CN108709995B - Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody - Google Patents
Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody Download PDFInfo
- Publication number
- CN108709995B CN108709995B CN201810575755.2A CN201810575755A CN108709995B CN 108709995 B CN108709995 B CN 108709995B CN 201810575755 A CN201810575755 A CN 201810575755A CN 108709995 B CN108709995 B CN 108709995B
- Authority
- CN
- China
- Prior art keywords
- protein
- groel
- delta
- kit
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56916—Enterobacteria, e.g. shigella, salmonella, klebsiella, serratia
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
Abstract
The invention relates to the technical field of animal epidemic disease detection, in particular to a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum disease antibody. The kit comprises: p27 protein, GroEL-delta 8-1 protein, enzyme-labeled secondary antibody, BSA, coating solution, blocking solution, developing solution and stop solution. The invention uses prokaryotic expression protein of avian leukosis virus conserved region p27 and prokaryotic expression protein of GroEL-delta 8-1 of a truncation of the dominant antigen GroEL of the salmonella pullorum as coating antigens to develop an indirect ELISA kit capable of simultaneously detecting avian leukosis virus antibodies and the salmonella pullorum antibodies.
Description
Technical Field
The invention relates to the technical field of animal epidemic disease detection, in particular to a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum disease antibody.
Background
Avian leukemia (Avian leukemia) is a collective term for a variety of neoplastic diseases in birds caused by viruses in the Avian leukemia Virus (Avian leukemia Virus, ALV) and Avian Sarcoidosis Virus (ASV) groups. The disease can cause a plurality of infectious benign and malignant tumors of chickens. Since the report of chicken lymphosarcoma by Roloff in 1868, avian leukemia has been distributed around the world, and natural cases occur in China. The disease can cause the weight of the chicken to slowly increase, the sexual maturity is delayed, the egg is small, the eggshell is thin, the egg yield is reduced, the fertility rate and the hatching rate are low, the carcass waste rate is increased, the death rate is increased, and the like, thereby causing direct economic loss. Meanwhile, the non-specific resistance of the organism is reduced and the immunity is inhibited, thereby causing indirect economic loss. The disease can be vertically spread, so the disease has great harm to the poultry industry and is one of the main diseases harming the chicken industry.
Pullorum Disease (Pullorum Disease) is caused by Salmonella Pullorum (SP), and is mainly characterized by the white feces excretion and egg production reduction of chicks, which can cause acute infectious diseases of poultry with septic typhoid fever in chickens of each day before parturition. The spreading mode of the salmonella pullorum is diverse, not only can be horizontally spread through feed, air, drinking water, mice and the like, but also can be vertically spread through producing bacteria-carrying eggs, a large amount of pathogenic bacteria carried in hatched brood villi can pollute drinking water, brooding devices, feed and the like, broods in the same chicken coop are infected through digestive tracts, respiratory tracts and the like, and after the chicks are grown up, the bacteria-carrying eggs are discharged, so that a complex spreading network is formed. The salmonella pullorum is high in infection rate and wide in distribution in China, is the key point for breeding and purifying breeding poultry and is also the key disease for preventing and treating the breeding of commercial laying hens.
Both avian leukemia and pullorum disease are infectious diseases that can be transmitted vertically, and cause serious harm to the chicken industry. At present, the most effective measure for controlling the avian leukemia and the pullorum disease is to purify infectious diseases, and the avian leukosis and pullorum disease-free chicken flocks are bred by mainly quarantining the chicken flocks regularly, eliminating positive chickens and continuously purifying. Among many detection methods in various countries, the ELISA detection method is widely applied to clinical detection due to its sensitivity, specificity and convenient operation. The method is suitable for diagnosis and serological detection of the disease in basic veterinary departments and chicken farms.
The p27 gene of avian leukosis virus is a highly conserved gene between different subgroups of avian leukosis virus. The encoded p27 protein is the main component of the virus core shell, has high content, accounts for more than 30 percent of the total virus protein component, and can induce the organism to generate specific antibodies. Heat-shock protein 60(GroEL) is an important protein antigen of salmonella pullorum and can induce the generation of a large amount of antibodies when the salmonella pullorum invades the body. Therefore, p27 and GroEL can be used as coating antigens to establish an indirect ELISA detection kit for detecting avian leukemia and pullorum disease antibodies. The types of the main existing avian leukemia and pullorum disease detection kits are shown in table 1:
TABLE 1 avian leukosis and pullorum disease assay kit statistics
The avian leukemia and pullorum disease are infectious diseases which need to be purified in chicken farms, the existing purification of the avian leukemia mainly comprises the steps of detecting an avian leukemia virus antigen p27 of a chicken cloaca swab and an avian leukemia antibody of chicken serum by using a foreign ELISA kit, and the purification of the pullorum disease mainly comprises the step of detecting a salmonella pullorum disease antibody of the chicken serum by using a flat plate agglutination test, wherein the kits or the methods are all used for detecting a single infectious disease, and no single kit can detect the avian leukemia and the pullorum disease. The kit for separately detecting the avian leukemia and the method for separately detecting the pullorum disease by using the plate agglutination test lead the work of clinically detecting and purifying the avian leukemia and the pullorum disease to consume a large amount of manpower, material resources and financial resources. Therefore, the development of a convenient and easy-to-use kit for detecting the avian leukemia and the pullorum disease is urgently needed, and the purification work of the avian leukemia and the pullorum disease is relieved.
Disclosure of Invention
In view of the above, the present invention provides a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum antibody. The kit can simultaneously detect the leukemia and the pullorum disease of the poultry, and the chicken which is detected as positive can be eliminated, so that the aim of simultaneous purification is fulfilled.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum antibody, which comprises: p27 protein, GroEL-delta 8-1 protein, enzyme-labeled secondary antibody, BSA (bovine serum albumin), coating solution, blocking solution, developing solution and stop solution.
The invention combines the current situation that the avian leukemia and the pullorum disease need to be purified simultaneously, utilizes the basic principle of ELISA (enzyme linked immunosorbent assay), and uses the prokaryotic expression protein of the avian leukemia virus conserved region p27 and the prokaryotic expression protein of the truncated GroEL-delta 8-1 of the salmonella pullorum dominant antigen GroEL as the envelope antigen to develop the ELISA kit capable of simultaneously detecting the avian leukemia and the pullorum disease. By searching the optimal p27 and GroEL-delta 8-1 coating conditions and optimizing the ELISA reaction conditions, an indirect ELISA method for simultaneously detecting the avian leukemia virus antibody and the salmonella pullorum antibody is established. Compared with the existing commonly used kit for separately detecting the avian leukemia or the pullorum disease, the kit provided by the invention can be used for simultaneously detecting the avian leukemia and the pullorum disease, and chickens which are detected to be positive are eliminated, so that the purpose of simultaneous purification is achieved, and the work of clinical detection and purification is greatly reduced.
Preferably, the enzyme-labeled secondary antibody is horseradish peroxidase-labeled rabbit anti-chicken IgG.
Preferably, the coating liquid is a coating liquid having a pH of 9.6.
Preferably, the confining liquid is skim milk.
Preferably, the confining liquid is skim milk with a mass percentage concentration of 5%.
Preferably, the BSA is 0.5% by mass BSA.
Preferably, the color developing solution is TMB (3,3',5,5' -tetramethylbenzidine) color developing solution.
In the invention, the preparation method of the p27 protein comprises the following steps: using SEQ ID NO: 1 and the upstream primer shown in SEQ ID NO: 2 to obtain p27 gene segment, inserting p27 gene into prokaryotic expression vector, transferring into expression host, inducing expression, collecting thallus, cracking and purifying to obtain p27 protein.
In the invention, the GroEL-delta 8-1 protein is prepared by the following steps: using SEQ ID NO: 3 and the upstream primer shown in SEQ ID NO: 4 to obtain a GroEL-delta 8-1 gene segment, inserting the GroEL-delta 8-1 gene into a prokaryotic expression vector, transferring the prokaryotic expression vector into an expression host, and obtaining GroEL-delta 8-1 protein through induced expression, thallus collection, cracking and purification.
Preferably, the total concentration of the p27 protein and the GroEL-. DELTA.8-1 protein at the time of coating is 4. mu.g/mL.
Preferably, the mass ratio of the GroEL-delta 8-1 protein to the p27 protein is 1:2 during coating.
Preferably, the kit further comprises an enzyme label plate and/or a PBST buffer solution.
The invention provides a method for simultaneously detecting avian leukemia and pullorum disease, which comprises the following steps:
(1) antigen coating: taking GroEL-delta 8-1 protein and p27 protein as antigens, diluting the antigens by coating liquid, wherein the total coating concentration is 0.25-8 mu g/mL, the mass ratio of the GroEL-delta 8-1 protein to the p27 protein is 1: 0.125-1: 8, and coating is carried out for 8-12 h at 4 ℃;
(2) washing;
(3) and (3) sealing: and adding sealing liquid skim milk into the ELISA plate, and sealing for 0.5-3 h at 37 ℃.
(4) Washing;
(5) antigen-antibody reaction: serum was diluted with BSA to 1: 50-1: 800, adding the mixture into an enzyme label plate, and incubating for 30-90 min at 37 ℃;
(6) washing;
(7) enzyme-labeled antibody reaction: the enzyme-labeled secondary antibody stock was diluted with BSA to 1: 2000-1: 16000 adding into enzyme labeling plate, incubating at 37 deg.C for 15-90 min;
(8) washing;
(9) color development: adding a developing solution into the ELISA plate, and developing for 5-20 min at 15-30 ℃;
(10) and (4) terminating: adding a stop solution to terminate the reaction;
(11) reading: detecting an OD450nm value;
(12) and (3) judging: when the OD450nm value of the detected serum is larger than the positive and negative critical value (mean value of standard negative samples +3 times standard deviation of standard negative samples), the detected serum contains one or two of avian leukemia virus antibody or salmonella pullorum antibody.
Preferably, the coating liquid is a coating liquid having a pH of 9.6.
Preferably, the confining liquid is skim milk with a mass percentage concentration of 5%.
Preferably, the blocking temperature is 37 ℃ and the blocking time is 2 h.
Preferably, the BSA is 0.5% by mass BSA.
Preferably, the color developing solution is a TMB color developing solution.
Preferably, the total concentration of the p27 protein and the GroEL-. DELTA.8-1 protein at the time of coating is 4. mu.g/mL.
Preferably, the mass ratio of the GroEL-delta 8-1 protein to the p27 protein is 1:2 during coating.
Preferably, in step (5), the serum is diluted with BSA to 1:200, adding into an enzyme label plate, and incubating for 75min at 37 ℃.
Preferably, in step (7), the enzyme-labeled secondary antibody mother liquor is diluted with BSA to 1: 4000, adding the mixture into an enzyme label plate, and incubating for 45min at 37 ℃.
Preferably, the time for color development is 5 min.
The invention provides a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum disease antibody. The kit comprises: p27 protein, GroEL-delta 8-1 protein, enzyme-labeled secondary antibody, BSA, coating solution, blocking solution, developing solution and stop solution. The invention has the technical effects that:
the invention uses prokaryotic expression protein of avian leukosis virus conserved region p27 and prokaryotic expression protein of a truncation GroEL-delta 8-1 of a pullorum salmonella dominant antigen GroEL as coating antigens to develop an indirect ELISA kit capable of simultaneously detecting avian leukosis virus antibodies and pullorum salmonella antibodies. An indirect ELISA method for detecting avian leukosis virus antibody and salmonella pullorum disease antibody is established by searching the optimal p27 and GroEL-delta 8-1 coating conditions and optimizing the ELISA reaction conditions. Compared with the existing commonly used kit for separately detecting the avian leukemia or the pullorum disease, the kit provided by the invention can be used for simultaneously detecting the avian leukemia and the pullorum disease, and chickens which are detected to be positive are eliminated, so that the purpose of simultaneous purification is achieved, and the work of clinical detection and purification is greatly reduced.
Detailed Description
The invention discloses a kit for simultaneously detecting an avian leukosis virus antibody and a salmonella pullorum disease antibody, and the kit can be realized by appropriately improving process parameters by taking the contents as reference by the technical personnel in the field. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
In the invention, the coating buffer is a carbonate buffer with pH9.6 and 0.05M, and the formula is as follows:
in the present invention, the washing buffer is PBST buffer with pH7.4, and the formulation is:
in the invention, the formula of the sealing liquid is as follows:
amount of reagent used
Skimmed milk 5g
Wash buffer 100mL
In the present invention, the sample and the secondary antibody diluent are 0.5% BSA, and the formula is:
amount of reagent used
Bovine Serum Albumin (BSA) 0.5g
Wash buffer 100mL
In the present invention, the stopping liquid (2M H)2SO4) The formula of the composition is as follows:
amount of reagent used
Concentrated sulfuric acid 22mL
178mL of water
The reagent or the instrument used in the kit for simultaneously detecting the avian leukosis virus antibody and the salmonella pullorum antibody provided by the invention can be purchased from the market.
The invention is further illustrated by the following examples:
example 1
p27 protein, GroEL-delta 8-1 protein, rabbit anti-chicken IgG mother liquor marked by HRP, 0.5% BSA, coating solution (pH9.6), blocking solution (5% skim milk), TMB developing solution, stop solution, ELISA plate and PBST buffer solution.
Test example 1
Constructing a p27 recombinant prokaryotic expression vector according to the p27 gene of the avian leukemia virus, carrying out induction expression on fused p27 protein by IPTG, and purifying the p27 protein by a nickel column. The purified p27 protein and GroEL-delta 8-1 protein are used as coating antigens, an indirect ELISA method for detecting two antibodies of avian leukemia and pullorum disease is established by searching for the optimal coating conditions, the optimal sealing conditions, the optimal serum dilution ratio and action time, and the optimal secondary antibody dilution and action time and color development time, and the effectiveness of the established method is verified. The specific technical scheme is as follows:
preparation of p27 protein and GroEL-. DELTA.8-1 protein
(1) Construction of avian leukosis virus p27 prokaryotic expression vector and protein expression purification
Designing a specific primer with an enzyme cutting site according to the sequence of the p27 gene in the complete sequence (M37980) of the avian leukemia gene registered in Genbnak:
upstream primer (SEQ ID NO: 1): CGGGATCCATGCCTGTAGTGATTAAGAC, respectively;
downstream primer (SEQ ID NO: 2): CGCTCGAGCTAGGGCTGGATAGCAGACG are provided.
The p27 gene fragment was amplified by PCR, and the p27 gene was inserted into pET-30a prokaryotic expression vector by enzymatic ligation. pET-30a-p27 with correct sequencing was transformed into Transetta (DE3) and cultured with shaking at 37 ℃ to OD6000.6 to 0.8, IPTG was added to a final concentration of 1mmol/L, the expression was induced at 37 ℃ and 200rpm for 6 hours, and the cells were collected by centrifugation. The thalli is subjected to ultrasonic lysis (ultrasonic power ratio is 35%, ultrasonic treatment is carried out for 2 seconds, pause is carried out for 2 seconds, ultrasonic time (including ultrasonic treatment and pause time) is 1800 seconds in total), then centrifugation is carried out for 20min at 12000r/min, and supernatant is collected. And (4) carrying out affinity chromatography purification on the supernatant by using an affinity chromatography column with Ni ions, and purifying to obtain the p27 protein.
(2) Construction of salmonella pullorum GroEL-delta 8-1 prokaryotic expression vector and protein expression and purification
Specific primers with upstream enzyme cutting sites of BamH I and Xho I are designed according to the retrieved gene sequence (gene ID: CP003047.1) of Salmonella pullorum and the gene sequence of Salmonella pullorum, wherein the sequence comprises the following steps:
upstream primer (SEQ ID NO: 3): CGCGGATCCCTGATCATCGCTGAAGAT, respectively;
downstream primer (SEQ ID NO: 4): CCGCTCGAGTTCCATTGCACGCAGCGC are provided.
PCR amplification of GroEL-delta 8-1 gene fragment, enzyme digestion enzyme linked method to insert GroEL-delta 8-1 gene into pGEX-6p-1 prokaryotic expression vector. pGEX-6 p-1-GroEL-. DELTA.8-1, which was correctly sequenced, was transformed into Transetta (DE3) and cultured with shaking at 37 ℃ to OD6000.6 to 0.8, IPTG was added to a final concentration of 1mmol/L, the expression was induced at 30 ℃ and 200rpm for 10 hours, and the cells were collected by centrifugation. The thalli is subjected to ultrasonic lysis (ultrasonic power ratio is 35%, ultrasonic treatment is carried out for 2 seconds, pause is carried out for 2 seconds, ultrasonic time (including ultrasonic treatment and pause time) is 1800 seconds in total), then centrifugation is carried out for 20min at 12000r/min, and supernatant is collected. And (3) carrying out affinity chromatography purification on the supernatant by using a Glutathion Sepharose TM 4B affinity chromatography column, and purifying to obtain GroEL-delta 8-1 protein.
2. Establishment of indirect ELISA detection method and optimization of conditions
The detection method comprises the following steps:
(1) antigen coating: diluting the antigen with coating solution with pH9.6, wherein the total coating concentration is 0.25-8 mu g/mL, the GroEL-delta 8-1: p27 is 1: 0.125-1: 8, adding the diluted antigen into a 96-well enzyme label plate, coating the diluted antigen at 100 mu L/well and standing overnight at 4 ℃.
(2) Washing: PBST washing plate, 300 u L/hole, pat dry, washing three times.
(3) And (3) sealing: and adding a sealing solution (5% of skim milk, 1% of BSA, 5% of standard fetal bovine serum and 0.7% of gelatin) into the ELISA plate, sealing at the temperature of 37 ℃ for 0.5-3 h at a rate of 200 mu L/hole.
(4) Washing: and (4) repeating the step (2).
(5) Antigen-antibody reaction: serum was diluted with 0.5% BSA to 1: 50-1: 800, adding the mixture into an enzyme label plate, incubating at the temperature of 37 ℃ for 30-90 min, wherein each hole is 100 mu L.
(6) Washing: and (4) repeating the step (2).
(7) Enzyme-labeled antibody reaction: the HRP-labeled rabbit anti-chicken IgG stock was diluted with 0.5% BSA to 1: 2000-1: 16000 adding into enzyme label plate, 100 μ L/hole, incubating at 37 deg.C for 15-90 min.
(8) Washing: and (4) repeating the step (2).
(9) Color development: TMB developing solution is added into the ELISA plate at 100 mu L/hole.
(10) And (4) terminating: developing at room temperature for 5-20 min, and adding 50 mu L of stop solution into each hole to terminate the reaction.
(11) Reading: the microplate reader is started to preheat 1 minute ahead, parameters of the microplate reader (reference wavelength: 620nm, measurement wavelength: 450nm, vibration 3s and interval 2s) are set, and the OD450nm value is read.
2.1 determination of optimal antigen coating conditions
The final concentrations of p27 and GroEL-. DELTA.8-1 protein were 0.25, 0.5, 1, 2, 4 and 8. mu.g/mL, and the ratio of GroEL-. DELTA.8-1: the ratio of p27 protein is 1:0.125, 1:0.25, 1:0.5, 1: 1. 1: 2. 1:4 and 1:8, diluting and mixing the p27 and GroEL-delta 8-1 antigen coated ELISA plates by using coating liquid respectively for each antigen coating combination, and mixing the diluted and mixed antigen coating conditions at 100 mu L/hole. The titer of pullorum disease positive serum and avian leukemia positive serum is respectively detected by each antigen coating combination, the pullorum disease positive serum and the avian leukemia positive serum are diluted by 0.5% BSA, and the dilution is respectively 1:200, 1:400, 1:800, 1:1600, 1: 3200,1: 6400,1: 12800,1: 25600, duplicate 2 microplate-wells per combination, 100 μ L/well, with sample dilution as a negative control. The other operations are carried out according to the conventional ELISA operation, the serological value of each antigen coating combination is calculated, and the detected antigen coating combination with higher serological values of pullorum disease positive and avian leukosis positive is taken as the optimal antigen coating condition.
TABLE 2 detection of potency values of ALV and SP Single Positive sera under different antigen coating conditions
Note: "' represents the highest effect value of detecting pullorum positive serum"△"represents the highest effective value of positive serum for detecting avian leukosis.
TABLE 3 ratio of titer to maximum titer of ALV and SP single positive sera tested under different antigen coating conditions
Note: ". indicates that the antigen coating combination with higher potency value for detecting ALV and SP single positive serum
As shown in tables 2 and 3, several antigen coating combinations are found to be better, and the binding potency value is selected as the optimal antigen coating condition with the total antigen coating concentration of 4 mug/mL and GroEL-delta 8-1: p27 of 1: 2.
2.2 determination of optimal blocking fluid and blocking time
And (3) coating the ELISA plate with the optimal antigen coating concentration, respectively sealing the ELISA plate with 5% skim milk, 1% BSA, 5% standard fetal bovine serum and 0.7% gelatin at 4 ℃ overnight, setting the sealing time at 37 ℃ to be 0.5h, 1h, 1.5h, 2h, 2.5h and 3h respectively, carrying out layout according to a chessboard method, and carrying out the rest operations according to the conventional ELISA operation. Respectively calculating the P/N values of the pullorum disease positive serum and the avian leukemia positive serum, and determining the optimal confining liquid and the confining time.
The result shows that the P/N value of the tested pullorum disease positive serum and avian leukemia positive serum is the highest in 5% skimmed milk at 37 ℃ for 2h, so the sealing condition is 5% skimmed milk at 37 ℃ for 2 h.
2.3 determination of optimal serum dilution and enzyme-labeled Secondary antibody dilution
According to optimized conditions, layout is carried out in a checkerboard mode, and serum dilution is respectively set as 1: 50. 1: 100. 1: 200. 1:400 and 1:800, setting the enzyme-labeled secondary antibody dilution degree as 1: 2000. 1: 4000. 1: 8000 and 1: 16000. respectively calculating and detecting the P/N value of the pullorum disease positive serum and the avian leukemia positive serum, and determining the optimal serum dilution and enzyme-labeled secondary antibody dilution.
Results the P/N values of the serum positive for pullorum disease and the serum positive for avian leukemia detected in the serum dilution of 1:200 and the dilution of the enzyme-labeled secondary antibody is 1: 4000 max, thus determining the serum dilution as 1:200 and the dilution of the enzyme-labeled secondary antibody is 1: 4000.
2.4 determination of optimal incubation time for Primary antibody
Under the optimized reaction conditions, the action time of the antigen and the antibody is respectively set to 30min, 45min, 60min, 75min and 90min, and the rest operations are carried out according to the conventional ELISA operation. Respectively calculating the P/N values of the pullorum disease positive serum and the avian leukemia positive serum, and determining the optimal time of antigen-antibody reaction.
The result P/N value is higher when the pullorum disease positive serum and the avian leukemia positive serum are detected to be incubated at 37 ℃ for 75min, and finally, the condition that the incubation at 37 ℃ for 75min is determined as a primary anti-reaction condition is determined.
2.5 determination of optimal incubation time for enzyme-labeled Secondary antibodies
Reacting rabbit anti-chicken IgG marked by HRP at 37 ℃, setting the reaction time to be 15min, 30min, 45min, 60min, 75min and 90min respectively, and comparing and detecting the P/N values of pullorum disease positive serum and avian leukemia positive serum.
The result P/N value is the highest when the tested pullorum disease positive serum and avian leukemia positive serum are incubated at 37 ℃ for 45min, and finally the condition that the incubation is carried out at 37 ℃ for 45min is determined as the secondary antibody reaction condition.
2.6 determination of the development time
Performing tests according to optimized conditions, setting the color development time to be 5min, 8min, 10min, 15min and 20min respectively, and comparing and detecting the P/N values of pullorum disease positive serum and avian leukemia positive serum.
As a result, the P/N value of the serum was the highest for the detection of pullorum disease-positive serum and avian leukemia disease-positive serum at a development time of 5min, and therefore, the development time was determined to be 5 min.
2.7 optimal Condition operating method for Indirect ELISA detection method to Final determine
(1) Antigen coating: the antigen was diluted with a coating solution of pH9.6 at a total coating concentration of 4. mu.g/mL and GroEL-. DELTA.8-1: p27 of 1:2, and the mixture was added to a 96-well microplate at 100. mu.L/well and coated overnight at 4 ℃.
(2) Washing: PBST washing plate, 300 u L/hole, pat dry, washing three times.
(3) And (3) sealing: 5% skim milk is added into the ELISA plate, 200 mu L/hole, and sealed for 2h at 37 ℃.
(4) Washing: and (4) repeating the step (2).
(5) Antigen-antibody reaction: the serum was diluted to 1:200 with 0.5% BSA, added to the microplate, 100. mu.L/well and incubated at 37 ℃ for 75 min.
(6) Washing: and (4) repeating the step (2).
(7) Enzyme-labeled antibody reaction: the HRP-labeled rabbit anti-chicken IgG stock was diluted with 0.5% BSA to 1: 4000, add into enzyme plate, 100 u L/hole, incubate 45min at 37 ℃.
(8) Washing: and (4) repeating the step (2).
(9) Color development: TMB developing solution is added into the ELISA plate at 100 mu L/hole.
(10) And (4) terminating: the reaction was stopped by developing at room temperature for 5min and adding 50. mu.L of stop solution to each well.
(11) Reading: the microplate reader is started to preheat 1 minute ahead, parameters of the microplate reader (reference wavelength: 620nm, measurement wavelength: 450nm, vibration 3s and interval 2s) are set, and the OD450nm value is read.
3. Detection of mixed sample of pullorum disease positive serum and avian leukosis positive serum
And (2) respectively mixing pullorum disease positive serum and avian leukemia positive serum according to the weight ratio of 1:0, 100:1 and 50: 1. mixing the components in different proportions of 20:1, 10:1, 1:10, 1:20, 1:50, 1:100 and 0:1, and respectively detecting the titer of different mixed sera by using an optimized ELISA detection method for the antibody of the salmonella pullorum, an ELISA detection method for the antibody of the avian leukemia virus and an ELISA co-detection method for the antibody of the salmonella pullorum and the antibody of the avian leukemia virus.
TABLE 4 results of different mixing ratios of SP-positive serum and ALV-positive serum with different coating antigens for detection of titer
The results are consistent with the expectations, as shown in table 4, the titer of the serum detected by the single detection ELISA method continuously increases with the increase of the proportion of the corresponding positive serum, while the titer of the serum detected by the co-detection ELISA method has no significant change, which indicates that the established ELISA co-detection method for salmonella pullorum antibodies and avian leukosis virus antibodies can well detect the two diseases.
4. Detection of chicken serum sample in infection experiment
Infection test chicken sera: chicken sera collected from Avian Myeloblastosis Virus (AMV) infected group, Salmonella Pullorum (SP) infected group, AMV and salmonella pullorum co-infected group, and placebo group on days 1, 4, 7, 15, and 21 after infection of chicks. The optimized ELISA detection method for the self-built salmonella pullorum antibodies (coating by GroEL-delta 8-1), the ELISA detection method for the self-built avian leukosis virus antibodies (coating by p 27), the ELISA co-detection method for the self-built avian leukosis virus and salmonella pullorum antibodies (coating by GroEL-delta 8-1 and p 27), the ALV A/B subgroup and J subgroup antibody detection kit produced by IDEXX, and the chicken white diarrhea plate agglutination test are respectively used for detecting 104 chicken serum samples of infection experiments.
TABLE 5 self-constructed avian leukosis Virus and Salmonella pullorum antibody ELISA Co-detection method for detecting infection experiment seropositivity
TABLE 6 coincidence rate of ALV subgroup A/B and subgroup J antibody detection kit of IDEXX and self-constructed avian leukosis virus antibody ELISA detection method
TABLE 7 consensus rates of pullorum disease plate agglutination tests and self-constructed ELISA detection methods for Salmonella pullorum antibodies
TABLE 8 coincidence rates of the self-constructed Salmonella pullorum antibody ELISA test method and the self-constructed avian leukemia virus antibody ELISA test method with the self-constructed avian leukemia virus and Salmonella pullorum antibody ELISA co-test method
TABLE 9 coincidence rate of ALV subgroup A/B and subgroup J antibody detection kit and pullorum disease panel agglutination test with self-built avian leukosis virus and pullorum disease salmonella antibody ELISA co-detection method
As shown in tables 6 and 7, the results show that the coincidence rate of the ALV subgroup A/B and subgroup J antibody detection kit of IDEXX and the ELISA detection method of the self-constructed avian leukosis virus antibody reaches 91.3%, the coincidence rate of the agglutination test of pullorum plates and the ELISA detection method of the self-constructed Salmonella pullorum antibody reaches 90.4%, and the coincidence rate of the ELISA method established by the independent coating of p27 and the independent coating of GroEL-delta 8-1 and the commercial detection method is higher. As shown in tables 8 and 9, the results of p27 and GroEL-. DELTA.8-1, which were separately coated and co-coated, showed a coincidence rate of 94.2% for the individual coating and the co-coating, and 89.4% for the ALV A/B subgroup and J subgroup antibody detection kit/pullorum disease plate agglutination test of IDEXX and the self-constructed ELISA co-detection method for avian leukemia virus and Salmonella pullorum antibodies, indicating that the indirect ELISA method constructed by co-coating p27 and GroEL-. DELTA.8-1 could achieve the effect of the commercial detection method, and could detect both avian leukemia virus and Salmonella pullorum antibodies, and could detect the infection of avian leukemia virus and Salmonella pullorum as shown in Table 5.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of agriculture in China
<120> kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody
<130>MP1731682
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
cgggatccat gcctgtagtg attaagac 28
<210>2
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
cgctcgagct agggctggat agcagacg 28
<210>3
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cgcggatccc tgatcatcgc tgaagat 27
<210>4
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ccgctcgagt tccattgcac gcagcgc 27
Claims (6)
1. A kit for simultaneously detecting avian leukosis virus antibodies and salmonella pullorum antibodies is characterized by comprising: p27 protein, GroEL-delta 8-1 protein, enzyme-labeled secondary antibody, BSA, coating solution, blocking solution, developing solution and stop solution; the confining liquid is skim milk;
the total concentration of the p27 protein and the GroEL-delta 8-1 protein is 4 mu g/mL when being coated;
the mass ratio of the GroEL-delta 8-1 protein to the p27 protein in coating is 1: 2;
the preparation method of the p27 protein comprises the following steps: using SEQ ID NO: 1 and the sequence shown in SEQ ID NO: 2 to obtain a p27 gene fragment, inserting the p27 gene into a prokaryotic expression vector, transferring the prokaryotic expression vector into an expression host, and performing induced expression, thallus collection, cracking and purification to obtain a p27 protein;
the preparation method of the GroEL-delta 8-1 protein comprises the following steps: using SEQ ID NO: 3 and the upstream primer shown in SEQ ID NO: 4 to obtain a GroEL-delta 8-1 gene segment, inserting the GroEL-delta 8-1 gene into a prokaryotic expression vector, transferring the prokaryotic expression vector into an expression host, and obtaining GroEL-delta 8-1 protein through induced expression, thallus collection, cracking and purification.
2. The kit of claim 1, wherein the enzyme-labeled secondary antibody is horseradish peroxidase-labeled rabbit anti-chicken IgG.
3. The kit according to claim 1, wherein the coating solution is a coating solution having a pH of 9.6.
4. The kit of claim 1, wherein the BSA is 0.5% BSA by mass.
5. The kit according to claim 1, wherein the color developing solution is a TMB color developing solution.
6. The kit of any one of claims 1 to 5, wherein the kit further comprises an elisa plate and/or a PBST buffer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810575755.2A CN108709995B (en) | 2018-06-06 | 2018-06-06 | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810575755.2A CN108709995B (en) | 2018-06-06 | 2018-06-06 | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108709995A CN108709995A (en) | 2018-10-26 |
| CN108709995B true CN108709995B (en) | 2020-05-22 |
Family
ID=63870406
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810575755.2A Active CN108709995B (en) | 2018-06-06 | 2018-06-06 | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108709995B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113325176A (en) * | 2021-06-02 | 2021-08-31 | 贵州大学 | Double-antibody sandwich direct ELISA (enzyme-Linked immuno sorbent assay) method for detecting avian leukosis P27 |
| CN113341140A (en) * | 2021-06-02 | 2021-09-03 | 贵州大学 | Indirect ELISA (enzyme-linked immunosorbent assay) method for detecting avian leukosis P27 |
| CN113519455A (en) * | 2021-08-02 | 2021-10-22 | 北京市华都峪口禽业有限责任公司 | Chicken white diarrhea field detection method |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040137525A1 (en) * | 2002-10-16 | 2004-07-15 | Jolley Michael E. | Detection of salmonella cells by fluorescence polarization |
| CN1530658A (en) * | 2003-03-17 | 2004-09-22 | 上海博N微晶科技有限公司 | Mixed making out of style enzyme linked immunosorbent assay for multiple infectious blood diseases |
| CN102636644B (en) * | 2012-04-18 | 2014-08-13 | 中国农业科学院哈尔滨兽医研究所 | Double-antibody sandwich ELISA (enzyme linked immunosorbent assay) kit used for detecting avian leukosis group specific antigen |
| CN103163299A (en) * | 2013-02-05 | 2013-06-19 | 扬州大学 | Avian leukosis double-antibody sandwich enzyme-linked immuno sorbent assay (ELISA) antigen detection kit |
| CN103995126B (en) * | 2014-04-18 | 2015-10-14 | 中国农业大学 | A kind of ELISA kit detecting S. pullonum antibody |
-
2018
- 2018-06-06 CN CN201810575755.2A patent/CN108709995B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN108709995A (en) | 2018-10-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108709995B (en) | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody | |
| Hasoksuz et al. | Biologic, antigenic, and full-length genomic characterization of a bovine-like coronavirus isolated from a giraffe | |
| CN108776221B (en) | Kit for simultaneously detecting avian leukosis virus antibody and salmonella pullorum disease antibody | |
| CN106226519A (en) | A kind of O type antibodies against foot-and-mouth disease virus chemiluminescence detection kit | |
| CN105606826A (en) | Kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay | |
| CN107974513A (en) | A kind of bovine viral diarrhea virus detection kit and its application based on RPA | |
| KR101667122B1 (en) | Improved vaccine diagnostics | |
| CN106443015A (en) | ELISA (Enzyme Linked Immunosorbent Assay) kit for detecting fowl adenovirus antibody based on hexon protein N-terminal conservative area | |
| CN108918869B (en) | Application of fiber2 protein and recombinant protein thereof in detecting serum type 4 avian adenovirus antibody | |
| Ito et al. | Virulence marker candidates in N-protein of viral haemorrhagic septicaemia virus (VHSV): virulence variability within VHSV Ib clones | |
| CN107102148A (en) | A kind of porcine reproductive and respiratory syndrome virus antibody detection method and its application | |
| CN107449912A (en) | Anti- H7N9 subtype avian influenza virus monoclonal antibody antigen epitope and its screening technique and application | |
| CN106771237B (en) | A kind of ELISA kit for detecting porcine sapelo virus antibody | |
| CN110484510B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
| WO2018166079A1 (en) | Applications of anaplasma phagocytophilum protein aph1384 | |
| CN110221060B (en) | Antigen for early diagnosis of haemonchus contortus infection and application thereof | |
| CN115141810B (en) | Hybridoma cell strain secreting monoclonal antibody against mycoplasma synoviae and application | |
| CN109580945B (en) | Enzyme linked immunosorbent assay kit for detecting O-type Guangxi strain antigen of foot-and-mouth disease and application thereof | |
| CN109521199B (en) | Colloidal gold detection kit for detecting avian leukosis virus and application thereof | |
| Chen et al. | A novel blocking ELISA for detection of antibodies against hepatitis E virus in domestic pigs | |
| CN106701687A (en) | Hybridoma cell strain and rabies virus phosphoprotein monoclonal antibody generated by same | |
| CN108101974B (en) | Fasciola hepatica multi-epitope fusion diagnostic antigen and application and preparation method thereof | |
| KR101080071B1 (en) | Rift valley fever competition ELISA using monoclonal antibodies against recombinant N protein | |
| CN112980802B (en) | Hybridoma cell secreting novel duck reovirus sigma B protein monoclonal antibody, monoclonal antibody and application | |
| Ignjatovic et al. | Detection of avian leukosis virus with the ELISA system: evaluation of conjugation methodology and comparison of sensitivity with the phenotypic mixing test in commercial layer flocks |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |