CN108588182A - Isothermal duplication and detection technique based on the substitution of CRISPR- chains - Google Patents
Isothermal duplication and detection technique based on the substitution of CRISPR- chains Download PDFInfo
- Publication number
- CN108588182A CN108588182A CN201810328785.3A CN201810328785A CN108588182A CN 108588182 A CN108588182 A CN 108588182A CN 201810328785 A CN201810328785 A CN 201810328785A CN 108588182 A CN108588182 A CN 108588182A
- Authority
- CN
- China
- Prior art keywords
- dna
- nucleic acid
- cas9
- sgrna
- isothermal amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses the isothermal duplication replaced based on CRISPR chains and detection techniques.Isothermal amplification kit based on the substitution of CRISPR chains, replace isothermal duplication reagent including chain, kit further comprise the Cas9 nickases of wild type Cas9 and/or nucleic acid enzyme defect, sgRNA pairs of specific recognition target dna sequence upstream and downstream, chain replaces the amplimer pair of isothermal amplification, and the single-stranded regions which exposes after being combined with target gene with Cas9 sgRNA complexs pair are complementary.The technical operation is simple, strong antijamming capability, and testing result is accurate and reliable.
Description
Technical field
The present invention relates to a kind of nucleic acid amplification technologies and based on the detection technique of the technology, more particularly to CRISPR- is based on
The isothermal duplication and detection technique of chain substitution.
Background technology
Nucleic acid molecules are considered as important biomarker based on its biological nature.The detection of nucleic acid molecules is examined in medicine
Treatment, food security, public health and social safety etc. have a wide range of applications.In general, during detection of nucleic acids, it is to be checked
Target nucleic acid molecule concentration in sample is extremely low rather than target nucleic acid molecule concentration is then higher.Therefore, to the target nucleus in detected sample
Acid molecule specific amplification is the common method of the sensitivity and the accuracy that improve nuclease assay reaction.
Currently, target nucleic acid molecule (DNA) segment specifically expanded by PCR amplification in detected sample is core
The most important technology used in acid detection, and most effective, most straightforward approach at present.However, round pcr still has at present
Many limitations for being difficult to overcome, such as：1) high to template DNA purity requirement；2) sensitive to reaction condition, and practical test sample to be checked
Often there is the ingredient for having inhibiting effect to PCR reactions in product；3) amplified reaction need to undergo the reaction of multiple alternating temperature, the reaction time compared with
It is long；4) equipment and interpretation of result equipment cost needed for detection reaction are higher, can only be completed in laboratory；And 5) examination needed for detection
Agent is of high cost, and need to pass through professional training using operation, and coherent detection need to expend a large amount of manpower and materials costs.Meanwhile in medicine
Diagnosis and treatment, food security it is relevant it is actually detected in, need to carry out and detect on the spot, and obtain target nucleic acid within the short time as far as possible
The testing result of molecule.Therefore, the detection of nucleic acids means of based on PCR technology cannot be satisfied the demand of practical application, it is new it is low at
This, efficiently quickly therefore detection of nucleic acids means will have a wide range of applications potentiality.
In view of the above-mentioned problems, researcher has developed a series of isothermal amplification technique (Isothermal of nucleic acid
Amplification) to solve the problems faced in PCR amplification.It is directed to the detection of DNA, usually utilizing has
Chain replace function polymerase (such as Klenow Fragment, Bst,Deng), there are nickase (such as SDA technologies) or non-incision
Under enzyme (such as LAMP, RCA, HDA and RPA technology) participates in, target DNA is expanded to the level that can be detected in 1-2 hours
(Isothermal in vitro amplification of DNA by a restriction enzyme/DNA
Polymerase system, Walker GT etc., Proc.Natl.Acad.Sci.U.S.A., 1992,89 (1):392–396；
Loop-mediated isothermal amplification of DNA, Notomi T etc., Nucleic Acids Res.,
2000,28(12):e63；Rolling replication of short DNA circles, Fire A etc.,
Proc.Natl.Acad.Sci.U.S.A.,1995,92(10):4641–4645；Helicase-dependent isothermal
DNA amplification, Vincent M etc., EMBO Rep., 2004,5 (8):795–800；DNA detection using
Recombination proteins, Piepenburg O etc., PLoS Biol., 2006,4 (7):e204).
Then first with reverse transcriptase by RNA reverse transcriptions it is usually DNA for RNA sample, then carried out as template using DNA etc.
Temperature amplification (such as NASBA and SMART technologies) (Isothermal, in vitro amplification of nucleic
acids by a multienzyme reaction modeled after retroviral replication,Guatelli
JC etc., Proc.Natl.Acad.Sci.U.S.A., 1990,87 (5):1874–1878；Specific detection of DNA
and RNA targets using a novel isothermal nucleic acid amplification assay
Based on the formation of a three-way junction structure, Wharam D etc., Nucleic
Acids Res.,2001,29(11):e54)。
Isothermal amplification technique completes nucleic acid amplification independent of temperature change or Thermal Cycling during the reaction, therefore
Proliferation time can significantly be shortened, and reduce the instrument cost of amplified reaction.Simultaneously as most of isothermal duplication systems are to common
PCR reaction suppressors it is insensitive, the preprocessing process of sample can be further simplified, and it is difficult to further reduced corresponding operation
Degree and complexity.These features make isothermal amplification technique be widely used in such as infectious disease detection, food pathogenic inspection
Survey, genetically modified crops detection etc., and be developing progressively as ripe commercial kit.However, current is most of
Commercialized isothermal amplification technique still has some defects not yet overcome, for example, design of primers is complex (such as LAMP technology),
And it cannot be distinguished from the difference etc. of mononucleotide in nucleic acid sequence.Therefore, new quick, efficient, highly sensitive detection of nucleic acids
Means have important application value.
CRISPR (Clustered Regularly Interspersed Short Palindromic Repeats, rule
The short palindrome in rule cluster interval repeats) it is the genic system that bacterium is used for resisting virus attack/hide mammalian immune reaction.
Cas9 albumen is the effect protein of CRISPR systems, is to be currently known as the double-stranded DNA binding protein that a kind of RNA is oriented to
First unified factor, the substantially any double chain DNA sequence that specifically can be accurately positioned and edit in genome.
The application of CRISPR-Cas9 technologies is still concentrated mainly on two aspects of gene editing and gene therapy so far.Based on the skill
Low cost, system possessed by art be simple, high efficiency, high specific and the features such as high sensitivity, in field of nucleic acid detection skill
Art, which should have, is equally widely applied foreground.
Target nucleic acid molecule is detected using CRISPR technologies and has started to see report in the recent period.CN105177110A is disclosed
A kind of in-vitro method being detected to target nucleic acid based on Cas9 fusion proteins, this method is i.e. existing for target nucleic acid sequence
In the case of, by being specifically bound with target sequence, the fluorescence signal that can be detected is generated by a pair of of Cas9 fusion proteins jointly.Separately
It has been reported that and utilizes nucleic acid product (the Nucleic acid after the amplification of CRISPR effect protein Cas13a specific detection RPA technologies
Detection with CRISPR-Cas13a/C2c2, Gootenberg JS etc., Science, 2017,356 (6336):438-
442).First target DNA molecule is expanded however, these technologies are all based on existing isothermal amplification technique, then with CRISPR
Technology is detected.It is that the method that starting carries out target nucleic acid specific amplification not yet sees report with CRISPR technologies.
Invention content
The purpose of the present invention is to provide the isothermal amplification kit replaced based on CRISPR- chains and methods.
The technical solution used in the present invention is：
A kind of isothermal amplification kit based on the substitution of CRISPR- chains, including chain replace isothermal duplication reagent, and kit is also
Include Cas9 nickases, the specific recognition target dna sequence upstream and downstream of wild type Cas9 and/or nucleic acid enzyme defect
SgRNA pairs, chain replaces the amplimer pair of isothermal amplification, the primer pair and Cas9-sgRNA complexs pair and target gene
The single-stranded regions exposed in conjunction with after are complementary.
As being further improved for above-mentioned isothermal amplification kit, the Cas9 nickases of nucleic acid enzyme defect are HNH nucleases
The Cas9 nickases of defect.
As being further improved for above-mentioned isothermal amplification kit, sgRNA pairs of recognition site is respectively on aim sequence
Swim 10~30 nucleotide sequences of 10~30 nucleotide sequences and the end of downstream NGG sequences 5 ' at 3 ' end of CCN sequences.
As being further improved for above-mentioned isothermal amplification kit, sgRNA to 100~1000bp of spacing of recognition site,
It is preferred that 100~250bp, recognition site 5 ' is held using CCN as starting point, and 3 ' end target sequences are using NGG as terminal.
As being further improved for above-mentioned isothermal amplification kit, chain replaces the DNA primer of isothermal duplication reagent to have such as
Lower feature：The primer 5 ' end contains a notch enzyme recognition site, and the restriction enzyme site in the site is on its complementary strand；This draws
At least ten continuous nucleotide of chain where the NGG sequences in the target DNA region that the stage casing of object is identified with Cas-sgRNA complexs
Complementary pairing.
As being further improved for above-mentioned isothermal amplification kit, chain replaces 3 ' ends of the DNA primer of isothermal duplication reagent
Contain the sequence with chain nucleotide complementation where NGG sequences of one section of 1~10 nucleotide.
A kind of kit for detecting nucleic acid based on the substitution of CRISPR- chains, including above-mentioned isothermal amplification kit, Yi Jihe
Acid cut amount analytical reagent.
The quantitative analysis of nucleic acids reagent is selected from specific molecular beacon molecule.
Based on the isothermal amplification method of CRISPR- chains substitution, include the following steps：
1) sample to be tested nucleic acid is obtained；
2) reagent contained using above-mentioned isothermal amplification kit expands nucleic acid samples to be measured.
Based on the isothermal amplification detection method of CRISPR- chains substitution, include the following steps：
1) sample to be tested nucleic acid is obtained；
2) reagent contained using above-mentioned isothermal amplification kit expands nucleic acid samples to be measured；
3) amplified production is analyzed, determines testing result.
The beneficial effects of the invention are as follows：
1) technology of the invention mainly utilizes CRISPR-Cas9 systems can the end of specific recognition 3 ' appointing with-NGG sequences
This feature of meaning DNA sequence dna, which is characterized in that substantially any target fragment in genome can be accurately positioned, and complex is built
It is very easy.For theoretical calculation, in one section of DNA to be detected, every 8 bases may occur in which primary-NGG sequences.Therefore,
The design of upstream and downstream DNA target sequence (i.e. Cas9-sgRNA complexs recognition site) is widely distributed in actually detected.Meanwhile by
The region of 20 bases at the end of sgRNA molecules 5 ' is depended entirely in the targeting of Cas9-sgRNA complexs, structure is directed to
The Cas9-sgRNA complexs of upstream and downstream DNA target sequence are very easy.
2) the CRISPR-Cas9 systems that technology of the invention utilizes are swift in response to the identification of target DNA, and specificity is high.Mesh
Before have been demonstrated, CRISPR-Cas9 systems to target DNA identification combine dissociation constant 10-9-10-10M magnitudes, when association reaction
Between complete in 5-10 minutes, it is similar to the feature of most of antibody, to make the isothermal duplication system of the present invention be swift in response,
And has high specificity.Meanwhile for isothermal amplification primer pair in CRISPR-Cas9 systems to DNA to be detected
The progress that can not cause isothermal amplification before cutting is completed, this feature further improves the isothermal duplication system of the present invention
Specificity.
3) technology of the invention can be in same temperature (preferred 37 DEG C) into the hand-manipulating of needle without relying on annealing or alternating temperature step
To RNA, the detection of single stranded DNA and double-stranded DNA.When being detected for RNA, it is only necessary to carry out RNA reverses with the primer for target RNA
Record, then carry out isothermal duplication detection to transcription product cDNA synthesis complementary DNAs and then after forming double-stranded DNA.And for single-stranded
DNA detect when, then only need with for target DNA primer carry out complementary strand synthesize can carry out isothermal duplication detection.
4) technology reaction condition of the invention is simple, the high feature of amplification efficiency.Due to independent of initial annealing step,
And the isothermal duplication system for maintaining these features of same temperature to make the present invention is only needed to become without complicated in entire detection process
Warm equipment so that detection reaction is simple controllable, and testing cost is low.Meanwhile by being combined with chain substitution reaction, isothermal of the invention
Amplification system can be in 1-2 hours to the target DNA (10 of very low amount-16M 10) are completed6-109Amplification again.
5) in technology of the invention, CRISPR-Cas9 systems and chain substitution reaction system are to traditional PCR reaction suppressors
Insensitive, isothermal duplication system of the invention has good anti-interference to various impurity components.
Description of the drawings
Fig. 1 is the chain substitution amplified reaction mechanism schematic diagram based on CRISPR-Cas9 systems；
Fig. 2 is the electrophoresis detection of the chain substitution amplified reaction specific detection short dna template based on CRISPR-Cas9 systems
As a result；
Fig. 3 is small fragment DNA in the chain substitution amplified reaction specific detection human genome based on CRISPR-Cas9 systems
Electrophoresis detection result；
Fig. 4 is the real-time fluorescence of the chain substitution amplified reaction specific detection short dna template based on CRISPR-Cas9 systems
Testing result；
Fig. 5 is chain substitution amplified reaction specific detection people under high pollution object background based on CRISPR-Cas9 systems
The electrophoresis detection result of small fragment DNA in genome.
Specific implementation mode
It elaborates to the technology mechanism of the present invention with reference to Fig. 1.
Functionally it is divided into 3 independent reaction steps based on the chain substitution amplified reaction of CRISPR-Cas9 systems, i.e.,
Cas9-sgRNA complexs specifically bind DNA target sequence to (Cas9 association reactions), amplimer and DNA target sequence region quilt
The single-stranded regions that Cas9-sgRNA complexs expose after combining combine (primer association reaction), and the amplimer in conjunction with after is waiting
Temperature amplification enzyme effect is lower to realize index times isothermal duplication (chain substitution isothermal amplification).
(1) Cas9 association reactions
This step by system to be detected introduce specific recognition DNA target sequence pair Cas9-sgRNA complexs,
Binding site and amplified reaction initiation site are provided for detection primer.Due to Cas9-sgRNA complexs and its DNA target sequence
It is similar with the reaction of most of antibody-antigen bindings in conjunction with identification reaction, with being swift in response, it is specific high the features such as, to make
The isothermal duplication system of the present invention is swift in response, and has high specificity.Simultaneously as invention introduces upstream and downstream two
Prerequisite of a DNA target sequence as amplification starting reaction so that potential single identification reaction of missing the target can not further draw
The chain for playing downstream replaces amplified reaction, this feature to further improve the specificity of the isothermal duplication system reaction of the present invention.
Specific method is, under the conditions of certain ion concentration (NaCl or KCl, 50~300mM) and pH ranges (pH6~8.5), leads to
It crosses and introduces certain density Cas9-sgRNA complexs into detected sample to (10nM~200nM), at a certain temperature (room
Temperature~45 DEG C) it is incubated 15 minutes, you can complete the combination identification reaction for DNA target sequence pair.It is advantageous that Cas9-
SgRNA complexs the identification of DNA target sequence reaction requires reaction condition it is relatively low, can in large range of ion concentration,
It is quickly completed under pH and temperature condition.
(2) primer association reaction
This step is next step index times isothermal amplification by introducing specific primer pair in above-mentioned reaction system
Action site is provided.The research work of early period is found, after Cas9-sgRNA complexs specifically bind DNA target sequence, can be incited somebody to action
The non-template chain of target DNA double-strand and template chain separation, and be exposed in surrounding medium environment.This feature is to provide amplification to draw
The binding site of object.By design it is a pair of respectively at the DNA target sequence being exposed in solution to the primer pair of specific binding,
And nickase action site is introduced in 5 ' end regions of primer pair, provide initiation site for next step chain substitution reaction.It should
Single-stranded regions can form 5 ' jags of a primer after being combined with primer specificity.The advantage of this design is：First, it is right
It misses the target in Cas9-sgRNA complexs and identifies reaction, due to the otherness of its DNA sequence dna and target DNA sequence, primer usually can not
The exposed single stranded DNA complementation of reaction is combined with being missed the target, to can not effectively cause the chain in downstream to replace amplified reaction；The
Two, the chain substitution index times amplified reaction in downstream requires Cas9-sgRNA complexs pair while identifying the upstream and downstream of DNA to be detected
DNA target sequence further improves the specificity of the isothermal duplication system of the present invention；Third, primer pair be exposed it is single-stranded
The association reaction in region of DNA domain is rapid, is not necessarily to alternating temperature, improves the efficiency of the isothermal duplication system of the present invention.Specific method is,
After the completion of waiting for Cas9 association reactions, a small amount of high concentration amplimer is added into the reaction system to (50~200nM of final concentration),
And (room temperature~45 DEG C) of short duration incubation (10 seconds~10 minutes) at a certain temperature, you can complete primer association reaction.
(3) chain replaces isothermal amplification
This step replaces isothermal amplification enzyme by introducing chain in above-mentioned reaction system, to realize to upstream and downstream
The index in the region between DNA target sequence expands again.After introducing chain substitution isothermal amplification enzyme, it is anti-to first pass through chain extension
5 ' the jags for answering the single stranded DNA region that filling-in exposes to be formed after being combined with primer.The double-stranded region newly formed is due to primer band
Some notch enzyme recognition sites for the nickase in reaction system so that provide action site.It is expanded in nickase and chain substitution
Under the double action of enzyme, the region between upstream and downstream DNA target sequence is expanded again by index.Specific method is, after primer combination
The medium volume of reaction system chain be added replace isothermal amplification enzyme (final concentration：KlenowFragmentexo-：0.1~
0.5U/ μ L, Nb.BbvCI nickases：0.01~0.2U/ μ L；dNTPs：100~300nM；SSB：500nM~2 μM；BSA：0.1
~0.3mg/ μ L；And other ion concentrations, pH etc. is as aforementioned), and at a certain temperature (room temperature~45 DEG C, preferred 37 DEG C)
It is incubated (60~120 minutes), you can complete amplified reaction.
On the basis of amplification, it can further carry out (four) and detect reaction.
This step is to pass through traditional Native PAGE (non-denaturing polyacrylamide gel electrophoresis) or real-time fluorescence PCR instrument etc.
Common detection methods or reagent carry out quantitative detection to the product of amplification.
A kind of isothermal amplification kit based on the substitution of CRISPR- chains, including chain replace isothermal duplication reagent, and kit is also
Include Cas9 nickases, the specific recognition target dna sequence upstream and downstream of wild type Cas9 and/or nucleic acid enzyme defect
SgRNA pairs, chain replaces the amplimer pair of isothermal amplification, the primer pair and Cas9-sgRNA complexs pair and target gene
The single-stranded regions exposed in conjunction with after are complementary.
As being further improved for above-mentioned isothermal amplification kit, the Cas9 nickases of nucleic acid enzyme defect are HNH nucleases
The Cas9 nickases of defect.
The Cas9 nickases of wild type Cas9 and/or HNH nucleic acid enzyme defect are the effect egg of type II CRISPR systems
In vain, source includes but not limited to streptococcus pyogenes (Streptococcus pyogenes), streptococcus thermophilus
(Streptococcus thermophilus), staphylococcus aureus (Staphylococcus aureus), meningitis Neisser
Bacterium (Neisseria meningitidis), treponema denticola (Treponema denticola), new assailant Fu Langxisishi
Bacterium (Francisella novicida), solution fiber hot acid bacterium (Acidothermus cellulolyticus).It is specific wild
The Cas9 nickases of type Cas9 and/or HNH nucleic acid enzyme defect include but not limited to Genbank ACCESSION ID：WP_
010922251、WP_059257345、WP_053019794、WP_014574210、WP_002684945、A0Q5Y3、
ABK53723。
As being further improved for above-mentioned isothermal amplification kit, sgRNA pairs of recognition site is respectively on aim sequence
Swim 10~30 nucleotide sequences of 10~30 nucleotide sequences and the end of downstream NGG sequences 5 ' at 3 ' end of CCN sequences.Especially
, sgRNA is to comprising there are one the crRNA that 5 ' hold T7 promoters, a sgRNA recognition site and 80 nucleotide
It is convenient that in-vitro transcription is carried out by t7 rna polymerase with trancrRNA integration regions, and pass through glue purification and ethanol precipitation etc.
Means obtain the sgRNA of purification.
As being further improved for above-mentioned isothermal amplification kit, sgRNA to 100~1000bp of spacing of recognition site,
It is preferred that 100~250bp, recognition site 5 ' is held using CCN as starting point, and 3 ' end target sequences are using NGG as terminal.
As being further improved for above-mentioned isothermal amplification kit, chain replaces the DNA primer of isothermal duplication reagent to have such as
Lower feature：The primer 5 ' end contains a notch enzyme recognition site, and the restriction enzyme site in the site is on its complementary strand；This draws
At least ten continuous nucleotide of chain where the NGG sequences in the target DNA region that the stage casing of object is identified with Cas-sgRNA complexs
Complementary pairing.
As being further improved for above-mentioned isothermal amplification kit, chain replaces 3 ' ends of the DNA primer of isothermal duplication reagent
Contain the sequence with chain nucleotide complementation where NGG sequences of one section of 1~10 nucleotide.
As being further improved for above-mentioned isothermal amplification kit, the Cas9 of wild type Cas9 and/or HNH nucleic acid enzyme defect
Nickase, the sgRNA with synthesis is to pressing molar concentration 1：2 mix respectively.Preferably, a concentration of 100nM of Cas9, sgRNA concentration
For 200nM.Further, Cas9 albumen concentration, sgRNA concentration and primer concentration ratio are 1:2:4, it is highly preferred that its concentration point
It Wei not 25nM, 50nM and 200nM.
Further, reaction buffer is final concentration of：10-30mM TrisHCl(pH8.0)、50-150mM KCl、1-
5mM MgCl2, 0.1%-1% (v/v) Tween20.Amount of the isothermal duplication enzyme mixture each component in 10 μ L reaction systems
For：0.1-0.5U Nb.BbvCI, 1-5U Klenow Fragment (exo-), 2-5mM dNTPs, 2-5 μM of single strand binding protein
TP32,0.1mg/mL BSA.
A kind of kit for detecting nucleic acid based on the substitution of CRISPR- chains, including above-mentioned isothermal amplification kit, Yi Jihe
Acid cut amount analytical reagent.
As being further improved for above-mentioned kit for detecting nucleic acid, the quantitative analysis of nucleic acids reagent is selected from specific molecular beacon
Molecule.
Based on the isothermal amplification method of CRISPR- chains substitution, include the following steps：
1) sample to be tested nucleic acid is obtained；
2) reagent contained using above-mentioned isothermal amplification kit expands nucleic acid samples to be measured.
Based on the isothermal amplification detection method of CRISPR- chains substitution, include the following steps：
1) sample to be tested nucleic acid is obtained；
2) reagent contained using above-mentioned isothermal amplification kit expands nucleic acid samples to be measured；
3) amplified production is analyzed, determines testing result.
Sample can be the sample in various sources, including but not limited to human sample, such as blood, saliva, respiratory tract secretion
Object, urine, tear, sweat, hair, skin swab, buccal swab, tumor tissues, normal structure etc.；Or sample is animal sample
Product, such as animal tissue, hair, blood, secretion；Or sample is plant sample, such as plant leaf blade, rhizome, seed, flower
Deng；Or sample is environmental sample, such as underground water, surface water, seawater, industrial agricultural effluent, soil, air；Or sample
Come from food, drinking water, feed etc..
When nucleic acid sequence in sample is RNA, reverse transcription processing further can be first carried out, is expanded accordingly again later
Increase.
The detection means of the reaction product of amplification includes but not limited to traditional agarose electrophoresis, PAGE electrophoresis, capillary electricity
Swimming, or by be added in the reaction system 50-400 μM with the molecular beacon molecule of detection zone complementary specificity to be amplified simultaneously
Carry out real-time fluorescence detection.
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In addition, it should also be understood that, after reading the content taught by the present invention, people in the art
Member can make various changes or modifications the present invention, and such equivalent forms also belong to protection scope of the present invention.
Embodiment 1. carries out short target dna double-strand using the chain substitution amplified reaction based on CRISPR-Cas9 systems
Specific amplification, and be detected by traditional PAGE technologies
For one section of short dna double-strand (450bp) design and a pair of of sgRNA is synthesized by in-vitro transcription, respectively specificity
Identify short dna double-strand upstream CCAGTGCAAGTGCAGGTGCCAGA (SEQ ID NO：1) (wherein 5 ' end CCA are PAM sequences
The complementary series of NGG) and downstream GGCCCAGACTGAGCACGTGATGG (SEQ ID NO：2) (wherein 3 ' end TGG are PAM sequences
Row).The sgRNA of identification upstream and downstream sequence is respectively designated as sgRNA-UPS and sgRNA-DNS.
sgRNA-UPS：GUGCAAGUGCAGGUGCCAGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU
AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID NO：3)
sgRNA-DNS：GGCCCAGACUGAGCACGUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUA
GUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID NO：4)
Replace isothermal duplication with the single-stranded chain for binding site of target DNA sequence that the binding site of above-mentioned sgRNA is exposed
DNA primer is to being respectively designated as UPS-ISO and DNS-ISO.
UPS-ISO：TAGATCGGTAAGGATAGCGCTGAGGGCAAGTGCAGGTGCCAGAACATTTCTCTATCGAT
(SEQ ID NO：5)
DNS-ISO：TAGATCGGTAAGGATAGCGCTGAGGACGTGCTCAGTCTGGGCCTCGAGC(SEQ ID NO：
6)。
Short dna double-strand mother liquid concentration to be detected is 223ng/ μ L, and molar concentration is 1 μM.By 1:The mode of 10 gradient dilutions,
Substep prepares 500nM~5aM short dna double-strand solution to be detected.The ion concentration of dilute solution be 50~300mM (NaCl or
KCl), ranging from pH6~8.5 a concentration of 0.1%~0.5%, BSA of Tween20 a concentration of 0.1~0.3mg/ μ L, pH.
Steps are as follows for specific experiment：
1) under the conditions of certain ion concentration (NaCl or KCl, 50~300mM) and pH ranges (pH6~8.5), will know
The sgRNA-UPS of the other upstream DNA target sequence and sgRNA-DNS of downstream DNA target sequence respectively with wild type Cas9 and/or HNH
The Cas9 nickases of nucleic acid enzyme defect are 1 by molar concentration rate：2 at a certain temperature (room temperature~45 DEG C, preferred 37 DEG C) incubate
It educates 15 minutes, to prepare the Cas9-sgRNA protein nucleic acid complexs with target activity；In step reaction, sgRNA's is dense
Degree is 20nM~400nM, a concentration of 10nM~200nM of the Cas9 nickases of wild type Cas9 and/or HNH nucleic acid enzyme defect；
2) the Cas9-sgRNA protein nucleic acid complexs of specific recognition upstream and downstream DNA target sequence after incubation are pressed into volume 1：
1 mixing；The to be checked of 10 μ L various concentrations (500nM~5aM) is added in Cas9-sgRNA protein nucleic acid complexs after 1 μ L mixings
It surveys in short dna double-strand solution；(room temperature~45 DEG C, preferred 37 DEG C) are incubated 15 minutes at a certain temperature, to complete Cas9-
SgRNA protein nucleic acids complex is reacted with the identification of the upstream and downstream DNA target sequence in short dna double-strand to be detected；
3) be added into the reaction system after the completion of identification the certain density upstream and downstream amplimers of 2 μ L (UPS-ISO and
DNS-ISO a concentration of is respectively 50nM~2 μM), (room temperature~45 DEG C, preferred 37 DEG C) are incubated 5 minutes at a certain temperature, with
Complete the knot of the single-stranded regions exposed after amplimer is combined with upstream and downstream DNA target sequence region by Cas9-sgRNA complexs
Close reaction；
4) chain is added in equal volume and replaces isothermal amplification enzyme (final concentration：KlenowFragmentexo-：0.1~
0.5U/ μ L, Nb.BbvCI nickases：0.01~0.2U/ μ L；dNTPs：100~300nM；SSB：500nM~2 μM；BSA：0.1
~0.3mg/ μ L；And other ion concentrations, pH etc. is as aforementioned), and at a certain temperature (room temperature~45 DEG C, preferred 37 DEG C)
It is incubated (60~120 minutes), you can complete amplified reaction；
5) into the reaction system after amplification by volume 20：1 addition EvaGreen fluorescent dyes, 6：1 is added 36%
Glycerine water solution, with 6% Native PAGE glue, electrophoresis 20 minutes under the conditions of 1xTBE, 150V；Non- change after the completion of electrophoresis
Property PAGE glue carry out quantitative detection with fluorescent glue imager.
Experimental result shows (Fig. 2), and the chain substitution amplified reaction of the invention based on CRISPR-Cas9 systems can will be down to
The short dna double-strand to be detected of 50aM be expanded in 1.5 hours can be detected by traditional Native PAGE level (>5ng), i.e.,
More than 108Amplification again.For the specificity of the verification present invention, it is being more than 10ng/ μ L's by being added in above-mentioned amplified reaction
After non-template interferes DNA, amplification is not affected.Meanwhile by short dna duplex concentration to be detected be 500fM but body
The detection sample without Cas9 albumen further demonstrates Cas9 in this amplification system without any amplified band being detected in system
The effect of albumen.
Embodiment 2. replaces amplified reaction to short in human gene group DNA using based on the chain of CRISPR-Cas9 systems
Target fragment carries out specific amplification, and is detected by traditional PAGE technologies
First by commercial kit, from extraction genomic DNA in human embryonic kidney cells (HEK293).By people's base of extraction
Because a group DNA ladder degree is diluted to 2.5ng/ μ L.In the detected sample, the concentration of human gene group DNA is about 692.4aM.It is examining
In survey, using the solution example of Plasmid DNA (pEGFP-C2) or musculus cdna group DNA as negative control.Plasmid DNA in negative control
(pEGFP-C2) or the concentration of musculus cdna group DNA is 30ng/ μ L.
Using method same as Example 1, for the specific region in human genome, design synthesis specific recognition should
SgRNA pairs of region upstream and downstream target DNA sequence.It is anti-for the chain substitution amplification based on CRISPR-Cas9 systems of the verification present invention
The repeatability answered, we devise 3 pairs sgRNA pairs, have carried out isothermal detection for 3 different sites in human genome.
3 sites to be detected are respectively：
| Site 1 | People's Chromosome 9：Nucleotide sequence 110330835 to 110331009 |
| Site 2 | People's Chromosome 9：Nucleotide sequence 110331126 to 110331334 |
| Site 3 | No. 12 chromosome of people：Nucleotide sequence 13983991 to 13984189 |
For sgRNA pairs of site 1, the difference specific recognition short dna double-strand upstream
CCTAAGGTTGAGGCCAGTTGCAA(SEQ ID NO：7) (complementary series that wherein 5 ' end CCT are PAM sequences NGG) and downstream
CTTGTAGCTACGCCTGTGATGGG(SEQ ID NO：8) (wherein 3 ' end GGG are PAM sequences).Identify upstream and downstream sequence
SgRNA be respectively designated as h-sgRNA1-UPS and h-sgRNA1-DNS.
h-sgRNA1-UPS：AAGGUUGAGGCCAGUUGCAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG
GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID NO：9)
h-sgRNA1-DNS：CUUGUAGCUACGCCUGUGAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG
CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID NO：10)
Replace isothermal duplication with the single-stranded chain for binding site of target DNA sequence that the binding site of above-mentioned sgRNA is exposed
DNA primer is to being respectively designated as h1-UPS-ISO and h1-DNS-ISO.
h1-UPS-ISO：TAGATCGGTAAGGATAGCGCTGAGGGGTTGAGGCCAGTTGCAAAGACAATTGACATGT
(SEQ ID NO：11)
h1-DNS-ISO：TAGATCGGTAAGGATAGCGCTGAGGCACAGGCGTAGCTACAAGATTAGTTTTGAGAC
(SEQ ID NO：12)
For sgRNA pairs of site 2, the difference specific recognition short dna double-strand upstream
CCTTGGAGAGTTTTAAGCAAGGG(SEQ ID NO：13) (wherein 5 ' end CCT be PAM sequences NGG complementary series) and under
Swim GGCCCAGACTGAGCACGTGATGG (SEQ ID NO：14) (wherein 3 ' end TGG are PAM sequences).Identify upstream and downstream
The sgRNA of sequence is respectively designated as h-sgRNA2-UPS and h-sgRNA2-DNS.
h-sgRNA2-UPS：UGGAGAGUUUUAAGCAAGGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG
GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID NO：15)
h-sgRNA2-DNS：GGCCCAGACUGAGCACGUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG
GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID NO：16)
Replace isothermal duplication with the single-stranded chain for binding site of target DNA sequence that the binding site of above-mentioned sgRNA is exposed
DNA primer is to being respectively designated as h2-UPS-ISO and h2-DNS-ISO.
h2-UPS-ISO：TAGATCGGTAAGGATAGCGCTGAGGGAGAGTTTTAAGCAAGGGCTGATGTGGGCTGC
(SEQ ID NO：17)
h2-DNS-ISO：TAGATCGGTAAGGATAGCGCTGAGGACGTGCTCAGTCTGGGCCCCAAGGATT(SEQ
ID NO：18)
For sgRNA pairs of site 3, the difference specific recognition short dna double-strand upstream
CCACCCGGGGTACCACGGAGAGA(SEQ ID NO：19) (wherein 5 ' end CCA be PAM sequences NGG complementary series) and under
Swim GGAGAACAGCACTCCGCTCTGGG (SEQ ID NO：20) (wherein 3 ' end GGG are PAM sequences).Identify upstream and downstream
The sgRNA of sequence is respectively designated as h-sgRNA3-UPS and h-sgRNA3-DNS.
h-sgRNA3-UPS：UCUCUCCGUGGUACCCCGGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG
GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID NO：21)
h-sgRNA3-DNS：GGAGAACAGCACUCCGCUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG
CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID NO：22)
Replace isothermal duplication with the single-stranded chain for binding site of target DNA sequence that the binding site of above-mentioned sgRNA is exposed
DNA primer is to being respectively designated as h3-UPS-ISO and h3-DNS-ISO.
h3-UPS-ISO：TAGATCGGTAAGGATAGCGCTGAGGCGGGGTACCACGGAGAGATGGTGGAAATCAT
(SEQ ID NO：23)
h3-DNS-ISO：TAGATCGGTAAGGATAGCGCTGAGGAGCGGAGTGCTGTTCTCCCAAGTTCTGGTTG
(SEQ ID NO：24).
Steps are as follows for specific experiment：
1. with 1~3 step in embodiment 1, under the same conditions, the Cas9-sgRNA eggs with target activity are prepared respectively
White nucleic acid complex completes Cas9-sgRNA protein nucleic acids complex and the upstream and downstream DNA target sequence in short dna double-strand to be detected
Identification reaction and primer association reaction.
2. isometric chain substitution isothermal amplification enzyme (final concentration being added after optimization：KlenowFragmentexo-：
0.4~2U/ μ L, Nb.BbvCI nickases：0.05~1U/ μ L；dNTPs：100~300nM；SSB：1 μM~4 μM；BSA：0.1~
0.3mg/μL；And other ion concentrations, pH etc. is as aforementioned), and (room temperature~45 DEG C, preferred 37 DEG C) are incubated at a certain temperature
It educates (60~120 minutes), you can complete amplified reaction.
3. into the reaction system after amplification by volume 20：1 addition EvaGreen fluorescent dyes, 6：1 is added 36%
Glycerine water solution, with 6% Native PAGE glue, electrophoresis 20 minutes under the conditions of 1xTBE, 150V.Non- change after the completion of electrophoresis
Property PAGE glue carry out quantitative detection with fluorescent glue imager.
Experimental result shows (Fig. 3), the chain substitution amplified reaction of the invention based on CRISPR-Cas9 systems can down to
In the human genome sample of 670aM~67aM, in 1.5 hours by target fragment specific amplification extremely can by tradition it is non denatured
Level that PAGE is detected (>5ng), that is, it is more than 108Amplification again.Meanwhile in no Cas9 albumen, or with Plasmid DNA (pEGFP-
C2) or musculus cdna group DNA is not amplify any purpose band in the sample for interfere DNA.
Embodiment 3. carries out short target dna double-strand using the chain substitution amplified reaction based on CRISPR-Cas9 systems
Specific amplification, and be detected by RT-PCR technology (real-time fluorescence PCR).
Using method same as Example 1 the sgRNA in embodiment 1 is used for one section of short dna double-strand (450bp)
Specific amplification detection is carried out to the short dna double-strand to sgRNA-UPS and sgRNA-DNS.
Steps are as follows for specific experiment：
1. with 1~3 step in embodiment 1, under the same conditions, the Cas9-sgRNA eggs with target activity are prepared respectively
White nucleic acid complex completes Cas9-sgRNA protein nucleic acids complex and the upstream and downstream DNA target sequence in short dna double-strand to be detected
Identification reaction and primer association reaction.
2. isometric chain substitution isothermal amplification enzyme (final concentration being added after optimization：KlenowFragmentexo-：
0.4~2U/ μ L, Nb.BbvCI nickases：0.05~1U/ μ L；dNTPs：100~300nM；SSB：1 μM~4 μM；BSA：0.1~
0.3mg/μL；And other ion concentrations, pH etc. is as aforementioned), and for the molecular beacon (MB of region to be amplified design：FAM-
CCGCGACTGCCTGCGTGAGATTCTCGCACGCGG-Dabcyl(SEQ ID NO：25), 100nM~400nM), and specific
At a temperature of (room temperature~45 DEG C, preferred 37 DEG C) be incubated (60~120 minutes), you can complete amplified reaction.
Experimental result shows (Fig. 4) that the chain of the invention based on CRISPR-Cas9 systems replaces amplified reaction binding molecule
Beacon is simultaneously detected using real-time fluorescence, and the target DNA sample down to 1aM can be detected in 1.5 hours.
Embodiment 4. replaces amplified reaction special under high pollution object background using the chain based on CRISPR-Cas9 systems
Property detection human genome in small fragment DNA, and be detected by traditional PAGE technologies.
Using method same as Example 2, using the sgRNA in embodiment 2 to h-sgRNA2-UPS and h-sgRNA2-
DNS for the specific region in human genome to carrying out specific amplification detection.
Steps are as follows for specific experiment：
With 1 step in embodiment 1, under the same conditions, it is multiple to prepare the Cas9-sgRNA protein nucleic acids with target activity
It is fit.
1) in the short dna double-strand solution to be detected of various concentration, 1：1, which is mixed into mammalian cell ultrasound, slightly splits product
(i.e. product after the abundant ultrasonication of PBS solution of 100,000 cells/mL).Specific recognition upstream and downstream DNA target after being incubated
The Cas9-sgRNA protein nucleic acid complexs of sequence press volume 1：1 mixing.Cas9-sgRNA protein nucleic acids after 1 μ L mixings are answered
Zoarium is added in the short dna double-strand solution to be detected of 10 μ L various concentrations (500nM~5aM).(room temperature~45 at a certain temperature
DEG C, preferred 37 DEG C) it is incubated 20 minutes, to complete in Cas9-sgRNA protein nucleic acids complex and short dna double-strand to be detected
The identification of upstream and downstream DNA target sequence is reacted.
2) with 3~5 steps in embodiment 1, primer is completed with upstream and downstream DNA target sequence region by Cas9-sgRNA complexs
The association reaction of the single-stranded regions exposed in conjunction with after, primer association reaction and final PAGE detections.
Experimental result shows (Fig. 5), the impurity (pollutant) after a large amount of clasmatosis, to the present invention based on
The efficiency and specificity of the chain substitution amplified reaction of CRISPR-Cas9 systems have no effect.
SEQUENCE LISTING
<110>Shenzhen Institutes of Advanced Technology, Chinese Academy of Science
<120>Isothermal duplication and detection technique based on the substitution of CRISPR- chains
<130>
<160> 25
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> DNA
<213>Artificial sequence
<400> 1
ccagtgcaag tgcaggtgcc aga 23
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<400> 2
ggcccagact gagcacgtga tgg 23
<210> 3
<211> 97
<212> RNA
<213>Artificial sequence
<400> 3
gugcaagugc aggugccaga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97
<210> 4
<211> 97
<212> RNA
<213>Artificial sequence
<400> 4
ggcccagacu gagcacguga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97
<210> 5
<211> 59
<212> DNA
<213>Artificial sequence
<400> 5
tagatcggta aggatagcgc tgagggcaag tgcaggtgcc agaacatttc tctatcgat 59
<210> 6
<211> 49
<212> DNA
<213>Artificial sequence
<400> 6
tagatcggta aggatagcgc tgaggacgtg ctcagtctgg gcctcgagc 49
<210> 7
<211> 23
<212> DNA
<213>Artificial sequence
<400> 7
cctaaggttg aggccagttg caa 23
<210> 8
<211> 23
<212> DNA
<213>Artificial sequence
<400> 8
cttgtagcta cgcctgtgat ggg 23
<210> 9
<211> 97
<212> RNA
<213>Artificial sequence
<400> 9
aagguugagg ccaguugcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97
<210> 10
<211> 97
<212> RNA
<213>Artificial sequence
<400> 10
cuuguagcua cgccugugau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97
<210> 11
<211> 58
<212> DNA
<213>Artificial sequence
<400> 11
tagatcggta aggatagcgc tgaggggttg aggccagttg caaagacaat tgacatgt 58
<210> 12
<211> 57
<212> DNA
<213>Artificial sequence
<400> 12
tagatcggta aggatagcgc tgaggcacag gcgtagctac aagattagtt ttgagac 57
<210> 13
<211> 23
<212> DNA
<213>Artificial sequence
<400> 13
ccttggagag ttttaagcaa ggg 23
<210> 14
<211> 23
<212> DNA
<213>Artificial sequence
<400> 14
ggcccagact gagcacgtga tgg 23
<210> 15
<211> 97
<212> RNA
<213>Artificial sequence
<400> 15
uggagaguuu uaagcaaggg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97
<210> 16
<211> 97
<212> RNA
<213>Artificial sequence
<400> 16
ggcccagacu gagcacguga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97
<210> 17
<211> 57
<212> DNA
<213>Artificial sequence
<400> 17
tagatcggta aggatagcgc tgagggagag ttttaagcaa gggctgatgt gggctgc 57
<210> 18
<211> 52
<212> DNA
<213>Artificial sequence
<400> 18
tagatcggta aggatagcgc tgaggacgtg ctcagtctgg gccccaagga tt 52
<210> 19
<211> 23
<212> DNA
<213>Artificial sequence
<400> 19
ccacccgggg taccacggag aga 23
<210> 20
<211> 23
<212> DNA
<213>Artificial sequence
<400> 20
ggagaacagc actccgctct ggg 23
<210> 21
<211> 97
<212> RNA
<213>Artificial sequence
<400> 21
ucucuccgug guaccccggg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97
<210> 22
<211> 97
<212> RNA
<213>Artificial sequence
<400> 22
ggagaacagc acuccgcucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97
<210> 23
<211> 56
<212> DNA
<213>Artificial sequence
<400> 23
tagatcggta aggatagcgc tgaggcgggg taccacggag agatggtgga aatcat 56
<210> 24
<211> 56
<212> DNA
<213>Artificial sequence
<400> 24
tagatcggta aggatagcgc tgaggagcgg agtgctgttc tcccaagttc tggttg 56
<210> 25
<211> 33
<212> DNA
<213>Artificial sequence
<400> 25
ccgcgactgc ctgcgtgaga ttctcgcacg cgg 33
Claims (10)
1. a kind of isothermal amplification kit based on the substitution of CRISPR- chains, including chain replace isothermal duplication reagent, feature to exist
In：Kit further comprises the Cas9 nickases of wild type Cas9 and/or nucleic acid enzyme defect, specific recognition target dna sequence
SgRNA pairs of upstream and downstream, chain replace the amplimer pair of isothermal amplification, the primer pair and Cas9-sgRNA complexs pair with
The single-stranded regions that target gene exposes after combining are complementary.
2. isothermal amplification kit according to claim 1, it is characterised in that：The Cas9 nickases of nucleic acid enzyme defect are
The Cas9 nickases of HNH nucleic acid enzyme defects.
3. isothermal amplification kit according to claim 1, it is characterised in that：SgRNA pairs of recognition site is respectively mesh
Sequences upstream CCN sequences 3 ' hold 10~30 nucleotide sequences and downstream NGG sequences 5 ' hold 10~30 nucleotides sequences
Row.
4. isothermal amplification kit according to claim 1, it is characterised in that：The DNA of chain substitution isothermal duplication reagent draws
Object has following feature：The primer 5 ' end contains a notch enzyme recognition site, and the restriction enzyme site in the site is in its complementation
On chain；At least ten of chain where the NGG sequences in the target DNA region that the stage casing of the primer is identified with Cas-sgRNA complexs
Continuous nucleotide complementary pairing.
5. isothermal amplification kit according to claim 4, it is characterised in that：The DNA of chain substitution isothermal duplication reagent draws
3 ' ends of object contain the sequence with chain nucleotide complementation where NGG sequences of one section of 1~10 nucleotide.
6. isothermal amplification kit according to claim 1, it is characterised in that：SgRNA to the spacing 100 of recognition site~
1000bp, preferably 100~250bp, recognition site 5 ' are held using CCN as starting point, and 3 ' end target sequences are using NGG as terminal.
7. a kind of kit for detecting nucleic acid based on the substitution of CRISPR- chains, it is characterised in that：Including any one of claim 1~6
The isothermal amplification kit and the quantitative analysis of nucleic acids reagent.
8. kit for detecting nucleic acid according to claim 7, it is characterised in that：The quantitative analysis of nucleic acids reagent is selected from specificity
Molecular beacon molecule.
9. based on the isothermal amplification method of CRISPR- chains substitution, include the following steps：
1) sample to be tested nucleic acid is obtained；
2) reagent contained using any one of claim 1~6 isothermal amplification kit expands nucleic acid samples to be measured.
10. based on the isothermal amplification detection method of CRISPR- chains substitution, include the following steps：
1) sample to be tested nucleic acid is obtained；
2) reagent contained using any one of claim 1~6 isothermal amplification kit expands nucleic acid samples to be measured；
3) amplified production is analyzed, determines testing result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810328785.3A CN108588182A (en) | 2018-04-13 | 2018-04-13 | Isothermal duplication and detection technique based on the substitution of CRISPR- chains |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810328785.3A CN108588182A (en) | 2018-04-13 | 2018-04-13 | Isothermal duplication and detection technique based on the substitution of CRISPR- chains |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108588182A true CN108588182A (en) | 2018-09-28 |
Family
ID=63622119
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810328785.3A Pending CN108588182A (en) | 2018-04-13 | 2018-04-13 | Isothermal duplication and detection technique based on the substitution of CRISPR- chains |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108588182A (en) |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| CN110607355A (en) * | 2019-02-18 | 2019-12-24 | 华东理工大学 | Cas9 nickase-coupled DNA polymerase-based constant-temperature nucleic acid detection and analysis method and kit |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| CN111154913A (en) * | 2018-11-08 | 2020-05-15 | 中山大学 | Primer and crRNA for EB virus DNA detection and application thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| WO2021121321A1 (en) * | 2019-12-18 | 2021-06-24 | 华东师范大学 | Fusion protein that improves gene editing efficiency and application thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| CN115992284A (en) * | 2022-09-16 | 2023-04-21 | 上海市农业科学院 | Kit and method for rapidly detecting transgenic product based on RPA-CRISPR-Cas12a system |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| EP4265741A1 (en) * | 2022-04-21 | 2023-10-25 | Consejo Superior de Investigaciones Científicas (CSIC) | Multiplexable crispr-cas9-based virus detection method |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177110A (en) * | 2015-09-11 | 2015-12-23 | 中国科学院微生物研究所 | Detection method of nucleic acid |
| CN107488656A (en) * | 2016-06-13 | 2017-12-19 | 陆欣华 | A kind of nucleic acid isothermal is from amplification method |
| CN107488710A (en) * | 2017-07-14 | 2017-12-19 | 上海吐露港生物科技有限公司 | A kind of purposes of Cas albumen and the detection method and kit of target nucleic acids molecule |
-
2018
- 2018-04-13 CN CN201810328785.3A patent/CN108588182A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177110A (en) * | 2015-09-11 | 2015-12-23 | 中国科学院微生物研究所 | Detection method of nucleic acid |
| CN107488656A (en) * | 2016-06-13 | 2017-12-19 | 陆欣华 | A kind of nucleic acid isothermal is from amplification method |
| CN107488710A (en) * | 2017-07-14 | 2017-12-19 | 上海吐露港生物科技有限公司 | A kind of purposes of Cas albumen and the detection method and kit of target nucleic acids molecule |
Non-Patent Citations (3)
| Title |
|---|
| KAIXIANG ZHANG 等: "Cas9 cleavage assay for pre-screening of sgRNAs using nicking triggered isothermal amplification", 《CHEMICAL SCIENCE》 * |
| ZHOUWENHUA等: "A CRISPR–Cas9-triggered strand displacement amplification method for ultrasensitive DNA detection", 《NATURE》 * |
| 张开翔: "基于核酸等温扩增的生物分析方法研究", 《中国博士学位论文全文数据库基础科学辑》 * |
Cited By (41)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN111154913B (en) * | 2018-11-08 | 2023-04-18 | 中山大学 | Primers and crRNA for EB virus DNA detection and application thereof |
| CN111154913A (en) * | 2018-11-08 | 2020-05-15 | 中山大学 | Primer and crRNA for EB virus DNA detection and application thereof |
| CN110607355A (en) * | 2019-02-18 | 2019-12-24 | 华东理工大学 | Cas9 nickase-coupled DNA polymerase-based constant-temperature nucleic acid detection and analysis method and kit |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| WO2021121321A1 (en) * | 2019-12-18 | 2021-06-24 | 华东师范大学 | Fusion protein that improves gene editing efficiency and application thereof |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| EP4265741A1 (en) * | 2022-04-21 | 2023-10-25 | Consejo Superior de Investigaciones Científicas (CSIC) | Multiplexable crispr-cas9-based virus detection method |
| WO2023203206A1 (en) | 2022-04-21 | 2023-10-26 | Consejo Superior De Investigaciones Científicas (Csic) | Multiplexable crispr-cas9-based virus detection method |
| CN115992284A (en) * | 2022-09-16 | 2023-04-21 | 上海市农业科学院 | Kit and method for rapidly detecting transgenic product based on RPA-CRISPR-Cas12a system |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108588182A (en) | Isothermal duplication and detection technique based on the substitution of CRISPR- chains | |
| CN107058320B (en) | The preparation and its application of IL7R gene delection zebra fish mutant | |
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| CN110878343B (en) | Cpf1 kit for rapidly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof | |
| US9624542B2 (en) | Telomere length measurement in formalin-fixed, paraffin embedded (FFPE) samples by quantitative PCR | |
| CN110093457A (en) | A kind of African swine fever virus ASFV-LAMP detection primer group and kit | |
| US8080378B2 (en) | Method of detecting colon cancer marker | |
| WO2004044209A1 (en) | A method of detection | |
| CN110004250A (en) | A kind of African swine fever virus LAMP visual detection kit | |
| CN111521781B (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
| CN109837345A (en) | Detect the primer and method of mouse cell residual DNA | |
| CN104212792A (en) | Nicking endonuclease-based netted rolling cycle amplification system and use thereof | |
| CN107227377B (en) | RPA-IAC primer and method for detecting vibrio vulnificus | |
| CN114231665A (en) | Phaseolus golden mosaic virus (RPA-LFD) detection kit and application thereof | |
| CN107653308B (en) | One group is combined and kit for distinguishing active tuberculosis patient with the primer pair of non-tuberculous pneumonia patient | |
| CN109161586A (en) | A kind of pair of RNA molecule carries out the high-flux sequence method of absolute quantitation | |
| CN107385057B (en) | RPA-IAC primer and method for detecting vibrio cholerae | |
| CN110894550A (en) | RAA constant temperature fluorescence detection method and reagent for eel Herpes Virus (HVA) | |
| CN110791568A (en) | LAMP primer group for rapidly detecting chicken-derived components in beef and mutton, detection kit, detection method and application | |
| JP2008072951A (en) | Method for rapid detection of serum type of salmonella o4 group using lamp method | |
| CN107227378B (en) | RPA-IAC primer and method for detecting vibrio mimicus | |
| CN114164296B (en) | Primer probe composition for detecting pythium oligandrum, kit and application and detection method | |
| CN110894544A (en) | RAA constant temperature fluorescence detection method and reagent for Salmon Alphavirus (SAV) | |
| KR20190136647A (en) | Methode for detecting and absolute quantification of Alexandrium spp. using digital PCR | |
| CN108841997A (en) | A kind of kit of Electrochemistry gene chip method detection common type influenza A virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20191113 Address after: Office building of Shenzhen Institute of advanced technology A-207 518000 in Guangdong city of Shenzhen province Nanshan District City Road No. 1068 Chinese Academy of Shenzhen University Academy of Sciences Applicant after: Shenzhen advanced science and technology Cci Capital Ltd Address before: 1068 No. 518055 Guangdong city of Shenzhen province Nanshan District Shenzhen University city academy Avenue Applicant before: Shenzhen Institutes of Advanced Technology, Chinese Academy of Science |
|
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200518 Address after: 430000 floor 1-6, building A6, Huazhong e-commerce Industrial Park, plot 206M, Wuhan Economic and Technological Development Zone, Wuhan City, Hubei Province Applicant after: WUHAN ZHONGKE ADVANCED TECHNOLOGY RESEARCH INSTITUTE Co.,Ltd. Address before: Office building of Shenzhen Institute of advanced technology A-207 518000 in Guangdong city of Shenzhen province Nanshan District City Road No. 1068 Chinese Academy of Shenzhen University Academy of Sciences Applicant before: Shenzhen advanced science and technology Cci Capital Ltd |
|
| TA01 | Transfer of patent application right |