CN108660224B - Primer and method for identifying Siberian sturgeons, Acipenser schrenki and filial generations thereof - Google Patents
Primer and method for identifying Siberian sturgeons, Acipenser schrenki and filial generations thereof Download PDFInfo
- Publication number
- CN108660224B CN108660224B CN201810693273.7A CN201810693273A CN108660224B CN 108660224 B CN108660224 B CN 108660224B CN 201810693273 A CN201810693273 A CN 201810693273A CN 108660224 B CN108660224 B CN 108660224B
- Authority
- CN
- China
- Prior art keywords
- sturgeon
- primer
- siberian
- taking
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer and a method for identifying Siberian sturgeon, Acipenser schrenki and filial generation thereof, which consists of a Siberian sturgeon primer pair and a microsatellite primer pair As1, wherein the sequence of a forward primer of the Siberian sturgeon primer pair is shown As SEQ ID No.1, and the sequence of a backward primer is shown As SEQ ID No. 2; the sequence of the forward primer of the microsatellite primer pair As1 is shown As SEQ ID No.3, and the sequence of the backward primer is shown As SEQ ID No. 4. The primers and the method can be used for simply and quickly distinguishing the Siberian sturgeons, the Acipenser schrenki and filial generations thereof.
Description
Technical Field
The invention belongs to the field of molecular biology, and particularly relates to primers and a method for identifying Siberian sturgeons, Acipenser schrenki and filial generations thereof.
Background
Sturgeon schneideriana and sturgeon siberian are 2 important breeding varieties in China. Under natural conditions, the sturgeon is only distributed in a water system of the Heilongjiang (Amur river), is a special species and important economic fish of the Heilongjiang, has high growth speed, poor disease resistance and transportation intolerance, is difficult to domesticate due to excessive dependence on live baits, has high death rate in the culture process, and increases the risk of sturgeon culture industry. Siberian sturgeons are mainly distributed in the Central Asia and the east Europe, and are distributed in a small amount in the frontal Zisi river water system in China, so that the growth speed is slow, but the disease resistance is strong, and the transportation is resistant.
The hybrid combination breeding of the Siberian sturgeon and the Acipenser schrenki is successful in China around 2007, and the hybrid combination breeding is called 'West hybrid' as the effect difference of the positive cross and the negative cross is not large. Compared with parents, the Xiza has obvious production advantages, strong adaptability, high growth speed, strong disease resistance and high transportation survival rate. After the western hybrid breeding is successful, the breeding is rapidly popularized and cultured in the national range, and the breeding is now the main breeding variety in the northeast, north China, east China and China, and is the variety with the largest scale and yield of commercial sturgeons in China at present.
Partial research has been carried out on the paternity test of the West hybrids and the parents thereof, and the research mainly focuses on the research of isoenzyme biochemical markers. Wu Yi and the like adopt polyacrylamide gel vertical plate electrophoresis to analyze Esterase (EST), Malate Dehydrogenase (MDH) and Alcohol Dehydrogenase (ADH)3 isozymes of 5 tissues (heart, liver, muscle, eye and kidney) of 4 groups of sturgeon, Siberian sturgeon and positive and negative hybrids thereof, and find that the 3 isozymes have obvious tissue specificity in each group; obvious regularity difference is shown among 4 different sturgeon groups, and the method can be used as a biochemical genetic marker for distinguishing the 4 sturgeons. The Yihong Bin is similar to that of Yihong Bin, and through adopting polyacrylamide gel electrophoresis method to make 9 kinds of isoenzyme expression analysis on 5 tissues of 4 groups, the expression of the enzyme band of hybrid species is more complex than that of parent species, but is more similar to that of parent species, and through clustering analysis, the expression of Acipenser schrenki, Acipenser schrenki (female parent) x Siberian sturgeon
The hybrid species are gathered into the same branch, i.e. Siberian sturgeon and Siberian sturgeon (female parent) x
The hybrid is clustered into another branch. Although the method is simple to operate and easy to learn and master, the sample preparation is complex, the difference of bands generated among samples is small, and the method is very easily influenced by various conditions in a sample collection method and an experimental process, so that in recent years, the method has fewer reports in sturgeon identification and is mainly used for health assessment and determination of sturgeon individuals under artificial feeding conditions. In order to better match the Western hybrid and the parent Siberian sturgeon and Acipenser schrenki sturgeonThe identification is carried out, so that a rapid, stable and reliable method is urgently needed to be developed, and a reliable basis is provided for subsequent research.
The Xiza in the invention refers to filial generation by taking Siberian sturgeon as a female parent and taking Acipenser schrenki as a male parent; the hybridization refers to the filial generation of the Siberian sturgeon which is taken as the female parent.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: how to rapidly, stably and reliably identify Siberian sturgeons, Acipenser schrenki and filial generations thereof.
The technical scheme of the invention is as follows: the primer for identifying the Siberian sturgeons, the Acipenser schrencki and the filial generations thereof is composed of a Siberian sturgeon primer pair and a microsatellite primer pair As1, wherein the forward primer sequence of the Siberian sturgeon primer pair is shown As SEQ ID No.1 (CAGATGCCAGTAACAGGCTGA), and the backward primer sequence is shown As SEQ ID No.2 (TATACACCATTATCTCTATGT); the sequence of the forward primer of the microsatellite primer pair AS1 is shown AS SEQ ID No.3 (AACAAGCGACGAACAGTGTG), and the sequence of the backward primer is shown AS SEQ ID No.4 (GAAAGGACACCAGCAGTG).
The primers for identifying the Siberian sturgeons, the Acipenser schrenki and the filial generations thereof are used for identifying the Siberian sturgeons, the Acipenser schrenki and the filial generations thereof.
The invention also provides a method for identifying the Siberian sturgeon, the Acipenser schrenki and the filial generation thereof, which comprises the following steps:
(1) taking sturgeon DNA to be identified As a template, taking a microsatellite primer pair As1 As a primer to carry out PCR amplification, and if an amplification product of 200bp but not an amplification product of 105bp appears, taking sturgeon As the template; if 105bp amplification products but not 200bp amplification products appear, the sturgeon is obtained; if the amplification products of 105bp and 200bp appear simultaneously, the hybridization is carried out or West hybridization;
(2) identifying sturgeon DNA identified as either west-bred or bred: taking sturgeon DNA to be identified as a template, taking a Siberian sturgeon primer pair as a primer for PCR amplification, and if an amplification product of 215bp appears, taking the sturgeon DNA as a West hybridization; otherwise, applying impurities;
the sequence of a forward primer of the Siberian sturgeon primer pair is shown as SEQ ID No.1, and the sequence of a backward primer is shown as SEQ ID No. 2; the sequence of the forward primer of the microsatellite primer pair As1 is shown As SEQ ID No.3, and the sequence of the backward primer is shown As SEQ ID No. 4.
Compared with the prior art, the invention has the following beneficial effects:
the primers and the method can be used for simply and quickly distinguishing the Siberian sturgeons, the Acipenser schrenki and filial generations thereof.
Drawings
FIG. 1 is a polyacrylamide gel electrophoresis pattern of the amplification product of the primer pair of Acipenser sibirica;
FIG. 2A polyacrylamide gel electrophoresis pattern of the amplification product of microsatellite primer pair As 1.
Detailed Description
1.1. Material
1.1 Experimental materials:
parent sample: siberian sturgeon 34 parts, sturgeon 10 parts (part of fin is preserved with absolute ethyl alcohol)
Progeny samples: 12 Xiza and 12 Shiza (the whole is preserved with absolute ethyl alcohol)
1.2 experimental equipment:
a PCR instrument: Bio-Rad iCycler and MJ 100;
a centrifuge: eppendorf Centrifuge 5415D;
voltage-stabilizing and current-stabilizing electrophoresis apparatus: Bio-Rad powerPAC 300;
gel imaging system: alphalmage multimap Light cassette;
electronic balance, constant temperature water tank, incubator, steam sterilizer, shaking table, centrifuge and some common experimental facilities.
1.3 main drugs and reagents:
double distilled water (MilliQ) and disodium diaminetetraacetate (EDTA-Na.2H)2O), proteinase K (Merck) (10mg/mL), Tris base, concentrated hydrochloric acid, NaOH, MgCl2Taq enzyme buffer, dNTPs (10mM), etc.
2. Method of producing a composite material
2.1 extraction of Total genomic DNA
Tissue material (not more than 30 mg) was excised, placed in a centrifuge tube containing 200 μ lGA buffer (the centrifuge tube was labeled), and vortexed for 15 sec.
② adding 20 mul of protease K (20mg/ml) solution, mixing evenly by vortex, centrifuging briefly to remove water drops on the inner wall of the tube cover, placing (digesting) at 56 ℃ until the tissue is completely dissolved, centrifuging briefly to remove water drops on the inner wall of the tube cover, and then carrying out the next step.
And thirdly, adding 200 mu l of buffer solution GB, fully reversing and uniformly mixing, standing at 70 ℃ for 10min, strain-clearing the solution, and centrifuging briefly to remove water drops on the inner wall of the tube cover. (Note: it should be put in a refrigerator at 4 ℃ C. while waiting)
Adding 200 mu l of absolute ethyl alcohol, fully reversing and mixing evenly, wherein flocculent precipitates can appear, and centrifuging briefly to remove water drops on the inner wall of the tube cover.
Fifthly, adding the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (the adsorption column is placed into a collecting pipe and marked), centrifuging at 12000rpm (13 to 400 Xg) for 30sec, pouring the waste liquid, and placing the adsorption column CB3 back into the collecting pipe.
Sixthly, 500 microliter of buffer GD (whether absolute ethyl alcohol is added before use or not is checked) is added into the adsorption column CB3, the mixture is centrifuged at 12000rpm (-13,400 Xg) for 30sec, waste liquid is poured out, and the adsorption column CB3 is placed into a collecting pipe.
Seventhly, 600 mul of buffer solution PW (whether absolute ethyl alcohol is added or not is checked before use) is added into the adsorption column CB3, the adsorption column CB3 is placed into a collection tube after the adsorption column CB is centrifuged for 30sec at 12000rpm (-13, 400 Xg), waste liquid is poured off.
And (8) repeating the step (7).
Ninthly, putting the adsorption column CB3 back into the collecting pipe, centrifuging at 12000rpm (-13, 400 Xg) for 30sec, pouring the waste liquid, and placing the adsorption column CB3 at room temperature for a plurality of minutes (about 10min) so as to thoroughly dry the residual rinsing liquid in the adsorption material. (Note: the purpose of this step is to remove the residual rinsing solution in the adsorption column, which could affect the subsequent enzyme reaction (digestion, PCR, etc.) experiment)
Transferring the adsorption column CB3 into a clean centrifugal tube, suspending and dropwise adding 50-200 mu l of washing liquid to the middle part of the adsorption filmDecuffering solution TE (ddH for this experiment)2O), standing at room temperature for 2-5 min, centrifuging at 12000rpm (13, 400 Xg) for 2min, and collecting the solution in a centrifuge tube.
2.2 agarose gel electrophoresis detection of DNA
Firstly, preparing 1% agarose gel, namely weighing 0.4-0.6 g agarose by using balance, pouring about 45mL of 1 time of TAE buffer solution, shaking uniformly, placing in a microwave oven, heating at high temperature until the buffer solution is completely dissolved, taking out, cooling slightly, and adding EB 2 uL.
Preparing a rubber plate: the rubber-making plate was placed in a horizontal position and then a sample comb was inserted. Pouring the agarose gel solution prepared in the last step into a plate making groove. Cooling for half an hour, slightly pulling out the comb after the gel is fixed, and putting the gel into the electrophoresis tank. The TAE solution was added to immerse the gel.
Adding sample: 1/6 volumes of spotting buffer (bromophenol blue) were spotted onto the spotting plate, after which 2uL of DNA solution was pipetted into the spotting buffer and mixed well, and the order of spotting and the amount of spotting were recorded.
Running electrophoresis: 100V voltage, 400mA current, electrophoresis for 15-20 min. Determining the concentration of template DNA according to the electrophoresis brightness of the ultraviolet transmission detector after electrophoresis, and if the concentration is high, adding a proper amount of MilliQ (ddH)2O), and if the concentration is low, the addition amount can be increased in a proper amount during PCR amplification. The detected DNA is stored in a refrigerator at the temperature of 20 ℃ below zero for later use.
2.3 primer design
According to the mitochondrial sequence and the microsatellite sequence of sturgeon, two pairs of primers are designed and named as Siberian sturgeon primer pair and microsatellite primer pair HLJS41 respectively, and the primers are synthesized by Chengdu Hippon Biotechnology Limited.
The sequence of the forward primer of the Siberian sturgeon primer pair is CAGATGCCAGTAACAGGCTGA (shown in SEQ ID No. 1)
The backward primer sequence of the Siberian sturgeon primer pair is TATACACCATTATCTCTATGT (shown in SEQ ID No. 2)
The sequence of the forward primer of the microsatellite primer pair As1 is AACAAGCGACGAACAGTGTG (shown in SEQ ID No. 3)
The rear primer sequence of the microsatellite primer pair As1 is GAAAGGACACCAGCAGTG (shown in SEQ ID No. 4)
2.4PCR amplification System and conditions
PCR amplification of the Siberian sturgeon primer pair: the total amount of the PCR reaction system was 25. mu.L (template 1. mu. L, Mix 12.5.5. mu.L, ddH2O10.5. mu.L, forward primer 0.5. mu.L, and reverse primer 0.5. mu.L). The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 5 min; then circulating 35 times, wherein each circulation comprises denaturation at 94 ℃ for 40s, annealing at 55 ℃ for 35s and extension at 72 ℃ for 50 s; and finally extension at 72 ℃ for 10 min. After gel electrophoresis of the PCR product with 120v of 1.5% agarose, the amplified fragment was detected by UV light.
And (3) carrying out PCR amplification on the microsatellite primer pair As 1: the total amount of the PCR reaction system was 25. mu.L (template 1. mu. L, Mix 12.5.5. mu.L, ddH2O10.5. mu.L, forward primer 0.5. mu.L, and reverse primer 0.5. mu.L). The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 5 min; then circulating 35 times, wherein each circulation comprises denaturation at 94 ℃ for 40s, annealing at 55 ℃ for 35s and extension at 72 ℃ for 50 s; and finally extension at 72 ℃ for 10 min. And (3) detecting the PCR reaction product by using 10% non-denatured Polyacrylamide Gel (PAAG for short) electrophoresis, and storing a data result after dyeing-developing-scanning imaging by using an improved silver staining method after the electrophoresis is finished.
3. Results
3.1 mitochondrial identification
The acipenser baerii primer pair has a specific band with a length of 215bp in the PCR amplification using the hybrid progeny DNA of acipenser baerii and the acipenser baerii as female parents as a template, and has no specific band in the PCR amplification using the acipenser baerii and the hybrid progeny DNA of acipenser baerii as female parents as a template (fig. 1).
The microsatellite primer pair As1 has a 200bp strip in PCR amplification by taking Acipenser schrenki DNA As a template, has a 105bp strip in PCR amplification by taking Acipenser sibirica DNA As a template, and has 105bp and 200bp heterozygous strips in PCR amplification by taking hybrid germplasm DNA thereof As a template, and the amplified specific strips can effectively identify 3 germplasms (figure 2);
4 analysis of results
According to the results, the sturgeon DNA to be identified is taken As a template, the microsatellite primer pair As1 is taken As a primer for PCR amplification, and if 200bp amplification products but not 105bp amplification products appear, sturgeon is taken; if 105bp amplification products but not 200bp amplification products appear, the sturgeon is obtained; if the amplification products of 105bp and 200bp appear simultaneously, the hybridization is carried out or West hybridization;
further characterization of sturgeon DNA identified as either west-bred or bred: taking sturgeon DNA to be identified as a template, taking a Siberian sturgeon primer pair as a primer for PCR amplification, and if an amplification product of 215bp appears, taking the sturgeon DNA as a West hybridization; otherwise, the impurities are removed.
Examples
(1) Taking sturgeon DNA to be identified As a template (the extraction method adopts the extraction method of 2 total genomic DNAs), taking a microsatellite primer pair As1 As a primer to carry out PCR amplification, wherein the total amount of a PCR reaction system is 25 mu L (the template is 1 mu L, the Mix12.5 mu L, the ddH2O10.5 mu L, the upstream primer is 0.5 mu L, and the downstream primer is 0.5 mu L). The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 5 min; then circulating 35 times, wherein each circulation comprises denaturation at 94 ℃ for 40s, annealing at 55 ℃ for 35s and extension at 72 ℃ for 50 s; and finally extension at 72 ℃ for 10 min. And (3) detecting the PCR reaction product by using 10% non-denatured Polyacrylamide Gel (PAAG for short) electrophoresis, and storing a data result after dyeing-developing-scanning imaging by using an improved silver staining method after the electrophoresis is finished. If the amplification product of 200bp does not occur, the sturgeon is sturgeon, and the amplification product of 105bp does not occur; if 105bp amplification products but not 200bp amplification products appear, the sturgeon is obtained; if the amplification products of 105bp and 200bp appear simultaneously, the hybridization is carried out or West hybridization;
(2) further characterization of sturgeon DNA identified as either west-bred or bred: taking sturgeon DNA to be identified as a template and taking a Siberian sturgeon primer pair as a primer to carry out PCR amplification, wherein the total amount of a PCR reaction system is 25 mu L (the template is 1 mu L, the Mix12.5 mu L, the ddH2O10.5 mu L, the upstream primer is 0.5 mu L and the downstream primer is 0.5 mu L). The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 5 min; then circulating 35 times, wherein each circulation comprises denaturation at 94 ℃ for 40s, annealing at 55 ℃ for 35s and extension at 72 ℃ for 50 s; and finally extension at 72 ℃ for 10 min. After gel electrophoresis of the PCR product with 120v of 1.5% agarose, the amplified fragment was detected by UV light. If the 215bp amplification product appears, the product is West hybrid; otherwise, the impurities are removed.
Claims (1)
1. A method for identifying Siberian sturgeons, Acipenser schrenki and filial generations thereof is characterized by comprising the following steps:
(1) taking sturgeon DNA to be identified As a template, taking a microsatellite primer pair As1 As a primer to carry out PCR amplification, and if an amplification product of 200bp but not an amplification product of 105bp appears, taking sturgeon As the template; if 105bp of amplification product does not occur, the product is the Siberian sturgeon; if the amplification products of 105bp and 200bp appear simultaneously, the hybridization is carried out or West hybridization; the sturgeon to be identified is Siberian sturgeon, Acipenser schrenki, Siberian sturgeon or Siberian sturgeon; the Siberian sturgeon is a filial generation taking Siberian sturgeon as a female parent and sturgeon as a male parent; the hybridization refers to the filial generation of the Siberian sturgeon which is taken as the female parent;
(2) identifying sturgeon DNA identified as either west-bred or bred: taking sturgeon DNA to be identified as a template, taking a Siberian sturgeon primer pair as a primer for PCR amplification, and if an amplification product of 215bp appears, taking the sturgeon DNA as a West hybridization; otherwise, applying impurities; the sequence of the forward primer of the Siberian sturgeon primer pair is CAGATGCCAGTAACAGGCTGA, and the sequence of the backward primer is TATACACCATTATCTCTATGT; the sequence of the forward primer of the microsatellite primer pair As1 is AACAAGCGACGAACAGTGTG, and the sequence of the backward primer is GAAAGGACACCAGCAGTG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810693273.7A CN108660224B (en) | 2018-06-29 | 2018-06-29 | Primer and method for identifying Siberian sturgeons, Acipenser schrenki and filial generations thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810693273.7A CN108660224B (en) | 2018-06-29 | 2018-06-29 | Primer and method for identifying Siberian sturgeons, Acipenser schrenki and filial generations thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108660224A CN108660224A (en) | 2018-10-16 |
| CN108660224B true CN108660224B (en) | 2021-10-29 |
Family
ID=63773235
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810693273.7A Active CN108660224B (en) | 2018-06-29 | 2018-06-29 | Primer and method for identifying Siberian sturgeons, Acipenser schrenki and filial generations thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660224B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1936567A (en) * | 2005-09-19 | 2007-03-28 | 中国水产科学研究院黑龙江水产研究所 | Technology for appraising acipenser schrencki and Acipenser datryanus |
| CN105861642A (en) * | 2015-02-11 | 2016-08-17 | 华大(镇江)水产科技产业有限公司 | Sturgeon sexuality difference molecular marker and application thereof |
| CN107828899A (en) * | 2017-11-22 | 2018-03-23 | 镇江华大检测有限公司 | Differentiate the molecular specificity labeled primers and method of mandarin sturgeon |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009080864A1 (en) * | 2007-12-20 | 2009-07-02 | Riista- Ja Kalatalouden Tutkimuslaitos | Method for the production of fish progeny |
| CN103436610A (en) * | 2013-08-20 | 2013-12-11 | 徐鹏 | PCR-RFLP rapid detection method for common sturgeons |
| CN105567789B (en) * | 2014-10-08 | 2018-12-25 | 北京市水产科学研究所 | The PCR primer pair composition and its application of identification or auxiliary identification sturgeon germplasm |
| CN105063192B (en) * | 2015-07-31 | 2017-08-25 | 中国长江三峡集团公司 | Molecular labeling and its application for identifying Amur Sturgeon germplasm |
| FR3055905B1 (en) * | 2016-09-13 | 2018-10-26 | Universite De Toulon | PRECISE SEXING METHOD OF STURGEON |
| CN106939348A (en) * | 2017-04-28 | 2017-07-11 | 四川省农业科学院水产研究所 | A kind of microsatellite marker primer and its authentication method for acipenser dabryanus Parentage determination |
-
2018
- 2018-06-29 CN CN201810693273.7A patent/CN108660224B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1936567A (en) * | 2005-09-19 | 2007-03-28 | 中国水产科学研究院黑龙江水产研究所 | Technology for appraising acipenser schrencki and Acipenser datryanus |
| CN105861642A (en) * | 2015-02-11 | 2016-08-17 | 华大(镇江)水产科技产业有限公司 | Sturgeon sexuality difference molecular marker and application thereof |
| CN107828899A (en) * | 2017-11-22 | 2018-03-23 | 镇江华大检测有限公司 | Differentiate the molecular specificity labeled primers and method of mandarin sturgeon |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108660224A (en) | 2018-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399523B (en) | A kind of molecular labeling SV193 and its application technology distinguishing Chinese native pig breed and Large White | |
| CN106906303A (en) | One SNP marker for influenceing quality character of pork and its application | |
| CN103866032B (en) | A kind of method and application thereof detecting goat STAT3 gene mononucleotide polymorphism | |
| CN102719426A (en) | Method for extracting genomic DNA (deoxyribonucleic acid) in milk appropriate for large-scale genotype identification | |
| CN110724735B (en) | SNP locus and primer for rapidly identifying individual sex of fugu obscurus and method thereof | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN115341035A (en) | SNP molecular marker for selecting laying weight of hens | |
| CN108660224B (en) | Primer and method for identifying Siberian sturgeons, Acipenser schrenki and filial generations thereof | |
| CN108531620B (en) | Primer and method for identifying acipenser schrencki, acipenser sibiricus and filial generation thereof | |
| CN106947806A (en) | A kind of method and its application based on ATF3 identified for genes cow producing milk characters | |
| CN108660223B (en) | Siberian sturgeon and identification method of Siberian sturgeon | |
| CN109825600A (en) | One kind SNP marker relevant to Suhuai pig muscle drip loss and detection method | |
| CN109439771A (en) | A method of hybridization porgy family is identified using microsatellite marker | |
| CN101899500B (en) | Method for detecting single nucleotide polymorphism of cattle krupple-like factor (KLF) 7 gene | |
| CN105219842B (en) | The method and kit of tumor susceptibility gene in multistage PCR detections gynaecology swab sample | |
| CN106282379B (en) | Hybridize the CH of Pelteobagrus fulvidraco4Digestion identification method | |
| CN112029868A (en) | Portunus trituberculatus microsatellite markers and application thereof in growth trait association analysis | |
| CN101875977B (en) | Method for detecting mononucleotide polymorphism of scalper SREBP1c gene | |
| CN116751868B (en) | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof | |
| CN116103413B (en) | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof | |
| CN110616270A (en) | COI gene sequence-based molecular identification method of beta and beta | |
| CN113151490B (en) | Growth character molecular marker auxiliary selection method based on cattle LOC107131166 gene CNV marker | |
| CN114752685B (en) | Molecular marker for vannamei and primer and application thereof | |
| CN107988386A (en) | A kind of SSR fluorescent dye primers and application for Mandarin fish paternity test | |
| CN114592068B (en) | High-fertility molecular marker X1W1 of litopenaeus vannamei and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |