CN104928290B - The detection kit and detection method of a kind of lovage - Google Patents
The detection kit and detection method of a kind of lovage Download PDFInfo
- Publication number
- CN104928290B CN104928290B CN201510374599.XA CN201510374599A CN104928290B CN 104928290 B CN104928290 B CN 104928290B CN 201510374599 A CN201510374599 A CN 201510374599A CN 104928290 B CN104928290 B CN 104928290B
- Authority
- CN
- China
- Prior art keywords
- lovage
- detection
- radix angelicae
- angelicae sinensis
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the nucleotide sequence of lovage, also discloses purposes of the reagent of detection foregoing sequences in lovage detection reagent is prepared, and the detection kit and detection method of lovage.Detection kit and detection method of the present invention can be with accurate and effective discriminating lovages, high specificity, and time-consuming short, application prospect is good.
Description
Technical field
The present invention relates to a kind of detection kit of lovage and detection method.
Background technology
Lovage (Levisticum officinale Koch), also known as Radix Angelicae Sinensis is protected, it is that Umbelliferae levisticum is perennial
Herbaceous plant.Nineteen fifty-seven, introduced a fine variety when Radix Angelicae Sinensis is in short supply from Bulgaria, in China Hebei, Beijing, Shandong, Henan, the Inner Mongol, the Liao Dynasty
Rather, there is cultivation on the ground such as Shaanxi, Shanxi and Jiangsu.Lovage is used as medicine with dry root, early to be recorded by Deutscher Arzneibucs, and fragrance is special
It is different and muddy, property is sweet, the micro- peppery, micro-sweet of taste and have numb feeling in the tongue, there is diuresis, stomach invigorating, eliminating the phlegm, treatment gynaecological disease and other effects, be just
The common adulterant of product Radix Angelicae Sinensis.
Because the drug effect of lovage is not as good as Radix Angelicae Sinensis, and pharmacologically also there is larger difference, thus cannot function as Radix Angelicae Sinensis to make
With, but itself have drug effect, and cultivate easily, growth period is short.Therefore, effectively differentiate lovage, reasonable employment is entered to it
It is very important.
The content of the invention
The defects of in order to overcome prior art, the invention provides it is a kind of it is new, detect Europe easily and fast, exactly and work as
The kit and method returned.
The invention provides the kind nucleotide sequence shown in SEQ ID NO.1.
Present invention also offers the reagent of nucleotide sequence shown in detection SEQ ID NO.1 to prepare lovage detection reagent
In purposes.
The reagent of nucleotide sequence described in the detection SEQ ID NO.1 includes nucleotides shown in amplification SEQ ID NO.1
The reagent of sequence.
The lovage is the reagent expanded described in samphire lovage Levisticum officinalis Koch
Including the primer pair shown in SEQ ID NO.2~3.
The kit of present invention detection lovage, include the related reagent of nucleotide sequence described in detection SEQ ID NO.1.
The reagent includes the reagent of nucleotide sequence shown in amplification SEQ ID NO.1.
The reagent of the amplification includes the primer pair shown in SEQ ID NO.2~3.
A kind of detection method of lovage of the present invention, comprises the following steps：
A, DNA are extracted：Extract the DNA in sample to be checked；
B, detection：Sample to be checked is detected with foregoing kit, you can.
Nucleotides sequence shown in SEQ ID NO.1 of the present invention is classified as lovage specific sequence, can by detecting these sequences
It is the conjunction of medicinal material so as to effectively identify whether sample to be checked is lovage to accurately distinguish lovage and Radix Angelicae Sinensis, ligusticum acutilobum
For reason using guidance is provided, the inventive method is easy to operate, has a good application prospect.
The present invention is described in further details below by embodiment, but is not the limit to the present invention
System, according to the above of the present invention, according to the ordinary technical knowledge and customary means of this area, not departing from, the present invention is above-mentioned
Under the premise of basic fundamental thought, the modification, replacement or change of other diversified forms can also be made, be all the present invention protect it is interior
Hold.
Brief description of the drawings
The improvement RAPD amplifications of Fig. 1 lovages.Arrow is A13 RPAD fragments, for glue reclaim and clone.
The bacterium colony PCR identifications of Fig. 2 positive colonies.The positive colony of the signified passage of blueness is sequenced for Sanger.Passage " M "
Show the DL2000DNA marks of molecular wt (bp).Swimming lane 1-5 represents the bacterium colony of different positive colonies respectively.
The identification of Fig. 3 different plant species and Radix Angelicae Sinensis kind.The respectively Gansu Minxian County Radix Angelicae Sinensis of passage 1-18, ligusticum acutilobum, four
River Aba Radix Angelicae Sinensis, Pingliang, Gansu Radix Angelicae Sinensis, Hubei Radix Angelicae Sinensis, Sichuan Jiu Zhai Radix Angelicae Sinensis, lovage, Lijiang, yunnan Radix Angelicae Sinensis, Mianyang, Sichuan are worked as
Return, ginkgo, lichee, longan, Chinese olive, honeysuckle, gardenia, ganoderma lucidum, Long Li, penthorum chinense pursh.Blue signified passage 2 should have for day
Return, passage 7 is lovage.Passage " M " shows the DL2000DNA marks of molecular wt (bp).
The identification of Fig. 4 difference lovage kinds.Passage 1,2 and 3 is ligusticum acutilobum, respectively from Chongqing, Emei, Sichuan Province, is prolonged
Jilin；Passage 4 and 5 is lovage, from Changchun Jilin and Szechwan Ganzi；6 be normal Minxian County Radix Angelicae Sinensis；Passage " M " is shown
The DL2000DNA marks of molecular wt (bp).
Embodiment
The RAPD technologies of embodiment 1 expand the special SCAR mark of lovage
First, CTAB methods extraction DNA of plants
Take lovage 0.2g to be placed in 1.5mL EP pipes, add after liquid nitrogen about half a minute and pulverize into fine powder with mortar rod, stand
Add 500 μ l CTAB Extraction buffers [CTAB2%, Tris-HCl (pH8.0) 100mmolL_1, EDTA20mmol
mmol·L_1, NaCL 1.4molL_1, 0.4% beta -mercaptoethanol], after 60 DEG C of water-baths are incubated 1 hour, add isometric
Chloroform-isoamyl alcohol (24：1) extract, light reverse mixing, 10000 rpms centrifuge 10 minutes, Aspirate supernatant, take and reset and add
Enter the isopropanol of the precooling of 2/3 volume, mixing of gently turning upside down；12000 rpms centrifuge 10 minutes, abandon supernatant, carefully
Incline supernatant, and precipitation is respectively rinsed once with 70% ethanol and absolute ethyl alcohol, is abandoned washing lotion, is stayed precipitation, be air-dried.With 100 μ l
1 × TE solution dissolving it is standby.Sample is detected to DNA concentration and quality with 1% agarose gel electrophoresis, uses spectrophotometer
Concentration is determined, is diluted to concentration 10ng/ μ l, -20 DEG C save backup.Refer to《Fine works Medical Molecular Biology experiment instruction》(in
Medical Science Press of state, chief editor：Fu Junjiang).
2nd, RAPD technologies PCR is expanded
Expanded using RAPD technologies (with reference to Fu J, Yang L, Khan MA, Mei Z (2013) Genetic
characterization and authentication of Lonicera japonica Thunb.by using
improved RAPD analysis.Mol Biol Rep,40(10):5993-9)：
Using the nucleic acid of step 1 extraction as template, expanded that (sequence is shown in Table with RAPD primers SBA-A1 and SBS-A2
1, the synthesis of Beijing SBS Genetech company), PCR amplifications are included using 10 μ l reaction systems：1 μ l primer (2.5 μm of ol/L), 1.5 μ l
(15ng) template DNA, 5 μ l 2 × PCR Taq Mastermix (Tiangeng biotech firm, Beijing) and 2.5 μ l sterilizing are double to steam
Water.After fully mixing, 15s is centrifuged in centrifuge 12000rpm, is placed in PCR instrument (Applied Biosystems96-
Well Thermal Cycler, Life Technology, USA).PCR reaction conditions are：95 DEG C 1 point 30 seconds, 94 DEG C 40 seconds,
36 degree 60 seconds, 72 DEG C 1 point 30 seconds, 40 circulation, it is last 72 DEG C 5 minutes, wherein RAMP be 5%.Then with 1.5% agarose
Gel electrophoresis, exposure colour developing.
Table 1
Agarose gel electrophoresis (referring to《Fine works Medical Molecular Biology experiment instruction》, China Medical Science Press, master
Compile：Fu Junjiang)：
(1) 1.5% Ago-Gel is prepared, whole point samples are in gel pore in order by PCR primer, while point sample one
The individual big tick marks of DNA molecular (DL2000, TIANGEN company, Beijing).Pay attention to：Loading buffer need not be added, PCR amplifications are used
2 × mix with regard to pre-add Related Component.
(2) electrophoresis (electrophoresis apparatus is produced by the brilliant biological Co., Ltd in Beijing hundred, BG-subMID Icell), often selects voltage
110V, electrophoresis time 30min,
3rd, the separation of RAPD amplified bands
1. fragment reclaims
The specific fragment A1-0 of 1.5% agarose gel electrophoresis, under ultraviolet light shearogram certified products lovage kind, use
The DNA fragmentation of DNA Ago-Gels QIAquick Gel Extraction Kit (Tiangeng biotech firm) recovery RAPD amplifications.
2. clone
Followed by pGEM-T carriers (Promega Corporation) and the DNA fragmentation of recovery RAPD amplifications in T4-
The lower connection of DNA ligase effect (16 DEG C connect 8 hours).The DH5 α bacteriums of 30 μ l activation are added after connection, ice bath 30 minutes, are connect
42 DEG C to activate 45 seconds, then ice bath 2 minutes, add LB culture medium (compound methods of the 300 μ l without ampicillin：12.5
Gram LB powder adds 500ml water high-temperature sterilization) 200 rpms shake 45 minutes, then liquid is uniformly applied to the mould of benzyl containing ammonia
The solid LB media surface of element, 37 DEG C of cultures, 15 hours [solid medium compound methods：12.5 grams of LB powder, 7.5 grams of agar
After powder and 500 milliliters of water high-temperature sterilizations, 500 μ l ampicillin (100mg/ml) is added at 50 DEG C, using preceding in solid
Media surface smears 40 μ l 20mg/ml X-GAL's (the chloro- 3- indoles-β-D- galactosides of the bromo- 4- of 5-) and 20 μ l
24mg/ml IPTG (isopropylthiogalactoside)] blue and white screening is carried out, screening white colony carries out bacterium colony PCR identifications.
3. positive clone identification
Each ware selects multiple white colonies, is added separately in LB fluid nutrient mediums of the 300 μ l containing ampicillin,
220 rpms are shaken 2-4 hours, take 0.2~0.5 μ l culture mediums to carry out bacterium colony PCR reactions.The reaction system of 10 μ l volumes is：2
× PCR Taq Mastermix 5 μ l, DNA 0.5 μ l, the μ l of universal primer (SP6+T7) 1 (2.5 μm of ol/L), the μ l of water 3.5.PCR
Reaction condition is：95 DEG C 1 point 30 seconds, 94 DEG C 40 seconds, 58 DEG C 30 seconds, 72 DEG C 40 seconds, 30 circulation, it is last 72 DEG C 5 minutes.Then
With 1.5% agarose gel electrophoresis, EB dyeing, exposure colour developing.
4. result
Fig. 1 is shown in improvement RAPD amplifications.The colony PCR amplification and electroresis appraisal result such as Fig. 2 of positive colony.
5th, sequencing analysis
1. sequencing
Positive colony is selected, carries out Sanger sequencings.The nucleotide sequence of sequencing is following (shown in SEQ ID NO.1)：
CTTACTTACCTAAAGTGAACTTTTGGCTTACCTAAAAAGTGGACTGAAGGAACTGACCTAAGCATAGCTCTCTCAAA
TAAAAATGCCTTTCATTTCTCTTTTAAGACCTTTGTCCTACTTCTAGTCTCAGTCCTCCAGCCTATCGAAAGTCATC
TTTTTATTAACATTAACCAACAACACATGCACTTTGTTGGCACTAAAAAAAAGGTTATTCAATCCACTAGTGCAACT
GAAGGAATTACCTCTTCTGAACCGGAATAAGAAAGAGCTCATAACCACTACTTGTGAACAGCTCTCCTCAACTGAAG
GCGCACCTACTGTTACTAGAAGTCTAGTCTCTCTCAGGTCCAGTTTCGATCTCGAACTACAACATAGGCGGGAAAAG
AGATATTCAGAAAAGCCGATTTCCTGTCCTGTCTTAAGAACCTGACTCAAAAGAGAAAAGAAGACCGGACTAAAAGA
GATCTCACTTTCGACGATTGAACTCCACTTTCATATCAGGCTTGCACTGGAATTCACTTTCAGGAATCCTTGCTCCT
GGCTCATATTCACATAGGCCACTCATAAGAATAAGACGTTCAACTCCCTCAAACACGTGTAATTGAGAGAGTCAGAA
TATCAGTGCCTTGGGTAAATGTCTACCTTCGGGAGAATCTTACCGAACGACTTTCAAACCTGTCCTCTTCGCTTCCC
AAGAGATTGGATTTAGGTAAAAGGGCCTG。
2. homology search is new with looking into
The as above sequence obtained will be sequenced, in NCBI websites (http：//www.ncbi.nlm.nih.gov/BLAST/) on
It is compared, has no identical or repetitive sequence, illustrates as it is new, the distinctive nucleotide sequence of lovage, Europe can be established
The special SCAR mark of Radix Angelicae Sinensis.
The gene of the inventive method specific amplified lovage of embodiment 2
1st, experimental method
(1) the special SCAR mark (sequence shown in SEQ ID NO.1) of the lovage that is obtained according to embodiment 1, design
1 pair of primer, synthesis.
(2) PCR is expanded
1st, prepared by template
Detect different plant species：Take and have chosen 18 different plant species or variety genome DNA as template, they distinguish
It is：Gansu Minxian County Radix Angelicae Sinensis, ligusticum acutilobum, Sichuan Aba Radix Angelicae Sinensis, Pingliang, Gansu Radix Angelicae Sinensis, Hubei Radix Angelicae Sinensis, Sichuan Jiu Zhai Radix Angelicae Sinensis, Europe are worked as
Return (the 7th swimming lane), Lijiang, yunnan Radix Angelicae Sinensis, Mianyang, Sichuan Radix Angelicae Sinensis, ginkgo, lichee, longan, Chinese olive, honeysuckle, gardenia, spirit
Sesame, Long Li, penthorum chinense pursh.It is standby that 10ng/ μ l are diluted to respectively.Gene extracting method is the same as embodiment 1.
Differentiate ligusticum acutilobum, lovage and Radix Angelicae Sinensis：1st, 2 and 3 be ligusticum acutilobum, respectively from Chongqing, Emei, Sichuan Province, Yanji
Jilin；4 and 5 be lovage, from Changchun Jilin and Szechwan Ganzi；6 be normal Minxian County Radix Angelicae Sinensis.
2nd, PCR is expanded：
(1) PCR system (10 μ l)
After fully mixing, 15s is centrifuged in centrifuge 12000rpm, is placed in PCR instrument (Applied Biosystems96-Well Thermal Cycler, Life Technology, USA).
(2) PCR amplification conditions
3rd, agarose gel electrophoresis (gum concentration is depending on the size of its purpose fragment).
Refer to《Fine works Medical Molecular Biology experiment instruction》(China Medical Science Press, chief editor：Fu Junjiang)
(1) configuration of sepharose：0.8g agar powders are weighed with electronic balance, 1 × TAE 40ml is added, is put into micro-wave oven
In fully dissolving (moderate heat to seethe with excitement, in it is low fire to boiling 2 times), be placed on laboratory table, add the μ l of EB 2, mix, be cooled to
50 DEG C standby；
(2) the wide stripping fork in the holes of 0.75mm 16 is used, offset plate is prepared, glue plate is put into glue groove, by the agarose of dissolving
(about 50 DEG C), are poured into wherein, until thickness is 6mm (bubble is driven out of if any bubble), after it fully solidifies at room temperature
It is standby；
(3) point sample：
(4) 100V electrophoresis 45min；
4th, image capture：(BIO-RAD, Universal Hood II)
2nd, experimental result
As shown in figure 3, the primer that designs of the present invention can amplify specific fragment from lovage, and Radix Angelicae Sinensis and Japan
Radix Angelicae Sinensis does not amplify specific band, and other kind Plant Genomes do not amplify any band yet.
As shown in figure 4, the primer that the present invention designs can be from 2 lovages respectively from Jilin Changchun and Szechwan Ganzi
In amplify specific fragment, and 1 certified products Radix Angelicae Sinensis and 3 days respectively from Chongqing, Emei, Sichuan Province and Yanji should have
Return and do not amplify specific band.
Experimental result illustrates that the specificity of primer shown in SEQ ID NO.2~3 of the present invention is good, can specifically, effectively expand
Increase the gene of lovage, can effectively differentiate lovage.
The lovage detection kit of the present invention of embodiment 3 and application method
First, kit forms
This kit contains：
CTAB Extraction buffers (200ml)；
2 × Taq Master Mix, wherein, primer can select SEQ ID NO.5~6, SEQ ID NO.7~8, SEQ
Pair of primers or multipair primer (500 μ l) in primer shown in ID NO 9~10；
Negative control template DNA (DNA of ligusticum acutilobum or Radix Angelicae Sinensis) one manages (50 μ l)；
Positive control template DNA (lovage DNA) one manages (50 μ l)；
Sterilize ddH2O(1500μl)。
(1) CTAB Extraction buffers
CTAB Extraction buffers (100ml)
PH 5.0 is adjusted to HCL, adds H2O to 100ml.
(2) 2 × Taq of PCR system Master Mix formula
2nd, detection method
(1) PCR is expanded
1st, CTAB Extraction buffers extract sample DNA to be checked.
2nd, performing PCR amplification is entered：
It is specific as follows：
The μ l of different cultivars DNA 1 (50ng/ μ l)
2×Taq Master Mix 5μl
ddH2O 4μl
After fully mixing, 12000rpm centrifugations 30s；
Note：2 × Taq Master Mix, while take the different DNA profiling setting positives and negative control
3rd, (Mastercycler 5331PCR instrument, German Eppendorf, or other PCR instrument device are put into PCR instrument
Such as Applied Biosystems96-Well Thermal Cycler), using following program.
(2) agarose gel electrophoresis：
1st, the configuration of sepharose：0.8g agar powders are weighed with electronic balance, 0.5 × TAE 40ml is added, is put into microwave
In stove fully dissolving (moderate heat to seethe with excitement, in it is low fire to boiling 2 times), be placed on laboratory table, add EB 2ul, mix, it is to be cooled
It is standby to 50 DEG C；
2nd, with the wide stripping fork in the holes of 0.75mm 16, offset plate is prepared, glue plate is put into glue groove, by the agarose of dissolving (about
50 DEG C), pour into wherein, until thickness is 6mm (bubble is driven out of if any bubble), treat its fully solidification standby at room temperature
With；
3rd, point sample：Pay attention to Loading sequence, and plus DNA molecule Marker
4th, 100V electrophoresis 45min；
(3) result detection and analysis
Result is observed under gel imager, as a result photograph preserves, and analysis result.
To sum up, detection kit and detection method provided by the invention can effectively identify lovage, high specificity, take
Short, detection is quick, has good potential applicability in clinical practice.
Claims (4)
- Nucleotide sequence shown in 1.SEQ ID NO.1.
- Purposes of the primer pair in lovage detection reagent is prepared shown in 2.SEQ ID NO.2~3；The lovage is umbrella shape Section plant lovageLevisticum officinalis Koch。
- A kind of 3. kit for detecting lovage, it is characterised in that：Including the primer pair shown in SEQ ID NO.2~3.
- A kind of 4. detection method for detecting lovage, it is characterised in that：Comprise the following steps：A, DNA are extracted：Extract the DNA in sample to be checked；B, detection：Sample to be checked is detected with the kit described in claim 3, you can.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510374599.XA CN104928290B (en) | 2015-06-30 | 2015-06-30 | The detection kit and detection method of a kind of lovage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510374599.XA CN104928290B (en) | 2015-06-30 | 2015-06-30 | The detection kit and detection method of a kind of lovage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104928290A CN104928290A (en) | 2015-09-23 |
| CN104928290B true CN104928290B (en) | 2017-12-08 |
Family
ID=54115717
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510374599.XA Expired - Fee Related CN104928290B (en) | 2015-06-30 | 2015-06-30 | The detection kit and detection method of a kind of lovage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928290B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104946636B (en) * | 2015-06-30 | 2018-01-02 | 四川医科大学 | The detection kit and detection method of lovage |
| CN106222245A (en) * | 2016-06-14 | 2016-12-14 | 陕西省食品药品检验所 | The method for quick of ginsenoside in Radix Panacis Quinquefolii |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104263832A (en) * | 2014-09-26 | 2015-01-07 | 泸州医学院 | Novel RAPD (random amplified polymorphic DNA) method |
-
2015
- 2015-06-30 CN CN201510374599.XA patent/CN104928290B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104928290A (en) | 2015-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108474030A (en) | nucleic acid amplification method and system | |
| CN104928290B (en) | The detection kit and detection method of a kind of lovage | |
| Chen et al. | Authentication of Saussurea lappa, an endangered medicinal material, by ITS DNA and 5S rRNA sequencing | |
| CN107326080B (en) | LAMP (Loop-mediated isothermal amplification) detection primer group and kit for identifying cimicifuga foetida adulterants and application of LAMP detection primer group and kit | |
| CN105400900A (en) | Kit for detecting BRAF gene V600E trace mutation through pyrosequencing technique and application of kit | |
| CN113136448B (en) | Detection kit and detection method for dendrobium nobile lindl in Luzhou | |
| Li et al. | Molecular authentication of Alisma orientale by PCR-RFLP and ARMS | |
| CN104388569B (en) | PCR identification primers and method for identifying B.striata Rchb.f. and B.ochracea Schltr. by using same | |
| CN104946636B (en) | The detection kit and detection method of lovage | |
| CN104073550A (en) | SCAR molecular mark for performing sex identification of siraidia grosvenorii | |
| CN104946635B (en) | The detection kit and detection method of ligusticum acutilobum | |
| CN104745699B (en) | The detection kit and detection method of Radix Angelicae Sinensis | |
| CN103451312A (en) | Method for quickly identifying scorpion medicinal materials in field of molecular biology | |
| Qian et al. | Molecular authentication of Dendrobium loddigesii Rolfe by amplification refractory mutation system (ARMS) | |
| CN105154538B (en) | The primer and method of a kind of Legionella quick detection and parting | |
| CN104480103B (en) | A kind of extracting method of edaphon genome | |
| Lu et al. | Development of Randomly Amplified Polymorphic DNA-Sequence Characterized Amplified Region Marker for Identification of Apocynum venetum L INN. from A. pictum S CHRENK | |
| CN106520776B (en) | A kind of breast cancer kit for screening | |
| CN101705293B (en) | Specific primer pairs for soybean phytophthora PCR detection | |
| MEI et al. | Rapid and accurate genetic authentication of Penthorum chinense by improved RAPD-derived species-specific SCAR markers | |
| CN101104868A (en) | Method of herbal authentication based on 5S rRNA spacer sequences | |
| CN108504761A (en) | The detection kit and detection method of eclipta | |
| CN104711256B (en) | The detection kit and detection method of cape jasmine | |
| Jiang et al. | Helicase-dependent amplification is effective in distinguishing Asian ginseng from American ginseng | |
| CN113604467B (en) | Detection kit and detection method for dendrobium candidum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171208 Termination date: 20200630 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |