CN108776221B - Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody - Google Patents
Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody Download PDFInfo
- Publication number
- CN108776221B CN108776221B CN201810575209.9A CN201810575209A CN108776221B CN 108776221 B CN108776221 B CN 108776221B CN 201810575209 A CN201810575209 A CN 201810575209A CN 108776221 B CN108776221 B CN 108776221B
- Authority
- CN
- China
- Prior art keywords
- antibody
- protein
- groe
- serum
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56916—Enterobacteria, e.g. shigella, salmonella, klebsiella, serratia
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/24—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- G01N2333/255—Salmonella (G)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/465—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates from birds
Abstract
The invention relates to the field of biotechnology, in particular to a kit for simultaneously detecting an avian leukemia virus antibody and a salmonella pullorum disease antibody, wherein the antigen combination of the kit comprises p27 protein, gp85 protein and GroE L-delta 8-1 protein, and an E L ISA kit capable of simultaneously detecting the avian leukemia virus and the salmonella pullorum disease antibody is developed by using prokaryotic expression proteins of an avian leukemia virus capsid protein p27, a cyst membrane protein gp85 and a truncation GroE L-delta 8-1 prokaryotic expression protein of a salmonella pullorum disease dominant antigen GroE L as coating antigens.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum disease antibody.
Background
Avian leukemia (Avian L eukosis) is a collective term for a variety of neoplastic diseases in birds caused by viruses in the group of Avian leukemia Virus (Avian L eukosis Virus, A L V) and Avian sarcoidosis Virus (Avian Sarcoma Virus, ASV). The disease can cause a wide variety of benign and malignant tumors with infectivity in chickens.
Since the report of chicken lymphosarcoma by Roloff in 1868, avian leukemia has been distributed around the world, and natural cases occur in China. The disease can cause the weight of the chicken to slowly increase, the sexual maturity is delayed, the egg is small, the eggshell is thin, the egg yield is reduced, the fertility rate and the hatching rate are low, the carcass waste rate is increased, the death rate is increased, and the like, thereby causing direct economic loss. Meanwhile, the non-specific resistance of the organism is reduced and the immunity is inhibited, thereby causing indirect economic loss. The disease can be vertically spread, so the disease has great harm to the poultry industry and is one of the main diseases harming the chicken industry.
Pullorum Disease (Pullorum Disease) is caused by Salmonella Pullorum (SP), and is mainly characterized by the white feces excretion and egg production reduction of chicks, which can cause acute infectious diseases of poultry with septic typhoid fever in chickens of each day before parturition.
The spreading mode of the salmonella pullorum is diverse, not only can be horizontally spread through feed, air, drinking water, mice and the like, but also can be vertically spread through producing bacteria-carrying eggs, a large amount of pathogenic bacteria carried in hatched brood villi can pollute drinking water, brooding devices, feed and the like, broods in the same chicken coop are infected through digestive tracts, respiratory tracts and the like, and after the chicks are grown up, the bacteria-carrying eggs are discharged, so that a complex spreading network is formed. The salmonella pullorum is high in infection rate and wide in distribution in China, is the key point for breeding and purifying breeding poultry and is also the key disease for preventing and treating the breeding of commercial laying hens.
The most effective measure for controlling the avian leukemia and the pullorum disease at present is to purify the infectious disease, and the method is mainly to quarantine breeding hens regularly, eliminate positive chickens and breed the hens without the avian leukemia and the pullorum disease through continuous purification.
The gene p27 of the avian leukosis virus is a section of highly conserved gene among different subgroups of the avian leukosis virus, the encoded p27 protein is a main component of the virus core shell, the content of the protein is high, accounts for more than 30% of the total protein component of the virus, and can induce an organism to generate a specific antibody, the gene gp85 of the avian leukosis virus is a membrane protein of the avian leukosis virus, and can induce the organism to generate the specific antibody, the Heat-shock protein 60(GroE L) is an important protein antigen of the salmonella pullorum, and can induce to generate a large amount of antibodies when the salmonella pullorum invades the organism, therefore, the p27, the gp85 and the GroE L can be used as coating antigens to establish an indirect E L ISA detection kit for detecting the avian leukosis and the antibody pullorum.
TABLE 1 avian leukosis and pullorum disease assay kit statistics
At present, the purification of the avian leukemia is mainly to detect the avian leukemia virus antigen p27 of chicken cloaca swab and the avian leukemia virus antibody of chicken serum by using a foreign E L ISA kit, and the purification of the chicken white dysentery is mainly to detect the salmonella pullorum antibody of the chicken serum by using a plate agglutination test.
The poultry leukemia and pullorum disease are infectious diseases to be purified in chicken farms, the poultry leukemia is mainly purified by detecting an avian leukemia virus antigen p27 of a chicken cloaca swab and an avian leukemia antibody of chicken serum by using a foreign E L ISA kit at present, the pullorum disease is mainly purified by detecting a salmonella pullorum disease antibody of the chicken serum by using a plate agglutination test, the kits or methods are all used for detecting single infectious diseases, and no single kit is available for detecting the two diseases of the poultry leukemia and the pullorum disease.
Disclosure of Invention
In view of this, the invention provides a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum antibody. The kit can simultaneously detect the avian leukemia and the pullorum disease.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an antigen combination, which comprises p27 protein, gp85 protein and GroE L-delta 8-1 protein.
In some embodiments of the invention, the total concentration of the p27 protein, gp85 protein and GroE L-delta 8-1 protein in the antigen combination is (1-8) mu g/m L and the mass ratio is (0.5-1): 1.
In some embodiments of the invention, the total concentration of the p27 protein, gp85 protein and GroE L-delta 8-1 protein in the antigen combination is (1-4) mu g/m L and the mass ratio is 1:1 (0.25-4).
On the basis, the invention also provides application of the antigen combination in preparing a kit for detecting avian leukemia and/or pullorum disease.
The invention also provides a kit, and the kit coats the antigen combination.
In some embodiments of the invention, the kit further comprises serum, a primary antibody, an enzyme-labeled secondary antibody, a coating buffer, a washing buffer, a blocking solution, a dilution of the sample or the secondary antibody, a developing solution and a stop solution.
The invention also provides a using method of the kit, wherein the dilution of the serum is 1 (100-400), and preferably the dilution of the serum is 1: 200; the dilution of the enzyme-labeled secondary antibody is 1: (4000-16000), preferably, the enzyme-labeled secondary antibody dilution is 1: 8000.
in some embodiments of the invention, the blocking conditions of the blocking solution are 5% skim milk blocked for 2h at 37 ℃.
In some embodiments of the present invention, the primary antibody is incubated at 37 ℃ for 45-90 min, preferably at 37 ℃ for 60 min; the incubation condition of the enzyme-labeled secondary antibody is incubation at 37 ℃ (45-90) min, and preferably, the incubation condition of the enzyme-labeled secondary antibody is incubation at 37 ℃ for 45 min.
In some embodiments of the present invention, the developing time of the developing solution is (5-15) min, and preferably, the developing time of the developing solution is 10 min.
The invention combines the current situation that the avian leukemia and the pullorum disease need to be purified simultaneously, utilizes the basic principle of E L ISA, uses prokaryotic expression protein of avian leukemia virus capsid protein p27 and envelope protein gp85 and prokaryotic expression protein of truncation GroE L-delta 8-1 of the salmonella pullorum dominant antigen GroE L as coating antigen to develop an E L ISA kit capable of detecting the avian leukemia and the pullorum disease simultaneously, optimizes the reaction conditions of E L ISA by searching the optimal p27, gp85 and GroE L-delta 8-1 coating conditions to establish an indirect E L ISA method for detecting the avian leukemia and the pullorum disease.
Detailed Description
The invention discloses a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum antibody, and a person skilled in the art can realize the detection by appropriately improving process parameters by referring to the contents. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
1. The research method comprises the following steps:
according to the current situation that a chicken farm needs to purify avian leukemia and pullorum disease, and no kit or method capable of simultaneously detecting avian leukemia and pullorum disease exists at present, by utilizing the basic principle of E L ISA, an indirect E L ISA new method for detecting antibodies of avian leukemia virus and pullorum disease by taking avian leukemia virus capsid protein p27, envelope protein gp85 and pullorum disease salmonella dominant antigen GroE L-delta 8-1 as common envelope antigens is established.
2. Optimal condition operation method of determined indirect E L ISA detection method
(1) Antigen coating, namely diluting the antigen by coating liquid with pH9.6, wherein the total coating concentration is 4 mu g/m L, the GroE L-delta 8-1: p27+ gp85 is 1:2, namely GroE L-delta 8-1: p27: gp85 is 1:1:1, adding the diluted antigen into a 96-well enzyme label plate, coating the diluted antigen at 100 mu L/well and at 4 ℃ overnight.
(2) Washing PBST washing plate, 300 u L/hole, patting dry, washing three times.
(3) And (3) sealing, namely adding 5% of skim milk into the enzyme label plate, sealing at the temperature of 37 ℃ for 2h at the concentration of 200 mu L per hole.
(4) Washing: and (4) repeating the step (2).
(5) Antigen-antibody reaction, serum was diluted to 1:200 with 0.5% BSA, added to an ELISA plate at 100. mu. L/well, and incubated at 37 ℃ for 60 min.
(6) Washing: and (4) repeating the step (2).
(7) Enzyme-labeled antibody reaction, namely diluting HRP-labeled rabbit anti-chicken IgG mother liquor with 0.5% BSA to 1:8000, adding the diluted solution into an enzyme-labeled plate, incubating the solution at the temperature of 37 ℃ for 45min at the concentration of 100 mu L/hole.
(8) Washing: and (4) repeating the step (2).
(9) Color development, adding TMB color development liquid into the ELISA plate at 100 mu L per hole.
(10) And (3) terminating, wherein the reaction is terminated by developing the solution for 10min at room temperature and adding 50 mu L of termination solution into each hole.
(11) Reading: the microplate reader is started to preheat 1 minute ahead, parameters of the microplate reader (reference wavelength: 620nm, measurement wavelength: 450nm, vibration 3s and interval 2s) are set, and the OD450nm value is read.
(12) Judging that the detected serum contains one or two of avian leukemia virus antibody or salmonella pullorum antibody when the OD450nm value of the detected serum is larger than a negative and positive critical value (the mean value of the standard negative sample and the standard deviation of the standard negative sample of 3 ×).
Optimal coating conditions for p27+ gp85 and GroE L-. DELTA.8-1:
the enzyme-labeled plate is coated by p27+ gp85 and GroE L-delta 8-1 antigen coating combinations according to different total coating concentrations and different coating ratios, each antigen coating combination respectively uses poultry leukemia positive serum and pullorum disease positive serum diluted by times as primary antibodies, the other operations are carried out according to the conventional operation of E L ISA, the serum titer is detected, the efficacy value of each antigen coating combination for detecting the poultry leukemia positive serum and pullorum disease positive serum is calculated, the antigen coating combination with higher efficacy value of the two types of serum is taken as the optimal antigen coating condition, for example, as shown in tables 2 and 3, the result shows that the two antigen coating combinations are better, the combined efficacy value selects the antigen coating total concentration to be 4 mu g/m L and GroE L-delta 8-1: p27+ gp85 to be 1:2, namely, GroE L-delta 8-1: p27: gp85 is 1:1: 361 as the optimal antigen coating condition.
4. And (3) detecting artificial mixed pullorum disease positive serum and avian leukemia positive serum samples:
the chicken white diarrhea positive serum and the poultry leukemia positive serum are respectively mixed according to different proportions, and then the optimized detection method of the chicken white diarrhea salmonella antibody E L ISA, the detection method of the poultry leukemia virus antibody E L ISA and the co-detection method of the chicken white diarrhea salmonella antibody and the poultry leukemia virus antibody E L ISA are used for detecting the titer of different mixed sera, the result is consistent with the expected result, for example, in table 14, the titer of the serum detected by the single-detection E L ISA method is continuously increased along with the increase of the proportion of the corresponding positive sera, and the titer of the serum detected by the co-detection E L ISA method has no obvious change, which shows that the established co-detection method of the chicken white diarrhea salmonella antibody and the poultry leukemia virus antibody E L ISA can well detect the two diseases.
5. Detection of chicken serum samples in infection experiments:
the optimized detection method of the self-constructed salmonella pullorum antibody E L ISA (coated by GroE L-delta 8-1), the detection method of the self-constructed salmonella pullorum virus antibody E L ISA (coated by p27+ gp 85), the detection method of the self-constructed salmonella pullorum antibody and the avian leukemia virus antibody E L ISA (coated by GroE L2-delta 8-1 and p27+ gp 85), the detection kit for the A L V A/B subgroup and the J antibody subgroup produced by IDEXX, and the agglutination test of pullorum plates 104 for infection experiments, such as Table 16 and Table 17, result that the detection kit for the A L4V A/B subgroup and the J subgroup antibody of IDEXX and the detection method for the self-constructed avian leukemia virus antibody E L construction ISA detection kit for the pullorum test reach 90.4%, and the detection kit for the pullorum test and the detection kit for the self-constructed salmonella pullorum virus antibody E2 reach 90.4% and the detection kit for the detection method for the independent detection of the Δ ISA L and the detection method for the detection of the Δ L and the agglutination test of the Δ 3672.7 and the detection kit for the detection method for the indirect detection of the agglutination of the avian pullorum infection of the avian pullorum virus antibody.
The results in Table 19 show that, by taking the A L V A/B subgroup and J subgroup antibody detection kit/pullorum disease plate agglutination test of IDEXX as reference, the positive coincidence rate of the self-constructed pullorum disease salmonella antibody and avian leukemia virus antibody E L ISA co-detection method is 85.4%, and the negative coincidence rate is 88.9%, which indicates that the sensitivity and specificity of the established E L ISA method are good.
In the research, prokaryotic expression protein of avian leukosis virus capsid protein p27, envelope protein gp85 gene and prokaryotic expression protein of gene GroE L-delta 8-1 of a truncation of a chicken salmonella pullorum dominant antigen GroE L are used as coating antigens to establish an E L ISA kit for detecting avian leukosis and chicken pullorum disease, other methods for simultaneously detecting avian leukosis and chicken pullorum disease can be used for establishing an E L ISA kit by using other chicken salmonella dominant antigens and poultry leukosis antigens as common coating antigens, but the effectiveness of other antigens is uncertain, a colloidal gold kit for detecting avian leukosis and chicken pullorum disease is established by using p27, gp85 and GroE L-delta 8-1 as common antigens, but the method is not suitable for detection of a large number of samples, and the sensitivity is not good, E L, ISA is not good, and if the fusion method of fusion gene GroE dominant antigen GroE L gene, leukemia virus p 63 27 and gp85 gene is used for connecting the three genes together by a PCR method, and the fusion method for establishing a fusion gene expression of fusion protein of fusion of the chicken pullorum disease virus gp 6329, the fusion protein of fusion protein and the fusion protein of fusion construction of chicken pullorum disease, the fusion protein is probably used for detecting avian pullorum disease, the fusion of fusion protein and the fusion protein construction of fusion protein of fusion.
The invention constructs a p27 recombinant prokaryotic expression vector according to a p27 gene of avian leukemia virus, constructs a gp85 recombinant prokaryotic expression vector according to a gp85 gene, uses IPTG to induce and express fusion p27 protein and gp85 protein, and uses nickel column to purify p27 protein and gp85 protein, uses the purified p27 protein, gp85 protein and GroE L-delta 8-1 protein as coating antigens, establishes a method for detecting avian leukemia virus antibody and pullorum disease salmonella antibody by searching optimal coating conditions, sealing conditions, serum dilution ratio and action time, secondary antibody dilution, action time and color development time, and verifies the effectiveness of the established method.
The invention combines the current situation that the avian leukemia and the pullorum disease need to be purified simultaneously, utilizes the basic principle of E L ISA, uses prokaryotic expression proteins of avian leukemia virus capsid protein p27 and envelope protein gp85 and prokaryotic expression protein of a truncation GroE L-delta 8-1 of a pullorum disease dominant antigen GroE L as coating antigens to develop an E L ISA kit capable of simultaneously detecting the avian leukemia and the pullorum disease.
E L ISA immunoassay related reagent:
1. reagent preparation:
coating buffer (ph 9.60.05m carbonate buffer):
washing buffer (ph7.4 pbst):
| reagent | Dosage of |
| KH2PO4 | 0.2g |
| Na2HPO4·12H2O | 2.9g |
| NaCl | 8.0g |
| KCl | 0.2g |
| Tween-20 | 0.5mL |
| Distilled water | 1000mL |
Sealing liquid:
| reagent | Dosage of |
| Skimmed milk | 5g |
| Washing buffer | 100mL |
Sample and secondary antibody dilutions (0.5% BSA):
| reagent | Dosage of |
| Bovine Serum Albumin (BSA) | 0.5g |
| Washing buffer | 100mL |
Stop solution (2M H)2SO4) Is arranged in a cell
| Reagent | Dosage of |
| Concentrated sulfuric acid | 22mL |
| Water (W) | 178mL |
Conventional E L ISA experimental methods:
(1) antigen coating, pH9.6 coating solution to dilute the coating protein to the required concentration, adding to 96-well enzyme label plate, 100 u L/well, and coating overnight at 4 ℃.
(2) Washing PBST washing plate, 300 u L/hole, patting dry, washing three times.
(3) And (3) sealing, namely adding 5% of skim milk into the enzyme label plate, sealing at the temperature of 37 ℃ for 2h at the concentration of 200 mu L per hole.
(4) Washing: and (4) repeating the step (2).
(5) Antigen-antibody reaction, serum is diluted 1:200 with 0.5% BSA, added to an ELISA plate, incubated at 100. mu. L/well and incubated at 37 ℃ for 1 h.
(6) Washing: and (4) repeating the step (2).
(7) Enzyme-labeled antibody reaction, namely diluting HRP-labeled rabbit anti-chicken IgG mother liquor with 0.5% BSA to 1:8000, adding the diluted solution into an enzyme-labeled plate, incubating the solution at the temperature of 37 ℃ for 1h at the concentration of 100 mu L/hole.
(8) Washing: and (4) repeating the step (2).
(9) Color development, adding TMB color development liquid into the ELISA plate at 100 mu L per hole.
(10) And (3) terminating, wherein the reaction is terminated by developing the solution for 10min at room temperature and adding 50 mu L of termination solution into each hole.
(11) Reading: the microplate reader is started to preheat 1 minute ahead, parameters of the microplate reader (reference wavelength: 620nm, measurement wavelength: 450nm, vibration 3s and interval 2s) are set, and the OD450nm value is read.
The raw materials and reagents used in the kit for simultaneously detecting the avian leukosis virus antibody and the salmonella pullorum antibody provided by the invention are all available in the market.
The invention is further illustrated by the following examples:
example 1 preparation of p27 protein, gp85 protein and GroE L-. DELTA.8-1 protein
(1) Avian leukosis virus p27 prokaryotic expression vector construction and protein expression purification
Designing a specific primer with an enzyme cutting site according to the sequence of p27 gene in the complete sequence (M37980) of the avian leukemia virus gene registered in Genbank: an upstream primer (shown as SEQ ID No. 1) CGGGATCCATGCCTGTAGTGATTAAGAC and a downstream primer (shown as SEQ ID No. 2) CGCTCGAGCTAGGGCTGGATAGCAGACG. The p27 gene fragment was amplified by PCR, and the p27 gene was inserted into pET-30a prokaryotic expression vector by enzymatic ligation. The correctly sequenced pET-30a-p27 was transformed into Transetta (DE 3). pET-30a-p27/Transetta (DE3) was shake-cultured at 37 ℃ to OD6000.6 to 0.8, adding IPTG (isopropyl-beta-D-thiogalactoside) to enable the final concentration to be 1 mmol/L, inducing expression for 6 hours at 37 ℃ and 200rpm, centrifuging to collect thalli, carrying out ultrasonic lysis (ultrasonic power ratio is 35 percent, ultrasonic time is 2s, pause is 2s, and ultrasonic time (including ultrasonic time and pause time) is 1800 seconds), centrifuging for 20 minutes at 12000 r/min, collecting supernatant, and carrying out affinity chromatography purification on the supernatant by using an affinity chromatography column with Ni ions to obtain purified p27 protein.
(2) Avian leukosis virus gp85 prokaryotic expression vector construction and protein expression purification
Designing a specific primer with an enzyme cutting site according to a full-length sequence of gp85 gene in a complete sequence (Z46390) of the J subgroup avian leukosis gene registered in Genbank: an upstream primer (shown as SEQ ID No. 3) CGGGATCCGGAGTTCATCTATTGCAACA and a downstream primer (shown as SEQ ID No. 4) CGCTCGAGTTAGCGCCTGCTACGGTGGTGAC. And amplifying a gp85 gene fragment by PCR, and inserting the gp85 gene into a pET-28a prokaryotic expression vector by using a method of enzyme digestion and enzyme ligation. The correctly sequenced pET-28a-gp85 was transformed into Transetta (DE 3). pET-28a-gp85/Transetta (DE3) was cultured with shaking at 37 ℃ to OD6000.6 to 0.8, adding IPTG (isopropyl thiogalactoside) to enable the final concentration to be 1 mmol/L, inducing expression at 37 ℃ and 200rpm for 6 hours, centrifuging to collect thalli, carrying out ultrasonic lysis on the thalli (ultrasonic power ratio is 35 percent, ultrasonic time is 2s, pause time is 2s, ultrasonic time (including ultrasonic time and pause time) is 1800 seconds), centrifuging at 12000 r/min for 20 minutes, collecting supernatant, and carrying out affinity chromatography purification on the supernatant by using an affinity chromatography column with Ni ions to obtain purified gp85 protein.
(3) Construction and protein expression purification of Salmonella pullorum GroE L-Delta 8-1 prokaryotic expression vector according to gene sequence (gene ID: CP003047.1) of Salmonella pullorum GroE L retrieved from Genbank, specific primers with upstream and downstream enzyme cutting sites of BamH I and Xho I are designed, an upstream primer (shown as SEQ ID No. 5) CGCGGATCCCTGATCATCGCTGAAGAT and a downstream primer (shown as SEQ ID No. 6) of CCGCTCGAGTTCCATGCACGCAGCGC. PCR is used for amplifying GroE L-Delta 8-1 gene fragment, the GroE L-Delta 8-1 gene is inserted into pGEX-6p-1 expression vector by using prokaryotic enzyme ligation method, pGEX-6p-1-GroE L-Delta 8-1 with correct sequence is transformed into Transetta (DE3), cultured at 37 ℃ to 600 of 0.6-0.8, IPTG is added to make the final concentration of the gene be 1-GroE L-Delta 8-1, the protein is purified by ultrasonic affinity chromatography (Sepharose affinity chromatography) after centrifugation at 37 ℃ to 30 sec, centrifugation at 30 sec, 2 rpm, centrifugation at 30 sec, centrifugation at 20 sec, centrifugation, purification of strain 2, ultrasonic induction, and centrifugation at 20 sec for collecting supernatant 2 sec, and purification at 20 sec.
Example 2 establishment of Indirect E L ISA detection method and determination of conditions
2.1 determination of optimal antigen coating conditions
Firstly, determining the ratio of p27+ gp85 as p27: gp85 is 1:1, then determining the final concentration of p27+ gp85 and GroE L-delta 8-1 proteins as 0.25, 0.5, 1, 2, 4 and 8 mu g/m L, and combining different antigen coating conditions of GroE L-delta 8-1: p27+ gp85 as 1:0.125, 1:0.25, 1:0.5, 1:1, 1:2, 1:4 and 1:8, respectively, diluting the antigen coating combinations with coating liquid to mix p27+ gp85 and GroE L-delta 8-1 antigen coated enzyme-labeled plate, 100 mu L/well, respectively detecting positive and positive chicken dysentery serum by each antigen coating combination, diluting the positive chicken serum and leukemia positive serum with 0.5% BSA positive and leukemia serum, determining the serum concentration as 1:1, the serum concentration of the antigen coating liquid is 1600: 1, the serum concentration of each antigen coating combination is 1600: 1, the optimal for detecting chicken serum positive and negative serum concentration of each antigen coating combination is calculated as 6400, and negative antibody coating of the highest value of chicken serum concentration of the antigen combination, wherein the antigen is calculated as 1: 600, and the value of the antigen of the value of the antigen of the chicken serum combination, the chicken.
TABLE 2 detection of potency values of A L V and SP Single Positive sera under different antigen coating conditions
And the prime symbol represents the highest effective value of detecting the pullorum disease positive serum, and the △ represents the highest effective value of detecting the avian leukemia positive serum.
TABLE 3 ratio of titer to maximum titer of single positive sera tested for A L V and SP under different antigen coating conditions
Note ". X" represents the antigen coating combination with higher potency value for the A L V and SP single positive sera tested
As shown in tables 2 and 3, the two antigen coatings are found to be combined well, and the binding potency value is selected from the optimal antigen coating conditions that the total antigen coating concentration is 4 mug/m L, and GroE L-delta 8-1: p27+ gp85 is 1:2, namely GroE L-delta 8-1: p27: gp85 is 1:1: 1.
2.2 determination of optimal blocking fluid and blocking time
Coating the ELISA plate with the optimal antigen coating condition, respectively sealing with 5% skim milk, 1% BSA, 5% standard fetal bovine serum and 0.7% gelatin at 4 ℃ overnight, respectively setting the sealing time at 37 ℃ to be 0.5h, 1h, 1.5h, 2h, 2.5h and 3h, performing layout according to a chessboard method, and performing other operations according to the conventional operation of E L ISA.
TABLE 4 detection of A L V antibody blocking conditions
TABLE 5 detection of SP antibodies under blocking conditions
The result shows that the P/N value of the tested pullorum disease positive serum and avian leukemia positive serum is the highest in 5% skimmed milk at 37 ℃ for 2h, so the sealing condition is 5% skimmed milk at 37 ℃ for 2 h.
2.3 determination of optimal serum dilution and enzyme-labeled Secondary antibody dilution
According to optimized conditions, layout is carried out in a checkerboard mode, and serum dilution is respectively set as 1: 50. 1: 100. 1: 200. 1:400 and 1:800, setting the enzyme-labeled secondary antibody dilution degree as 1: 2000. 1: 4000. 1:8000 and 1: 16000. respectively calculating and detecting the P/N value of the pullorum disease positive serum and the avian leukemia positive serum, and determining the optimal serum dilution and enzyme-labeled secondary antibody dilution.
TABLE 6 measurement of A L V antibody serum dilution and secondary antibody dilution
TABLE 7 detection of SP antibody serum dilution and secondary antibody dilution
Results the P/N values of the serum positive for pullorum disease and the serum positive for avian leukemia detected in the serum dilution of 1:200 and the dilution of the enzyme-labeled secondary antibody is 1:8000 max, thus determining serum dilution of 1:200 and the dilution of the enzyme-labeled secondary antibody is 1: 8000.
2.4 determination of optimal incubation time for Primary antibody
Under the optimized reaction condition, the antigen-antibody reaction time is respectively set to 30min, 45min, 60min, 75min and 90min, the other operations are carried out according to the conventional operation of E L ISA, the P/N values of pullorum disease positive serum and avian leukemia positive serum are respectively calculated and detected, and the optimal time of antigen-antibody reaction is determined.
TABLE 8 detection of A L V antibody Primary antibody incubation time exploration
TABLE 9 detection of SP antibody Primary antibody incubation time grope
The result P/N value is higher when the pullorum disease positive serum and the avian leukemia positive serum are detected to be incubated at 37 ℃ for 60min, and finally, the condition that the incubation at 37 ℃ for 60min is determined as the primary antibody reaction condition is determined.
2.5 determination of optimal incubation time for enzyme-labeled Secondary antibodies
Reacting rabbit anti-chicken IgG labeled by HRP at 37 ℃, respectively setting the reaction time to 15min, 30min, 45min, 60min, 75min and 90min, and carrying out other operations according to the conventional operation of E L ISA to comparatively detect the P/N values of pullorum disease positive serum and avian leukemia positive serum.
TABLE 10 detection of A L V antibody Secondary antibody reaction time
TABLE 11 detection of SP antibody Secondary antibody reaction time
The result P/N value is the highest when the tested pullorum disease positive serum and avian leukemia positive serum are incubated at 37 ℃ for 45min, and finally the condition that the incubation is carried out at 37 ℃ for 45min is determined as the secondary antibody reaction condition.
2.6 determination of the development time
Performing test according to optimized conditions, setting the color development time to be 5min, 8min, 10min, 15min and 20min respectively, and performing other operations according to conventional operation of E L ISA to compare and detect P/N values of pullorum disease positive serum and avian leukemia positive serum.
TABLE 12 detection of A L V antibody development time
TABLE 13 detection of SP antibody development time
As a result, the P/N value of the serum positive for pullorum disease and the P/N value of the serum positive for avian leukemia were the highest when the development time was 10min, and therefore the development time was determined to be 10 min.
2.7 optimal Condition operating method of Indirect E L ISA detection method finally determined
(1) Antigen coating, namely diluting the antigen by coating liquid with pH9.6, wherein the total coating concentration is 4 mu g/m L, the GroE L-delta 8-1: p27+ gp85 is 1:2, namely GroE L-delta 8-1: p27: gp85 is 1:1:1, adding the diluted antigen into a 96-well enzyme label plate, coating the diluted antigen at 100 mu L/well and at 4 ℃ overnight.
(2) Washing PBST washing plate, 300 u L/hole, patting dry, washing three times.
(3) And (3) sealing, namely adding 5% of skim milk into the enzyme label plate, sealing at the temperature of 37 ℃ for 2h at the concentration of 200 mu L per hole.
(4) Washing: and (4) repeating the step (2).
(5) Antigen-antibody reaction, serum was diluted to 1:200 with 0.5% BSA, added to an ELISA plate at 100. mu. L/well, and incubated at 37 ℃ for 60 min.
(6) Washing: and (4) repeating the step (2).
(7) Enzyme-labeled antibody reaction, namely diluting HRP-labeled rabbit anti-chicken IgG mother liquor with 0.5% BSA to 1:8000, adding the diluted solution into an enzyme-labeled plate, incubating the solution at the temperature of 37 ℃ for 45min at the concentration of 100 mu L/hole.
(8) Washing: and (4) repeating the step (2).
(9) Color development, adding TMB color development liquid into the ELISA plate at 100 mu L per hole.
(10) And (3) terminating, wherein the reaction is terminated by developing the solution for 10min at room temperature and adding 50 mu L of termination solution into each hole.
(11) Reading: the microplate reader is started to preheat 1 minute ahead, parameters of the microplate reader (reference wavelength: 620nm, measurement wavelength: 450nm, vibration 3s and interval 2s) are set, and the OD450nm value is read.
(12) Judging that the detected serum contains one or two of avian leukemia virus antibody or salmonella pullorum antibody when the OD450nm value of the detected serum is larger than a negative and positive critical value (the mean value of the standard negative sample and the standard deviation of the standard negative sample of 3 ×).
Example 3 detection of Mixed samples of pullorum disease-Positive serum and avian leukemia disease-Positive serum
Mixing pullorum disease positive serum and avian leukemia positive serum according to different proportions of 1:0, 100:1, 50: 1, 20:1, 10:1, 1:10, 1:20, 1:50, 1:100 and 0:1 respectively, and detecting the titer of different mixed sera by using an optimized self-constructed salmonella pullorum antibody E L ISA detection method, a self-constructed avian leukemia virus antibody E L ISA detection method and a self-constructed salmonella pullorum antibody and avian leukemia virus antibody E L ISA co-detection method respectively.
TABLE 14 results of potency test of different mixing ratios of SP-positive serum and A L V-positive serum with different coating antigens
The results are consistent with expectations, for example, in table 14, the titer of the serum detected by the single-detection E L ISA method continuously increases with the increase of the proportion of the corresponding positive serum, while the titer of the serum detected by the co-detection E L ISA method has no significant change, which indicates that the established co-detection method of the salmonella pullorum antibody and the avian leukemia virus antibody E L ISA can well detect the two diseases.
Example 4 detection of serum samples from infection experiments in chickens
The chicken serum of infection experiment comprises chicken serum collected from an Avian Myeloblastosis Virus (AMV) infected group, a chicken white dysentery Salmonella (SP) infected group, an AMV and chicken white dysentery salmonella co-infected group and a blank control group at 1, 4, 7, 15 and 21 days after chicks are infected, and chicken serum of an A L V A/B subgroup and a J subgroup antibody detection kit produced by IDEXX company and chicken white dysentery plate agglutination test 104 parts of infected chicken serum samples are respectively detected by an optimized self-constructed chicken white dysentery salmonella antibody E L ISA detection method (coated by GroE L-delta 8-1), a self-constructed chicken white leukemia virus antibody E L ISA detection method (coated by p27+ gp 85), a self-constructed chicken white dysentery salmonella antibody E L ISA co-detection method (coated by GroE L-delta 8-1 and p27+ gp 85).
TABLE 15 Co-detection method of self-constructed Salmonella pullorum antibody and avian leukosis virus antibody E L ISA for detecting infection experiment seropositivity
TABLE 16IDEXX coincidence rate of detection kit for antibody of subgroup A L V A/B and subgroup J with self-constructed detection method for avian leukosis virus antibody E L ISA
TABLE 17 agreement rates of pullorum disease plate agglutination test and self-constructed Salmonella pullorum antibody E L ISA detection method
TABLE 18 coincidence rate of detection method of self-constructed Salmonella pullorum antibody E L ISA and detection method of self-constructed avian leukemia virus antibody E L ISA and co-detection method of self-constructed Salmonella pullorum antibody and avian leukemia virus antibody E L ISA
TABLE 19IDEXX kit for detecting antibody of subgroup A L V A/B and subgroup J and assay rate of agglutination test of pullorum disease plate and self-constructed co-detection method of salmonella pullorum disease antibody and avian leukosis virus antibody E L ISA
As shown in tables 16 and 17, the results of IDEXX A L V A/B subgroup and J subgroup antibody detection kit with 90.4% of the detection method of the self-constructed avian leukosis virus antibody E L ISA, and the results of the panel agglutination test of pullorum disease with 89.4% of the detection method of the self-constructed Salmonella pullorum antibody E L ISA show that the single detection method coated with p27+ g85 is higher than the detection method of commercial product of the E L ISA method separately coated with GroE L- Δ 8-1. As shown in tables 18 and 19, the results of the single detection method coated with p27+ g85 and GroE L- Δ 8-1 with 93.3% of the detection method of common coating with the common detection method of common coating with p27+ g85 and GroE L- Δ 8-1 show that the panel agglutination test of pullorum disease with the panel agglutination test with the panel antibody E L with the common detection method of common coating with 93.5% of the panel agglutination test method of commercial product of avian leukosis virus with P6858 and the detection method of common detection of avian leukosis virus infection with P895-19 show that the panel agglutination test kit with the panel agglutination test method of commercial product of avian leukosis virus with P6858 and the panel antibody E855.
The results in Table 19 show that, with the A L V A/B subgroup and J subgroup antibody detection kit/pullorum disease plate agglutination test of IDEXX as reference, the positive coincidence rate of the self-constructed pullorum disease salmonella antibody and avian leukemia virus antibody E L ISA co-detection method is 85.4%, and the negative coincidence rate is 88.9%, which indicates that the sensitivity and specificity of the established E L ISA method reach the detection effect of the commercial kit, and the effect of simultaneously detecting the avian leukemia virus and pullorum disease salmonella is achieved.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of agriculture in China
<120> kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody
<130>MP1801998
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
cgggatccat gcctgtagtg attaagac 28
<210>2
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
cgctcgagct agggctggat agcagacg 28
<210>3
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cgggatccgg agttcatcta ttgcaaca 28
<210>4
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cgctcgagtt agcgcctgct acggtggtga c 31
<210>5
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
cgcggatccc tgatcatcgc tgaagat 27
<210>6
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ccgctcgagt tccattgcac gcagcgc 27
Claims (1)
1. The kit for detecting the avian leukemia and/or pullorum disease is characterized by consisting of a coating antigen combination, serum, a primary antibody, an enzyme-labeled secondary antibody, a coating buffer solution, a washing buffer solution, a confining liquid, a sample or a diluent of the secondary antibody, a developing liquid and a stop solution;
the antigen combination consists of p27 protein, gp85 protein and GroE L- Δ 8-1 protein;
the GroE L-delta 8-1 protein is obtained by amplifying a GroE L-delta 8-1 gene segment by an upstream primer shown in SEQ ID No.5 and a downstream primer shown in SEQ ID No.6, constructing a prokaryotic expression vector and performing induced expression, wherein the total concentration of the p27 protein, the gp85 protein and the GroE L-delta 8-1 protein is 4 mu g/m L, and the mass ratio is 1:1: 1;
the use method of the kit comprises the steps that the dilution of serum is 1: 200; the dilution of the enzyme-labeled secondary antibody is 1: 8000;
the sealing condition of the sealing liquid is 5% skimmed milk sealed for 2 hours at 37 ℃;
the primary antibody is incubated at 37 ℃ for 60 min; the incubation condition of the enzyme-labeled secondary antibody is incubation for 45min at 37 ℃;
the developing time of the developing liquid is 10 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810575209.9A CN108776221B (en) | 2018-06-06 | 2018-06-06 | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810575209.9A CN108776221B (en) | 2018-06-06 | 2018-06-06 | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108776221A CN108776221A (en) | 2018-11-09 |
| CN108776221B true CN108776221B (en) | 2020-07-31 |
Family
ID=64025772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810575209.9A Active CN108776221B (en) | 2018-06-06 | 2018-06-06 | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108776221B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113341140A (en) * | 2021-06-02 | 2021-09-03 | 贵州大学 | Indirect ELISA (enzyme-linked immunosorbent assay) method for detecting avian leukosis P27 |
| CN113519455A (en) * | 2021-08-02 | 2021-10-22 | 北京市华都峪口禽业有限责任公司 | Chicken white diarrhea field detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1530658A (en) * | 2003-03-17 | 2004-09-22 | 上海博N微晶科技有限公司 | Mixed making out of style enzyme linked immunosorbent assay for multiple infectious blood diseases |
| CN103995126A (en) * | 2014-04-18 | 2014-08-20 | 中国农业大学 | ELISA kit for detecting Salmonella pullorum antibody |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU745787B2 (en) * | 1997-05-06 | 2002-03-28 | Human Genome Sciences, Inc. | Enterococcus faecalis polynucleotides and polypeptides |
| US6146641A (en) * | 1998-07-21 | 2000-11-14 | The United States Of America As Represented By The Secretary Of Agriculture | Avian leukosis virus subgroup J envelope gene product for diagnosis and immunogenic composition |
| US7972776B2 (en) * | 2005-11-15 | 2011-07-05 | Oncohealth Corporation | Protein chips for HPV detection |
| US8206700B2 (en) * | 2006-10-25 | 2012-06-26 | The Regents Of The University Of California | Methods and compositions for treating tularemia |
| EP2542696B1 (en) * | 2010-03-01 | 2016-09-28 | Caris Life Sciences Switzerland Holdings GmbH | Biomarkers for theranostics |
| CN103018442B (en) * | 2011-09-23 | 2014-11-19 | 华中农业大学 | Mycoplasma hyopneumoniae indirect ELISA antibody detection kit and application |
| CN105445473B (en) * | 2015-11-13 | 2017-11-03 | 中国检验检疫科学研究院 | A kind of Brucella abortus ELISA detection kit |
| CN106248932A (en) * | 2016-08-18 | 2016-12-21 | 山东新四维农业科技有限公司 | A kind of discrimination method for the medium-sized young layer of high-quality |
-
2018
- 2018-06-06 CN CN201810575209.9A patent/CN108776221B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1530658A (en) * | 2003-03-17 | 2004-09-22 | 上海博N微晶科技有限公司 | Mixed making out of style enzyme linked immunosorbent assay for multiple infectious blood diseases |
| CN103995126A (en) * | 2014-04-18 | 2014-08-20 | 中国农业大学 | ELISA kit for detecting Salmonella pullorum antibody |
Non-Patent Citations (1)
| Title |
|---|
| 禽白血病病毒衣壳蛋白与囊膜蛋白单克隆抗体制备及诊断试剂盒研制;李晓菲;《中国优秀硕士学位论文全文数据库-农业科技辑》;20160131;摘要，第1.3.3、2.2.3、3.2.2部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108776221A (en) | 2018-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103777010B (en) | porcine epidemic diarrhea virus ELISA detection kit and preparation method thereof | |
| CN108709995B (en) | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody | |
| CN108776221B (en) | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody | |
| CN109142724B (en) | Blocking ELISA kit for detecting avian adenovirus group I type 4 antibody and application thereof | |
| CN112759629B (en) | ELISA kit for detecting iridovirus antibody of micropterus salmoides and detection method thereof | |
| Moreno et al. | MAb‐based competitive ELISA for the detection of antibodies against influenza D virus | |
| CN108956987B (en) | Application of fiber2 protein and recombinant protein thereof in detecting duck type 2 adenovirus antibody in duck serum | |
| CN101839917A (en) | Enzyme-linked immunosorbent assay (ELISA) kit for duck hepatitis virus type-I serum antibody, test method and application thereof | |
| CN104725490A (en) | Porcine circovirus 2 type ELISA antibody detection kit | |
| CN103033614A (en) | ELISA kit for porcine circovirus type 2 antibody detection | |
| CN106596966A (en) | Chemiluminescent detection kit for bovine foot-and-mouth disease 3ABC antibody | |
| CN108918869B (en) | Application of fiber2 protein and recombinant protein thereof in detecting serum type 4 avian adenovirus antibody | |
| CN103499693A (en) | Competitive Alpha LISA (linked immuno sorbent assay) detection kit for classical swine fever virus (CSFV) antibody and detection method thereof | |
| CN106771237B (en) | A kind of ELISA kit for detecting porcine sapelo virus antibody | |
| CN110568189B (en) | Dog adenovirus type 1 antibody ELISA detection kit and application thereof | |
| CN108982847B (en) | Indirect ELISA (enzyme-linked immunosorbent assay) detection method for duck reovirus causing duck spleen necrosis | |
| Choi et al. | Preparation and diagnostic utility of a hemagglutination inhibition test antigen derived from the baculovirus-expressed hemagglutinin-neuraminidase protein gene of Newcastle disease virus | |
| CN108101974B (en) | Fasciola hepatica multi-epitope fusion diagnostic antigen and application and preparation method thereof | |
| CN106866798B (en) | Subgroup J avian leukosis virus specific epitope, fusion protein, specific antibody and application thereof | |
| CN112980802B (en) | Hybridoma cell secreting novel duck reovirus sigma B protein monoclonal antibody, monoclonal antibody and application | |
| CN110484511B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
| KR101080071B1 (en) | Rift valley fever competition ELISA using monoclonal antibodies against recombinant N protein | |
| CN107664694A (en) | A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody | |
| CN103869066A (en) | Tembusu virus double-antibody sandwich ELISA (Enzyme Linked Immunosorbent Assay) detection method | |
| Rana et al. | Expression of recombinant Apple chlorotic leaf spot virus coat protein in heterologous system: production and use in immunodiagnosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |