
gcatggacca aagcccaccg 20
<210> 352
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 352
tgcaggaaat tgtgttagag ttatgtcc 28
<210> 353
<211> 54
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 353
cttacagagg tatttgaatt tgcatttaaa gattttttct cttggaaaga aagt 54
<210> 354
<211> 60
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 354
atttttattc tagaattaga gaattaagac attattcagt ttttctcttg gaaagaaagt 60
<210> 355
<211> 40
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 355
aaggtgcctg cggtgccagt ttttctcttg gaaagaaagt 40
<210> 356
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 356
caacatagct gggcactata gaggtttttc tcttggaaag aaagt 45
<210> 357
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 357
ctccaacgac gcagagaaac actttttctc ttggaaagaa agt 43
<210> 358
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 358
atggcgcgct ttgaggatcc tttttgaagt taccgtttt 39
<210> 359
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 359
aacacggcga ccctacaagc tttttctgag tcaaagcat 39
<210> 360
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 360
tacctgatct gtgcacggaa ctgtttttga agttaccgtt tt 42
<210> 361
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 361
aacacttcac tgcaagacat agaaataact ttttctgagt caaagcat 48
<210> 362
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 362
ttatttgtgg tgtatagaga cagtatacct ttttgaagtt accgtttt 48
<210> 363
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 363
gcatgctgca tgccataaat gtatagtttt tctgagtcaa agcat 45
<210> 364
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 364
actctgtgta tggagacaca ttggtttttg aagttaccgt ttt 43
<210> 365
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 365
aaaaactaac taacactggg ttatacaatt tattaatttt ttctgagtca aagcat 56
<210> 366
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 366
aaaccgttga atccagcaga aaaacttatt tttgaagtta ccgtttt 47
<210> 367
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 367
gacaccttaa tgaaaaacga cgatttcatt tttctgagtc aaagcat 47
<210> 368
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 368
ccagtgccat tcgtgctgca tttttgaagt taccgtttt 39
<210> 369
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 369
accgagcacg acaggaacga tttttctgag tcaaagcat 39
<210> 370
<211> 51
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 370
aagtataata ttaagtatgc atggacctaa ggtttttgaa gttaccgttt t 51
<210> 371
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 371
caacattgca agacattgta ttgcatttag tttttctgag tcaaagcat 49
<210> 372
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 372
agccccaaaa tgaaattccg gttgtttttg aagttaccgt ttt 43
<210> 373
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 373
accttctatg tcacgagcaa ttaagctttt tctgagtcaa agcat 45
<210> 374
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 374
atggagttaa tcatcaacat ttaccagctt tttgaagtta ccgtttt 47
<210> 375
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 375
ccgacgagcc gaaccacaac tttttctgag tcaaagcat 39
<210> 376
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 376
gtcacacaat gttgtgtatg tgttgtaatt tttgaagtta ccgtttt 47
<210> 377
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 377
gtgtgaagcc agaattgagc tagttttttc tgagtcaaag cat 43
<210> 378
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 378
ttcgagcatt ccagcagctg tttctttttg aagttaccgt ttt 43
<210> 379
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 379
tgaacaccct gtcctttgtg tgtctttttc tgagtcaaag cat 43
<210> 380
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 380
ctgtgtatat tgcaagacag tattggaa 28
<210> 381
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 381
gactcagagg aagaaaacga tgaaatag 28
<210> 382
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 382
agtagaaagc tcagcagacg acc 23
<210> 383
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 383
cgtggtgtgc atcccagcag 20
<210> 384
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 384
ggagcgaccc agaaagttac ctttttctct tggaaagaaa gt 42
<210> 385
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 385
acagttatgc acagagctgc aaactttttc tcttggaaag aaagt 45
<210> 386
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 386
tggaacaaca ttagaacagc aatacaactt tttctcttgg aaagaaagt 49
<210> 387
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 387
tgaagaaaag caaagacatc tggacaaatt tttctcttgg aaagaaagt 49
<210> 388
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 388
tcttgttgca gatcatcaag aacacgtttt tctcttggaa agaaagt 47
<210> 389
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 389
tagagaaacc cagctgtaat catgcttttt ctcttggaaa gaaagt 46
<210> 390
<211> 51
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 390
aatattgtaa ccttttgttg caagtgtgac tttttctctt ggaaagaaag t 51
<210> 391
<211> 45
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 391
atgcaccaaa agatgcacca aaagagtttt tgaagttacc gtttt 45
<210> 392
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 392
aactgcaatg tttcaggacc cacatttttc tgagtcaaag cat 43
<210> 393
<211> 55
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 393
aactatacat gatataatat tagaatgtgt gtactgtttt tgaagttacc gtttt 55
<210> 394
<211> 42
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 394
caagcaacag ttactgcgac gtgtttttct gagtcaaagc at 42
<210> 395
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 395
aggtatatga ctttgctttt cgggattttt tttgaagtta ccgtttt 47
<210> 396
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 396
atgcatagta tatagagatg ggaatccatt tttctgagtc aaagcat 47
<210> 397
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 397
tatgctgtat gtgataaatg tttaaagttt tattctattt ttgaagttac cgtttt 56
<210> 398
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 398
aaattagtga gtatagacat tattgttata gtttgtattt ttctgagtca aagcat 56
<210> 399
<211> 48
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 399
aaaccgttgt gtgatttgtt aattaggtgt ttttgaagtt accgtttt 48
<210> 400
<211> 46
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 400
tattaactgt caaaagccac tgtgtccttt ttctgagtca aagcat 46
<210> 401
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 401
aagcaaagat tccataatat aaggggtctt tttgaagtta ccgtttt 47
<210> 402
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 402
ggtggaccgg tcgatgtatg tttttctgag tcaaagcat 39
<210> 403
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 403
atggagatac acctacattg catgaatatt tttgaagtta ccgtttt 47
<210> 404
<211> 47
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 404
tatgttagat ttgcaaccag agacaacttt tttctgagtc aaagcat 47
<210> 405
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 405
gatctctact gttatgagca attaaatgac tttttgaagt taccgtttt 49
<210> 406
<211> 43
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 406
agctcagagg aggaggatga aatatttttc tgagtcaaag cat 43
<210> 407
<211> 39
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 407
gatggtccag ctggacaagc tttttgaagt taccgtttt 39
<210> 408
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 408
agaaccggac agagcccatt actttttctg agtcaaagca t 41
<210> 409
<211> 41
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 409
tctacgcttc ggttgtgcgt actttttgaa gttaccgttt t 41
<210> 410
<211> 44
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 410
aaagcacaca cgtagacatt cgtacttttt ctgagtcaaa gcat 44
<210> 411
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 411
tttggaagac ctgttaatgg gcac 24
<210> 412
<211> 24
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 412
actaggaatt gtgtgcccca tctg 24
<210> 413
<211> 16
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 413
actttctttc caagag 16
<210> 414
<211> 534
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 414
atgctttgac tcagaggatc gtaagtaact aaggactacc aggatcgtaa gtaactaagg 60
actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa ggactaccag 120
gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc aggatcgtaa 180
gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa 240
ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc 300
aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt 360
aagtaactaa ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact 420
aaggactacc aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta 480
ccaggatcgt aagtaactaa ggactaccag gatcgtaagt aactaaggac tacc 534
<210> 415
<211> 534
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 415
aaaacggtaa cttcaggatc gtaagtaact aaggactacc aggatcgtaa gtaactaagg 60
actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa ggactaccag 120
gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc aggatcgtaa 180
gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa 240
ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc 300
aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt 360
aagtaactaa ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact 420
aaggactacc aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta 480
ccaggatcgt aagtaactaa ggactaccag gatcgtaagt aactaaggac tacc 534
<210> 416
<211> 466
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 416
ggtagtcctt agttacttac gatcctgaat ccattgaatc ctgtgattga atccattgaa 60
tcctgtgatt gaatccattg aatcctgtga ttgaatccat tgaatcctgt gattgaatcc 120
attgaatcct gtgattgaat ccattgaatc ctgtgattga atccattgaa tcctgtgatt 180
gaatccattg aatcctgtga ttgaatccat tgaatcctgt gattgaatcc attgaatcct 240
gtgattgaat ccattgaatc ctgtgattga atccattgaa tcctgtgatt gaatccattg 300
aatcctgtga ttgaatccat tgaatcctgt gattgaatcc attgaatcct gtgattgaat 360
ccattgaatc ctgtgattga atccattgaa tcctgtgatt gaatccattg aatcctgtga 420
ttgaatccat tgaatcctgt gattgaatcc attgaatcct gtgatt 466
<210> 417
<211> 22
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 417
aatcacagga ttcaatggat tc 22

Claims (10)

1. a kind of cervical carcinoma detection probe sequence, which is characterized in that including high-risk HPV 16,18,31,33,35,39,45,51, 52, the probe sequence of one or more of 56,58,59,66 and 68 types；Each high-risk HPV probe sequence by Capture extension probes, K-type label extension probes and closing probe three classes probe sequence composition；
Wherein, 31 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.1-6, the high-risk HPV 31 Type K-type marks extension probes as shown in SEQ ID No.7-20, and 31 type of the high-risk HPV closes probe such as SEQ ID Shown in No.21-27；
33 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.28-33,33 type K of the high-risk HPV For phenotypic marker extension probes as shown in SEQ ID No.34-49,33 type of the high-risk HPV closes probe such as SEQ ID No.50- Shown in 55；
35 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.56-62,35 type K of the high-risk HPV For phenotypic marker extension probes as shown in SEQ ID No.63-78,35 type of the high-risk HPV closes probe such as SEQ ID No.79- Shown in 82；
39 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.83-90,39 type K of the high-risk HPV For phenotypic marker extension probes as shown in SEQ ID No.91-112,39 type of the high-risk HPV closes probe such as SEQ ID No.113 It is shown；
45 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.114-121, the high-risk HPV 45 Type K-type marks extension probes as shown in SEQ ID No.122-139, and 45 type of the high-risk HPV closes probe such as SEQ ID Shown in No.140-146；
51 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.147-153, the high-risk HPV 51 Type K-type marks extension probes as shown in SEQ ID No.154-173, and 51 type of the high-risk HPV closes probe such as SEQ ID Shown in No.174-175；
52 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.176-178, the high-risk HPV 52 Type K-type marks extension probes as shown in SEQ ID No.179-194, and 52 type of the high-risk HPV closes probe such as SEQ ID Shown in No.195-204；
56 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.205-208, the high-risk HPV 56 Type K-type marks extension probes as shown in SEQ ID No.209-228, and 56 type of the high-risk HPV closes probe such as SEQ ID Shown in No.229-234；
58 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.235-238, the high-risk HPV 58 Type K-type marks extension probes as shown in SEQ ID No.239-255, and 58 type of the high-risk HPV closes probe such as SEQ ID Shown in No.256-262；
59 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.263-267, the high-risk HPV 59 Type K-type marks extension probes as shown in SEQ ID No.268-289, and 59 type of the high-risk HPV closes probe such as SEQ ID Shown in No.290-292；
66 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.293-298, the high-risk HPV 66 Type K-type marks extension probes as shown in SEQ ID No.299-316, and 66 type of the high-risk HPV closes probe such as SEQ ID Shown in No.317-321；
68 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.322-329, the high-risk HPV 68 Type K-type marks extension probes as shown in SEQ ID No.330-349, and 68 type of the high-risk HPV closes probe such as SEQ ID Shown in No.350-352；
18 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.353-357, the high-risk HPV 18 Type K-type marks extension probes as shown in SEQ ID No.358-379, and 18 type of the high-risk HPV closes probe such as SEQ ID Shown in No.380-383；
16 type of the high-risk HPV captures extension probes sequence as shown in SEQ ID No.384-390, the high-risk HPV 16 Type K-type marks extension probes as shown in SEQ ID No.391-410, and 16 type of the high-risk HPV closes probe such as SEQ ID Shown in No.411-412.
2. probe sequence described in claim 1 is preparing the application in detecting cervical carcinoma kit.
3. a kind of kit of detection cervical carcinoma, which is characterized in that including probe sequence described in claim 1.
4. kit according to claim 3, which is characterized in that further include signal amplification precursor, signal amplification body, alkaline phosphorus Reporter probe, chemiluminescent substrate and the coupling of sour enzyme (AP) label have one or both of carrier of general probe with On；
Wherein, the general probe and the partial sequence complementarity of capture extension probes described in claim 1 match；
The signal amplification precursor includes that the preposition guiding region sequence of amplification precursor and the preposition boot section of repeated amplification body are mutual Complementary series；
The signal, which is put, generallys include the amplification preposition guiding region sequence of body and repeated reporter probe complementary series；
The preposition guiding region sequence of amplification precursor is matched with the label extension probes partial sequence complementarity of K-type described in claim 1 It is right；
The preposition guiding region sequence of amplification body and the repeated preposition boot section complementary series complementary pairing of amplification body；
The reporter probe of the alkali phosphatase enzyme mark is mutually recruited with the repeated reporter probe duplicate block complementary series It is right.
5. kit according to claim 4, which is characterized in that the carrier is magnetic bead or tissue culture plate.
6. to go 4 kits according to right, which is characterized in that the sequence of the general probe such as SEQ ID No.413 institutes Show.
7. kit according to claim 4, which is characterized in that the chemiluminescent substrate is adamantane derivative.
8. kit according to claim 4, which is characterized in that described be repeated several times is 20 repetitions.
9. kit according to claim 4, which is characterized in that the general probe prolongs with capture described in claim 1 The partial sequence complementarity pairing of probe is stretched, wherein the partial sequence is 3 ' ends of capture extension probes described in claim 1 To the 16bp sequences in 5 ' directions.
10. kit according to claim 4, which is characterized in that the preposition guiding region sequence of amplification precursor is wanted with right The label extension probes partial sequence complementarity pairing of K-type described in 1 is asked, wherein the partial sequence is K-type described in claim 1 Mark the 14bp sequences in 3 ' end to 5 ' directions of extension probes.
CN201810763465.0A 2018-07-12 2018-07-12 Cervical cancer detection probe sequence and application thereof Active CN108796134B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810763465.0A CN108796134B (en) 2018-07-12 2018-07-12 Cervical cancer detection probe sequence and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810763465.0A CN108796134B (en) 2018-07-12 2018-07-12 Cervical cancer detection probe sequence and application thereof

Publications (2)

Publication Number Publication Date
CN108796134A true CN108796134A (en) 2018-11-13
CN108796134B CN108796134B (en) 2021-09-10

Family

ID=64076263

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810763465.0A Active CN108796134B (en) 2018-07-12 2018-07-12 Cervical cancer detection probe sequence and application thereof

Country Status (1)

Country Link
CN (1) CN108796134B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109456886A (en) * 2018-12-12 2019-03-12 郑州科蒂亚生物技术有限公司 A kind of full-automatic nucleic acid signal amplification detection automatic work station
CN109943665A (en) * 2019-04-15 2019-06-28 郑州科蒂亚生物技术有限公司 A kind of probe sequence and its kit, application detected for detecting head and neck scale carcinoma oncogene
CN110592279A (en) * 2019-09-11 2019-12-20 圣湘生物科技股份有限公司 Compositions, kits and methods for detecting HPV
CN110938712A (en) * 2019-12-27 2020-03-31 苏州药明检测检验有限责任公司 Primer, probe, kit and method for detecting human papilloma virus based on real-time fluorescent quantitative PCR technology

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010129941A1 (en) * 2009-05-08 2010-11-11 Becton, Dickinson And Company Correlation of hpv e6 and e7 expression with progression of cervical disease
CN103114132A (en) * 2012-12-20 2013-05-22 张鹭鹭 Primer probe and kit for detecting oncogene of cervical cancer and detection method for non-detection disease purpose
CN105861669A (en) * 2016-04-22 2016-08-17 科蒂亚(新乡)生物技术有限公司 Amplificatory detection method for quickly capturing branched-chain DNA (Deoxyribonucleic Acid) signal of hybrid target substance
CN105886501A (en) * 2016-04-26 2016-08-24 科蒂亚(新乡)生物技术有限公司 Nucleic acid signal amplification sequence and method
US9512471B2 (en) * 2010-06-30 2016-12-06 Diacarta Inc Methods and kits for detecting human papillomavirus
CN106701984A (en) * 2017-02-07 2017-05-24 华南师范大学 Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010129941A1 (en) * 2009-05-08 2010-11-11 Becton, Dickinson And Company Correlation of hpv e6 and e7 expression with progression of cervical disease
US9512471B2 (en) * 2010-06-30 2016-12-06 Diacarta Inc Methods and kits for detecting human papillomavirus
CN103114132A (en) * 2012-12-20 2013-05-22 张鹭鹭 Primer probe and kit for detecting oncogene of cervical cancer and detection method for non-detection disease purpose
CN105861669A (en) * 2016-04-22 2016-08-17 科蒂亚(新乡)生物技术有限公司 Amplificatory detection method for quickly capturing branched-chain DNA (Deoxyribonucleic Acid) signal of hybrid target substance
CN105886501A (en) * 2016-04-26 2016-08-24 科蒂亚(新乡)生物技术有限公司 Nucleic acid signal amplification sequence and method
CN106701984A (en) * 2017-02-07 2017-05-24 华南师范大学 Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KARIN HOPPE-SEYLER ET AL.: ""The HPV E6/E7 Oncogenes:Key Factors for Viral Carcinogenesis and Therapeutic Targets "", 《TRENDS IN MICROBIOLOGY》 *
尚乐乐等: ""人乳头状瘤病毒核酸检测试剂盒用于宫颈癌及癌前病变筛查的临床价值"", 《实用临床医药杂志》 *
王少蕾等: ""人乳头瘤病毒E6/E7 mRNA bDNA检测在宫颈疾病筛查中的应用"", 《医学理论与实践》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109456886A (en) * 2018-12-12 2019-03-12 郑州科蒂亚生物技术有限公司 A kind of full-automatic nucleic acid signal amplification detection automatic work station
CN109943665A (en) * 2019-04-15 2019-06-28 郑州科蒂亚生物技术有限公司 A kind of probe sequence and its kit, application detected for detecting head and neck scale carcinoma oncogene
CN109943665B (en) * 2019-04-15 2023-05-16 郑州科蒂亚生物技术有限公司 Probe sequence for detecting head and neck squamous carcinoma oncogene, kit and application thereof
CN110592279A (en) * 2019-09-11 2019-12-20 圣湘生物科技股份有限公司 Compositions, kits and methods for detecting HPV
CN110938712A (en) * 2019-12-27 2020-03-31 苏州药明检测检验有限责任公司 Primer, probe, kit and method for detecting human papilloma virus based on real-time fluorescent quantitative PCR technology

Also Published As

Publication number Publication date
CN108796134B (en) 2021-09-10

Similar Documents

Publication Publication Date Title
CN108796134A (en) A kind of cervical carcinoma detection probe sequence and its application
Woodman et al. The natural history of cervical HPV infection: unresolved issues
PT1463839E (en) Method for detecting human papillomavirus mrna
Chang et al. Current status of biomarkers in head and neck cancer
KR20070105992A (en) Systems, methods, and compositions for detection of human papilloma virus in biological samples
Williams et al. Molecular detection methods in HPV-related cancers
US10465254B2 (en) Method for detecting and typing high-risk human papillomaviruses
CN103210091A (en) DNA chip for genotyping of human papilloma virus, kit having same, and method for genotyping
CN107043828A (en) A kind of Detection of high risk human papillomavirus genotyping detection method and kit
Papadopoulou et al. Detection of human papillomaviruses in squamous cell carcinomas of the lung
Jacquin et al. Methylation of human papillomavirus type 16 CpG sites at E2-binding site 1 (E2BS1), E2BS2, and the Sp1-binding site in cervical cancer samples as determined by high-resolution melting analysis–PCR
AU2006314297B2 (en) Method of detecting pathogens
CN104884638A (en) Compositions and methods for detecting human papillomavirus nucleic acid
Li et al. Human papilloma virus and female lung adenocarcinoma
SA110310331B1 (en) A Method for Detection of Human Papillomavirus (HPV) Type
CN106048081A (en) HPV (human papilloma virus) typing detection primers as well as detection method and application thereof
CN108546785A (en) The method for detecting genital tract pathogenic microorganism DNA
JPS62248492A (en) Invitro diagnosis of papilloma virus probe and visus infection
CN112575123A (en) Primer combination, probe combination and human papilloma virus nucleic acid detection kit
US8883414B2 (en) Methods for detecting human papilloma virus-associated cancers
CN112391495A (en) High-risk human papilloma virus typing detection method and kit
Mammas et al. Geographic variations of human papilloma virus infection and their possible impact on the effectiveness of the vaccination programme
Ludwig et al. Human papillomavirus in tissue of bladder and bladder carcinoma specimens
CN108504738A (en) A kind of prostate cancer detection probe sequence and its application
Lorincz et al. Developing and standardizing human papillomavirus tests

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Li Xiankun

Inventor after: Li Xin

Inventor after: Meng Ge

Inventor after: He Li

Inventor after: Guo Shuguang

Inventor after: Su Qin

Inventor before: Zhang Lulu

Inventor before: Guo Shuguang

Inventor before: Su Qin

Inventor before: Li Xiankun

Inventor before: Tian Xiaoqiang

Inventor before: Xu Wenru

Inventor before: Li Xin

Inventor before: Li Xiaolei

Inventor before: Meng Ge

Inventor before: He Li

Inventor before: Han Ran

GR01 Patent grant
GR01 Patent grant