CN108588254A - The detection kit and detection method of eclipta - Google Patents
The detection kit and detection method of eclipta Download PDFInfo
- Publication number
- CN108588254A CN108588254A CN201810354793.5A CN201810354793A CN108588254A CN 108588254 A CN108588254 A CN 108588254A CN 201810354793 A CN201810354793 A CN 201810354793A CN 108588254 A CN108588254 A CN 108588254A
- Authority
- CN
- China
- Prior art keywords
- eclipta
- seq
- detection
- dna
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of eclipta specific SCAR molecular labeling, the primer pair and application thereof for expanding the molecule labelled series is also disclosed, the detection kit and detection method of eclipta are also disclosed.Detection kit and detection method of the present invention can be accurate and effective discriminating eclipta, high specificity, take it is short, application prospect is good.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of detection kit of eclipta and detection side
Method.
Background technology
Eclipta is the herb of feverfew Eclipta prostrata (Eclipta prostrate), extracts herb in annual summer, two season of autumn,
Silt is removed, drying or drying in the shade can be used as medicine.When cauline leaf due to crumpling it, it is seen that the juice of black is flowed out and gained the name.Herb
It is medicinal, mainly contain triterpenes, Coumarether, flavonoids, steroid, the substances such as thiophene-based and volatile oil, with very strong
Immunological regulation, liver protection, anti-fibrosis, antitumor, Green Tea Extract be anti-oxidant and the pharmacological actions such as enzyme activition, is clinically usually used in controlling
Treat haematemesiss, bleeding from five sense organs or subcutaneous tissue, hematuria, have blood in stool, bloody flux, knife wound bleeding, poliosis, diphtheria, stranguria with turbid discharge, under, the wet diseases such as itch of private parts.
But eclipta is similar with penthorum chinense pursh form, is easy to obscure, to influence the accuracy of medication.Therefore, effectively differentiate
Eclipta is very important.
Invention content
In order to overcome the deficiencies of existing technologies, the present invention provides a kind of examinations easily and fast, accurately detecting eclipta
Agent box and method.
The present invention provides a kind of eclipta specific SCAR molecular labeling, nucleotide sequence such as SEQ ID NO.1 institutes
Show.
The present invention also provides the primer pairs of nucleotide sequence shown in amplification SEQ ID NO.1.
Wherein, it is primer pair shown in NO.2~3 SEQ ID.
The present invention also provides the purposes of above-mentioned SCAR molecular labelings, above-mentioned primer pair in detecting eclipta.
The present invention also provides a kind of detection kits of eclipta, including nucleotides sequence described in detection SEQ ID NO.1
The reagent of row.
Wherein, the reagent includes the reagent for expanding nucleotide sequence shown in SEQ ID NO.1.
Wherein, the reagent of the amplification includes primer pair shown in NO.2~3 SEQ ID.
Wherein, the eclipta is the eclipta for originating from Sichuan, Jiangxi, Anhui.
The present invention also provides a kind of detection methods of eclipta, include the following steps：
A, DNA is extracted：Extract the DNA in sample to be checked；
B, it detects：Sample to be checked is detected with above-mentioned kit, you can.
The present invention can effectively identify whether sample to be checked is black drought by detecting eclipta specific SCAR molecular labeling
Lotus accurately distinguishes eclipta and penthorum chinense pursh and other floristics, and the reasonable employment for eclipta medicinal material provides guidance,
The method of the present invention is easy to operate, has a good application prospect.
Obviously, the above according to the present invention is not being departed from according to the ordinary technical knowledge and customary means of this field
Under the premise of the above-mentioned basic fundamental thought of the present invention, the modification, replacement or change of other diversified forms can also be made.
The specific implementation mode of form by the following examples remakes further specifically the above of the present invention
It is bright.But the range that this should not be interpreted as to the above-mentioned theme of the present invention is only limitted to example below.It is all to be based on the above of the present invention
The technology realized all belongs to the scope of the present invention.
Description of the drawings
The improvement RAPD amplifications of Fig. 1 ecliptas.Arrow is the RPAD segments of A11-21 amplifications, recycles and clones for glue.
Channel 1-9 be catching up with from Jiangxi, Anhui, Shaanxi, Hunan, Luzhou, Sichuan, Xichang Sichuan, Guizhou, Hubei and Shanxi respectively
Yellow grass, 10 be the eclipta from Luzhou.
The bacterium colony PCR identifications of Fig. 2 positive colonies.The positive colony in black meaning channel is sequenced for Sanger.Channel " M "
Show the DL2000 DNA markers of molecular wt (bp).Swimming lane 3-4 respectively represents the bacterium colony of different positive colonies.
The identification of Fig. 3 difference eclipta kinds.Channel 1,2 and 3 is the eclipta from Sichuan, Jiangxi and Anhui；4,5,6
It is to come from Sichuan, the penthorum chinense pursh in Jiangxi and Anhui.
The identification of Fig. 4 different plant species and eclipta kind.Channel 1-14 is respectively penthorum chinense pursh, eclipta, Chinese olive, osmanthus
Circle, lichee, peppermint, matrimony vine, Radix Angelicae Sinensis, ginkgo, Artemisia santonica, red sesame, purple sesame, cape jasmine, wormwood." M " shows molecular wt in channel
(bp) DL2000 DNA markers.
Specific implementation mode
It is described further below with embodiment, but the present invention is not limited to these embodiments.
The raw material that is used in the specific embodiment of the invention, equipment are known product, pass through and buy commercial product and obtain.
Embodiment 1RAPD technologies expand the special SCAR mark of eclipta
One, CTAB methods extract DNA of plants
It takes eclipta 0.2g to be placed in 1.5mL EP pipes, is added after liquid nitrogen half a minute and pulverizes into fine powder with mortar stick, immediately
CTAB Extraction buffers [CTAB2%, Tris-HCl (pH8.0) 100mmolL_ of 500 μ l is added1, EDTA20mmol
mmol·L_1, NaCL 1.4molL_1, 0.4% beta -mercaptoethanol], after 60 DEG C of water-baths keep the temperature 1 hour, it is added isometric
Chloroform-isoamyl alcohol (24：1) it extracts, gently overturns mixing, 10000 rpms centrifuge 10 minutes, and Aspirate supernatant takes and resets and add
The isopropanol for entering the precooling of 2/3 volume, gently turn upside down mixing；12000 rpms centrifuge 10 minutes, abandon supernatant, carefully
Incline supernatant, precipitates 70% ethyl alcohol and absolute ethyl alcohol respectively rinses once, abandon washing lotion, stay precipitation, be air-dried.With 100 μ l
1 × TE solution dissolving it is spare.The concentration and quality that sample is detected to DNA with 1% agarose gel electrophoresis, use spectrophotometer
Measured concentration is diluted to concentration 10ng/ μ l, and -20 DEG C save backup.It refers to《Fine works Medical Molecular Biology experiment instruction》(in
Medical Science Press of state, chief editor：Fu Junjiang).
Two, RAPD technologies PCR amplification
It is expanded (with reference to Fu J, Yang L, Khan MA, Mei Z (2013) Genetic using RAPD technologies
characterization and authentication of Lonicera japonica Thunb.by using
improved RAPD analysis.Mol Biol Rep,40(10):5993-9)：
The nucleic acid extracted using step 1 is used as template, is expanded that (sequence is shown in Table 2, and Beijing is matched with RAPD primers SBA-A11
Company of Parkson synthesizes).
PCR amplification includes using 10 μ l reaction systems：The primer (2.5 μm of ol/L) of 1 μ l, 1.5 μ l (15ng) template DNAs, 5
The sterilizing distilled water in 2 × PCR Taq Mastermix (Tiangeng biotech firm, Beijing) and 2.5 μ l of μ l.After mixing well, in
Centrifuge 12000rpm centrifuges 15s, is placed in PCR instrument (Applied Biosystems96-Well Thermal
Cycler, Life Technology, USA).PCR reaction conditions are：95 DEG C 1 point 30 seconds, 94 DEG C 40 seconds, 36 degree 60 seconds, 72 DEG C 1
Points 30 seconds, 40 cycles, last 72 DEG C 5 minutes, wherein RAMP is 5%.Then with 1.5% agarose gel electrophoresis, exposure
Colour developing.
Table 1
Agarose gel electrophoresis (referring to《Fine works Medical Molecular Biology experiment instruction》, China Medical Science Press, master
It compiles：Fu Junjiang)：
(1) Ago-Gel for preparing 1.5%, by PCR product in order whole point samples to gel pore, while point sample one
A big tick marks of DNA molecular (DL2000, TIANGEN company, Beijing).Pay attention to：Loading buffer, PCR amplification need not be added to use
2 × mix with regard to pre-add Related Component.
(2) electrophoresis (electrophoresis apparatus is produced by the brilliant biological Co., Ltd in Beijing hundred, BG-subMID Icell), often selects voltage
110V, electrophoresis time 30min,
Three, the separation of RAPD amplified bands
1. segment recycles
1.5% agarose gel electrophoresis, under ultraviolet light one arrow of specific fragment figure of shearogram certified products eclipta kind
Shown in head, with the DNA fragmentation of DNA Ago-Gels QIAquick Gel Extraction Kit (Tiangeng biotech firm) recycling RAPD amplifications.
2. clone
Followed by pGEM-T carriers (Promega Corporation) and the DNA fragmentation of recycling RAPD amplifications in T4-
The lower connection of DNA ligase effect (16 DEG C connect 8 hours).The DH5 α bacteriums of 30 μ l activation are added after connection, ice bath 30 minutes connects
It 42 DEG C to activate 45 seconds, then ice bath 2 minutes, add LB culture medium (preparation methods of the 300 μ l without ampicillin：12.5
Gram LB powder adds 500ml water high-temperature sterilization) 200 rpms shake 45 minutes, then liquid is uniformly applied to the mould of benzyl containing ammonia
The solid LB media surface of element, 37 DEG C of cultures, 15 hours [solid medium preparation methods：12.5 grams of LB powder, 7.5 grams of agar powders
After 500 milliliters of water high-temperature sterilizations, the ampicillin (100mg/ml) of 500 μ l is added at 50 DEG C, is trained in solid using preceding
Support the 24mg/ of X-GAL (the chloro- 3- indoles-β-D- galactosides of the bromo- 4- of 5-) and 20 μ l of the 20mg/ml of 40 μ l of primary surface smearing
The IPTG (isopropylthiogalactoside) of ml] blue and white screening is carried out, screening white colony carries out bacterium colony PCR identifications.
3. positive clone identification
Each ware selects multiple white colonies, is added separately in 300 LB liquid mediums of the μ l containing ampicillin,
220 rpms are shaken 2-4 hours, and 0.2~0.5 μ l culture mediums is taken to carry out bacterium colony PCR reactions.The reaction system of 10 μ l volumes is：2
× PCR Taq Mastermix 5 μ l, DNA 0.5 μ l, 1 μ l of universal primer (SP6+T7) (2.5 μm of ol/L), 3.5 μ l of water.PCR
Reaction condition is：95 DEG C 1 point 30 seconds, 94 DEG C 40 seconds, 58 DEG C 30 seconds, 72 DEG C 40 seconds, 30 cycle, last 72 DEG C 5 minutes.Then
With 1.5% agarose gel electrophoresis, EB dyeing, exposure colour developing.
4. result
Fig. 1 is shown in improvement RAPD amplifications.The colony PCR amplification and electroresis appraisal result such as Fig. 2 of positive colony.
Five, sequencing analysis
1. sequencing
Positive colony is selected, Sanger sequencings are carried out.The nucleotide sequence of sequencing is following (shown in SEQ ID NO.1)：
TTTACAAAAGAGAATTCTTGTTCTTTTTTTCGTCAAAACTGAAATTCTTTAATATTATGTTTTGCTCTTTGTTCTCA
TTTCCAGCTTTATGGAGAAAATGCAAACCGGAGGTGATCTTAACCTCATCGGTCAGTTTGGTGTTGGATTTTATTCT
GTATATCTTGTTGCTGATTATGTGGAAGTGATAAGCAAACACAATGATGACAAACAGTATGCCTTCTGGTTTTTGTT
CTGCAGTAGTCGATTTTAGCTTTACTTATCAACTTGCTTCAACTTGTAACTTTTTAGGATGTGTGGGAGTCAACGGC
TGATGCCGCATTTGCGACTCTGAAGATACATACAATGAGCCACTCGGTCATGGTACTGAAATAAGATTGCATCTTAG
GAACGAAGCCGGAGAATATCTTGAAGAGTCAAAATTGAAGGATTTGGTGAAAAAATATTCGGAATTTATTAACTTCC
。
2. homology search and looking into new
The sequence as above that sequencing is obtained, in the websites NCBI (http：//www.ncbi.nlm.nih.gov/BLAST/) on
It is compared, has no identical or repetitive sequence, illustrate that such as it be new, the distinctive nucleotide sequence of eclipta, ink can be established
The special SCAR mark of non-irrigated lotus.
The gene of the method for the present invention specific amplified eclipta of embodiment 2
1, experimental method
(1) the special SCAR mark (sequence shown in SEQ ID NO.1) of the eclipta that is obtained according to embodiment 1, design
1 pair of primer, synthesis.
SEQ ID NO.2：A11-21L primers；
SEQ ID NO.3：A11-21R primers.
(2) PCR amplification
1, prepared by template
Detect penthorum chinense pursh and the eclipta of different regions:Eclipta from Sichuan, Jiangxi and Anhui and Sichuan is come from,
The penthorum chinense pursh in Jiangxi and Anhui.
Detect different plant species：14 different plant species or variety genome DNA are had chosen as template, they are respectively：
1-14 is respectively penthorum chinense pursh, eclipta, Chinese olive, longan, lichee, peppermint, matrimony vine, Radix Angelicae Sinensis, ginkgo, Artemisia santonica, red sesame, purple sesame, Cape jasmine
Son, wormwood.It is spare that it is diluted to 10ng/ μ l respectively.
Gene extracting method is the same as embodiment 1.
2, PCR amplification：
(1) PCR system (10 μ l)
After mixing well, 15s is centrifuged in centrifuge 12000rpm, is placed in PCR instrument (Applied Biosystems96-Well Thermal Cycler, Life Technology, USA).
(2) PCR amplification condition
3, agarose gel electrophoresis (gum concentration is depending on the size of its target fragment).
It refers to《Fine works Medical Molecular Biology experiment instruction》(China Medical Science Press, chief editor：Fu Junjiang)
(1) configuration of sepharose：0.8g agar powders are weighed with electronic balance, 1 × TAE 40ml are added, are put into micro-wave oven
In fully dissolving (moderate heat to boiling, in low fire to boiling 2 times), be placed on laboratory table, 2 μ l of EB be added, mixing is cooled to
50 DEG C spare；
(2) the wide stripping fork in 16 holes 0.75mm is used, matches plastic plate, plastic plate is put into plastic tank, by the agarose of dissolving
(about 50 DEG C), are poured into wherein, until thickness is 6mm (bubble is driven out of if any bubble), after it is fully solidified at room temperature
It is spare；
(3) point sample：
(4) 100V electrophoresis 45min；
4, image capture：(BIO-RAD, Universal Hood II)
Two, experimental result
As shown in figure 3, the primer that the present invention designs can amplify specific piece from the eclipta from a different regions
Section, and penthorum chinense pursh does not have band.Channel 1,2 and 3 is the eclipta from Sichuan, Jiangxi and Anhui；4,5,6 be to come from Sichuan,
The penthorum chinense pursh in Jiangxi and Anhui, channel " M " show the DL2000 DNA markers of molecular wt (bp).
As shown in figure 4, the primer that the present invention designs can amplify specific fragment from eclipta, and penthorum chinense pursh and its
He does not amplify any band at kind Plant Genome yet.
The experiment results show that the specificity of primer shown in NO.2~3 SEQ ID of the present invention is good, can specifically, effectively expand
The gene for increasing eclipta, can effectively differentiate eclipta.
3 eclipta detection kit of the present invention of embodiment and application method
One, kit forms
This kit contains：
CTAB Extraction buffers (200ml)；
2 × Taq Master Mix, wherein primer can select NO.5~6 SEQ ID, NO.7~8 SEQ ID, SEQ
Pair of primers or multipair primer (500 μ l) in primer shown in ID NO 9~10；
Negative control template DNA (DNA of penthorum chinense pursh) one manages (50 μ l)；
Positive control template DNA (eclipta DNA) one manages (50 μ l)；
Sterilize ddH2O (1500 μ l).
(1) CTAB Extraction buffers
CTAB Extraction buffers (100ml)
It is adjusted to pH 5.0 with HCL, adds H2O to 100 ml.
(2) formula of 2 × Taq of PCR system Master Mix
Two, detection method
(1) PCR amplification
1, CTAB Extraction buffers extract sample DNA to be checked.
2, PCR amplification is carried out：
It is specific as follows：
1 μ l of different cultivars DNA (50ng/ μ l)
2×Taq Master Mix 5μl
ddH2O 4μl
After mixing well, 12000rpm centrifuges 30s；
Note：2 × Taq Master Mix, while taking different DNA profiling settings positive and negative control
3, (Mastercycler 5331PCR instrument, German Eppendorf or other PCR instrument are put into PCR instrument
Such as Applied Biosystems96-Well Thermal Cycler), using following procedure.
(2) agarose gel electrophoresis：
1, the configuration of sepharose：0.8g agar powders are weighed with electronic balance, 0.5 × TAE 40ml are added, are put into microwave
Fully dissolving (moderate heat to boiling, in low fire to boiling 2 times), is placed on laboratory table, EB 2ul is added, mixing is to be cooled in stove
It is spare to 50 DEG C；
2, with the wide stripping fork in 16 holes 0.75mm, match plastic plate, plastic plate is put into plastic tank, (about by the agarose of dissolving
50 DEG C), it pours into wherein, until thickness is 6mm (bubble is driven out of if any bubble), waits for its fully solidification standby at room temperature
With；
3, point sample：Pay attention to Loading sequence, and plus the molecule Marker of DNA
4,100V electrophoresis 45min；
(3) result detection and analysis
The preservation as a result, result is taken a picture of the observation under gel imager, and analysis result.
To sum up, detection kit and detection method provided by the invention can effectively identify that eclipta, high specificity take
Short, detection is quick, has a good application prospect.
Sequence table
<110>Southwestern medical university
<120>The detection kit and detection method of eclipta
<130> GY185-18P1183
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 462
<212> DNA
<213>Eclipta (Eclipta prostrate, SCAR)
<400> 1
tttacaaaag agaattcttg ttcttttttt cgtcaaaact gaaattcttt aatattatgt 60
tttgctcttt gttctcattt ccagctttat ggagaaaatg caaaccggag gtgatcttaa 120
cctcatcggt cagtttggtg ttggatttta ttctgtatat cttgttgctg attatgtgga 180
agtgataagc aaacacaatg atgacaaaca gtatgccttc tggtttttgt tctgcagtag 240
tcgattttag ctttacttat caacttgctt caacttgtaa ctttttagga tgtgtgggag 300
tcaacggctg atgccgcatt tgcgactctg aagatacata caatgagcca ctcggtcatg 360
gtactgaaat aagattgcat cttaggaacg aagccggaga atatcttgaa gagtcaaaat 420
tgaaggattt ggtgaaaaaa tattcggaat ttattaactt cc 462
<210> 2
<211> 20
<212> DNA
<213>Eclipta (Eclipta prostrate, A11-21 sense primer)
<400> 2
atcgattccc ggtcctacag 20
<210> 3
<211> 23
<212> DNA
<213>Eclipta (Eclipta prostrate, A11-21 downstream primer)
<400> 3
tgggtattct tcttagcaac caa 23
Claims (9)
1. a kind of eclipta specific SCAR molecular labeling, it is characterised in that：Its nucleotide sequence is as shown in SEQ ID NO.1.
2. expanding the primer pair of nucleotide sequence shown in SEQ ID NO.1.
3. primer pair according to claim 2, it is characterised in that：It is primer pair shown in NO.2~3 SEQ ID.
4. use of the primer pair in detecting eclipta described in SCAR molecular labelings described in claim 1, claim 2-3
On the way.
5. a kind of detection kit of eclipta, it is characterised in that：Include the examination of nucleotide sequence described in detection SEQ ID NO.1
Agent.
6. kit according to claim 5, it is characterised in that：The reagent includes core shown in amplification SEQ ID NO.1
The reagent of nucleotide sequence.
7. kit according to claim 6, it is characterised in that：The reagent of the amplification includes SEQ ID NO.2~3 institutes
The primer pair shown.
8. kit according to claim 5, it is characterised in that：The eclipta is the ink for originating from Sichuan, Jiangxi, Anhui
Non-irrigated lotus.
9. a kind of detection method of eclipta, it is characterised in that：Include the following steps：
A, DNA is extracted：Extract the DNA in sample to be checked；
B, it detects：Sample to be checked is detected with the kit described in claim 5~7 any one, you can.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810354793.5A CN108588254A (en) | 2018-04-19 | 2018-04-19 | The detection kit and detection method of eclipta |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810354793.5A CN108588254A (en) | 2018-04-19 | 2018-04-19 | The detection kit and detection method of eclipta |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108588254A true CN108588254A (en) | 2018-09-28 |
Family
ID=63611285
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810354793.5A Pending CN108588254A (en) | 2018-04-19 | 2018-04-19 | The detection kit and detection method of eclipta |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108588254A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1900282A (en) * | 2005-07-22 | 2007-01-24 | 中国农业科学院植物保护研究所 | Soy bean cyst roundworm specific SCAR label, specific primer and quick PCR detecting method |
| CN104120125A (en) * | 2014-07-14 | 2014-10-29 | 中国农业科学院植物保护研究所 | Specificity SCAR marker for detecting puccinia striiform |
-
2018
- 2018-04-19 CN CN201810354793.5A patent/CN108588254A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1900282A (en) * | 2005-07-22 | 2007-01-24 | 中国农业科学院植物保护研究所 | Soy bean cyst roundworm specific SCAR label, specific primer and quick PCR detecting method |
| CN104120125A (en) * | 2014-07-14 | 2014-10-29 | 中国农业科学院植物保护研究所 | Specificity SCAR marker for detecting puccinia striiform |
Non-Patent Citations (2)
| Title |
|---|
| GENBANK:KX671035.1: "Eclipta prostrate SCAR marker N7-11 genomic sequence", 《GENBANK》 * |
| ZHIQIANG MEI ET AL.: "genetic authentication of eclipta prostrate (asteraceae) from penthorum chinense(penthoraceae) by sequence characterized amplified region (SCAR) markers", 《REV.BIOL.TROP.》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102286355B1 (en) | Detection reagents, detection kits and detection methods for ITGA4 gene methylation | |
| CN103060478B (en) | Dual RT-PCR (reverse transcription-polymerase chain reaction) method for quickly identifying duck hepatitis A virus serotype | |
| CN107245532B (en) | The digital RT-PCR detection primers of crucian coronavirus HB93 a kind of and application | |
| ES2769053T3 (en) | Nucleic acid extraction using organic solvents to remove inhibitors | |
| Sultan et al. | Molecular characterization and marker based chemotaxonomic studies of Podophyllum hexandrum Royle | |
| CN108504761A (en) | The detection kit and detection method of eclipta | |
| CN113136448B (en) | Detection kit and detection method for dendrobium nobile lindl in Luzhou | |
| CN105400900A (en) | Kit for detecting BRAF gene V600E trace mutation through pyrosequencing technique and application of kit | |
| CN105154541B (en) | Application of the miRNA in Diagnosing Acute Myeloid Leukemia and treatment | |
| CN104946635B (en) | The detection kit and detection method of ligusticum acutilobum | |
| CN108588254A (en) | The detection kit and detection method of eclipta | |
| CN104928290B (en) | The detection kit and detection method of a kind of lovage | |
| CN104745699B (en) | The detection kit and detection method of Radix Angelicae Sinensis | |
| CN104946636B (en) | The detection kit and detection method of lovage | |
| CN107058305A (en) | One group of nucleotide sequence and the application in EML4 ALK fusion gene quick detections | |
| CN108949980B (en) | Kit for detecting hepatocellular carcinoma | |
| CN104017886A (en) | Nested polymerase chain reaction (PCR) detection kit for cylindrocladium scoparium and using method of detection kit | |
| CN101275167B (en) | Screening method for hydroxyl carthamin yellow A-containing safflower | |
| CN105177149B (en) | Application of the miRNA in liver cirrhosis diagnosis and treatment | |
| CN113652496A (en) | Kit and method for identifying pholidota chinensis | |
| CN104711256B (en) | The detection kit and detection method of cape jasmine | |
| CN112877315A (en) | Szechwan chinaberry squalene oxide cyclase MtOSC1 and coding gene and application thereof | |
| CN106755403A (en) | A kind of method that utilization specific primer group differentiates two class squilla oratoria populations | |
| CN107663542A (en) | A kind of PCR method for identifying zaocys dhumnade | |
| Sim et al. | Preliminary findings of down-regulated genes in nasopharyngeal carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180928 |