CN105177110A

CN105177110A - Detection method of nucleic acid

Info

Publication number: CN105177110A
Application number: CN201510578997.3A
Authority: CN
Inventors: 娄春波; 欧阳颀; 张益豪; 魏伟佳
Original assignee: Peking University; Institute of Microbiology of CAS
Current assignee: Peking University; Institute of Microbiology of CAS
Priority date: 2015-09-11
Filing date: 2015-09-11
Publication date: 2015-12-23

Abstract

The present invention relates to an in vitro detection method that whether a sample contains target nucleic acid or not is detected by utilizing fusion protein of split-signaling morphogenetic protein and nucleic acid enzyme defect type Cas9 protein, a kit and a device.

Description

The detection method of nucleic acid

Technical field

The invention belongs to field of biological detection, relate to and utilize the fusion rotein of split-type signal generation albumen and nuclease-deficient Cas9 albumen to external (invitro) method, test kit and the equipment that whether there is target nucleic acid in sample and detect.

Background technology

Nucleic acid detection method has a wide range of applications at modern medical service, food safety and field of public health.Particularly when detecting the infectivity pathogenic bacteria in food, tap water and patient body fluid sample, for formulating treatment or solution targetedly quickly, need to obtain the information in the kind of pathogenic bacteria, concentration and resistance etc. within the time short as far as possible.But, due to the restriction of traditional detection method in sensitivity, need first may contain the sample incubation a few hours of pathogenic bacteria to be measured to a couple of days, the common detection methods such as reverse transcription, PCR or order-checking could be implemented.The delay of such length will miss the best moment giving to treat targetedly or process.Owing to relating to, liquid or solid is cultivated, RNA or DNA extraction, the operation such as centrifugal, these class methods need manually to be implemented by professional and technical personnel in clinical experiment indoor, often occur crossed contamination or the inconsistent problem of result.In addition, need also cause this type of detection method cost higher by special desk-top instrument and be difficult to realize portability.

For the problems referred to above, researchist develops the nucleic acid detection method that two classes are improved.The first kind is for utilizing isothermal duplication (isothermalamplification) technical substitution normal PCR.For DNA sample, by the archaeal dna polymerase (such as Bst, Φ 29 etc.) with strand-displacement activity, amplification (the AngelikaNiemz etc. of catalysis single stranded DNA at a constant temperature, TrendsinBiotechnology, 2011,29 (5): 240-250).For RNA sample, the isothermal amplification method (such as NASBA, Ribo-SPIA etc.) that RNA polymerase can be utilized to participate in directly obtains DNA cloning product by RNA template, or first implement a step reverse transcription, then carry out the conventional isothermal duplication for DNA.Simple to operate and the effect stability of isothermal duplication, does not need to use expensive thermal cycler.Due to insensitive to the inhibitor of normal PCR, further simplification (DevelopmentofRapidIsothermalAmplificationAssaysforDetect ionofPhytophthoraspp.inPlantTissue is able to the pre-treatment of sample, MilesTD etc., Phytopathology, 2015,105 (2): 265-278; RapiddetectionofHIV-1byReverse-Transcription, Loop-MediatedIsothermalAmplification (RT-LAMP), CurtisKA etc., 2008, J.Virol.Methods151 (2): 264-270).The clinical practice that these characteristics make isothermal amplification method be more suitable for for the popular middle and low income country of the transmissible diseases such as tuberculosis, malaria, cholera on a large scale.

The detection method that Equations of The Second Kind improves is molecular beacon (molecularbeacon) technology utilizing nucleic acid probe.Molecular beacon design is specific recognition sequence to be detected and has the single stranded oligonucleotide of loop-stem structure, and the end of this loop-stem structure is marked with fluorophor and quenching group respectively.Molecular beacon not with target nucleic acid in conjunction with time, fluorophor and quenching group spatially vicinity, due to occur energy trasfer, the fluorescence that fluorophor sends is quenched.And when molecular beacon and target nucleic acid complementation in conjunction with time, the spacing of fluorophor and quenching group exceeds energy trasfer scope, and fluorescence is detected.Sequence to be detected can be RNA and DNA.Molecular beacons technology can realize detecting (MolecularBeacon:ProbesthatFluoresceuponHybridization for the original position (insitu) of biopsy samples, SanjayTyagi etc., NatureBiotechnology, 1996,14 (3): 303-308).In molecular beacons technology, beacon is combined with the ratio of 1:1 with target dna, is difficult to signal to amplify.As improvement, there is report to be combined with molecular beacons technology by rolling circle amplification (a kind of isothermal amplification technique), or utilize the catalysis of DNA nickase, make signal amplify (JianweiLi etc., NucleicAcidsRes., 2008 further; 36 (6)).

Nucleic acid-protein is not almost utilized to interact the method detected nucleic acid in prior art.But what find recently all has for any DNA sequence the detection that the albumen (such as ZFN, TALEN or CRISPR/Cas9 system) of programmable type binding ability is nucleic acid and provides new thinking.Prior art mainly using above-mentioned albumen as gene editing instrument, also do not use it for the report of the nucleic acid detected in sample.

Summary of the invention

In first aspect, the invention provides a kind of method to whether there is target nucleic acid in sample and detecting, described target nucleic acid is target dna, and described method comprises following steps:

(1) the first fusion rotein and the second fusion rotein are provided, wherein, described first fusion rotein is the fusion rotein of split-type signal generation albumen n end fragment and nuclease-deficient Cas9 albumen, described second fusion rotein is the fusion rotein of split-type signal generation PROTEIN C end fragment and nuclease-deficient Cas9 albumen, and the described signal generation albumen be made up of described N end fragment and described C end fragment can participate in the chemical reaction producing detectable signal;

(2) for the one or more pairs of target sequence in described target dna, sgRNA couple is designed and synthesized;

(3) each sgRNA that described first fusion rotein described sample, step (1) provided and described second fusion rotein, step (2) obtain to and participate in producing other reactant of chemical reaction of detectable signal and/or catalyzer is hatched jointly, generate detectable signal; And

(4) described detectable signal is measured.

In second aspect, the invention provides a kind of method to whether there is target nucleic acid in sample and detecting, described target nucleic acid is target RNA, and described method comprises following steps:

(1') the first fusion rotein and the second fusion rotein are provided, wherein, described first fusion rotein is the fusion rotein of split-type signal generation albumen n end fragment and nuclease-deficient Cas9 albumen, described second fusion rotein is the fusion rotein of split-type signal generation PROTEIN C end fragment and nuclease-deficient Cas9 albumen, and the described signal generation albumen be made up of described N end fragment and described C end fragment can participate in the chemical reaction producing detectable signal;

(2'), for the one or more pairs of target sequence in the target dna corresponding to described target RNA, design and synthesize sgRNA couple;

(3'), for the described target RNA in described sample, implement the target dna of reverse transcription also corresponding to acquisition;

(4') described first fusion rotein that (1') target dna step (3') obtained, step provide and each sgRNA that (2') described second fusion rotein, step obtain to and participate in other reactant of the chemical reaction producing detectable signal and/or catalyzer is hatched jointly, generate detectable signal; And

(5') described detectable signal is measured.

In the third aspect, the invention provides a kind of test kit, described test kit comprises: the first fusion rotein and the second fusion rotein, described first fusion rotein is the fusion rotein of split-type signal generation albumen n end fragment and nuclease-deficient Cas9 albumen, described second fusion rotein is the fusion rotein of split-type signal generation PROTEIN C end fragment and nuclease-deficient Cas9 albumen, and the described signal generation albumen be made up of described N end fragment and described C end fragment can participate in the chemical reaction producing detectable signal.

In fourth aspect, the invention provides a kind of equipment, described equipment comprises raising module and detection module, described raising module is used for hatching step of the present invention (3) or reaction mixture (4'), and described detection module is for implementing step of the present invention (4) or (5').

Beneficial effect

Detection method of the present invention mainly utilizes CRISPR/Cas9 system can identify the character of any DNA sequence.Action site due to Cas9 albumen depends on designed sgRNA sequence completely, for arbitrary target sequence, can design and synthesize corresponding sgRNA.Nuclease-deficient Cas9 is utilized to achieve location and do not cut target dna.When existence in sample comprises the target dna of target sequence, the recognition sequence of each sgRNA of sgRNA centering can combine with target dna complementation, make one or more pairs of target sequences that the nuclease-deficient Cas9 structural domain of the first fusion rotein and the second fusion rotein is all positioned on target dna, form each nuclease-deficient Cas9-sgRNA-target dna complex body, thus split-type signal generation albumen n end fragment and C end fragment spatially located adjacent one another and re-assembly, therefore, it is possible to realize complete signal to send out function protedogenous.This signal generation albumen can participate in such as luminescence, fluorescence, generating etc. as enzyme or substrate can produce the reaction of detectable signal, thus be optical signal or electrical signal with sgRNA to the convert information that complementation is combined by target dna, obtain DNA sequence dna information by such mode.This first the protein system any nucleotide sequence all to programmable type binding ability is used for the vitro detection to nucleic acids in samples.Due to for two or more target position, method of the present invention has higher specificity.

Signal generation albumen after re-assemblying can be the enzyme that catalysis produces the chemical reaction of detectable signal, or is a reactant of signal cascade iodine.When signal generation albumen is the enzyme with katalysis, a large amount of substrate conversion can be product by the signal generation albumen of minute quantity, thus realizes the amplification of signal.Or, when signal generation albumen is a reactant of signal cascade iodine, the principle being similar to Enzyme-linked Immunosorbent Assay (ELISA) can be utilized, by the antigen-antibody reaction with scale effect, realize the secondary of signal or repeatedly amplify.Two kinds of modes all can increase substantially the sensitivity of detection.

Method of the present invention can be used for detecting for while the detection of target RNA or target dna or target RNA and target dna.When method of the present invention being used for separately to target RNA or detecting target RNA and target dna, only need to implement reverse transcription with the target RNA in specific primer pair sample, obtain reverse transcription product and obtain corresponding target dna further.Other steps are all to similar as the step detecting target using DNA.

Method simple and effective of the present invention.Due to without the need to using complicated alternating temperature equipment and treatment facility, method of the present invention is also favourable in portability, can effectively be used in as in the multiple object such as Control pollution, diagnosis, prevention and the detection on the spot implemented.

Especially, in a preferred embodiment, pre-treatment can be carried out to sample, and with the combine with technique such as existing isothermal duplication, improve sensitivity of the present invention further.

Accompanying drawing explanation

Fig. 1 is the schematic diagram of nucleic acid detection method of the present invention.When there is not target sequence in a DNA that () is to be detected, the first fusion rotein and the second fusion rotein stochastic distribution.There is target sequence (namely in b DNA that () is to be detected, target dna is there is in sample) when, under the guiding that sgRNA is right, the nuclease-deficient Cas9 structural domain of the first fusion rotein and the second fusion rotein is combined with target sequence respectively, N end fragment and C end fragment are spatially close to thus are reassembled as the signal generation albumen with function, participate in the reaction producing detectable signal, generate detectable signal.

Fig. 2 illustrates according to embodiments of the invention 1, takes the relative signal intensity that the PAM sequence of different directions and relative position and the building mode of fusion rotein obtain.Relative signal intensity illustrates with the ratio of the fluorescent value recorded with blank value.Blank value be obtained by the sample not containing any DNA to be detected fluorescent value (namely signal send out N end fragment protedogenous and C end fragment due to the spontaneous false positive signal re-assemblying generation at random).Error bar represents the standard deviation of three parallel laboratory tests.

Fig. 3 illustrates the relation of target sequence spacing and the relative signal intensity recorded according to embodiments of the invention 1.Relative signal intensity illustrates with the ratio of the fluorescent value recorded with blank value.Blank value be obtained by the sample not containing any DNA to be detected fluorescent value (namely signal send out N end fragment protedogenous and C end fragment due to the spontaneous false positive signal re-assemblying generation at random).Error bar represents the standard deviation of three parallel laboratory tests.

Fig. 4 illustrates the relation of target DNA concentration and the relative signal intensity recorded according to embodiments of the invention 1.The sensitivity of this relative signal intensity reflection detection system.Relative signal intensity illustrates with the ratio of the fluorescent value recorded with negative control value.Negative control value is by adding the fluorescent value (namely due to sgRNA and the false positive signal produced without the DNA non-specific binding to be detected of target sequence) obtained without the sample of the DNA to be detected of target sequence.Error bar represents the standard deviation of three parallel laboratory tests.

Fig. 5 illustrates according to embodiments of the invention 1, adopts the relative signal intensity that the DNA to be detected with different sequence signature obtains.The specificity of this strength of signal reflection detection system.Relative signal intensity illustrates with the ratio of the fluorescent value recorded with blank value.Blank value be obtained by the sample not containing any DNA to be detected fluorescent value (namely signal send out N end fragment protedogenous and C end fragment due to the spontaneous false positive signal re-assemblying generation at random).Error bar represents the standard deviation of three parallel laboratory tests.

Fig. 6 illustrates according to embodiments of the invention 2 and embodiment 3, to the result that subtilis (Bacillussubtilis) genome in sample detects.Described result illustrates with the ratio of the fluorescent value recorded with blank value.Blank value be obtained by the sample not containing any DNA to be detected fluorescent value (namely signal send out N end fragment protedogenous and C end fragment due to the spontaneous false positive signal re-assemblying generation at random).Black post represents the sgRNA detecting and adopt and mate with target dna.Grey post represents that detection adopts and the unmatched sgRNA of target dna (mismatchsgRNA).Error bar represents the standard deviation of three parallel laboratory tests.

Fig. 7 illustrates according to embodiments of the invention 3, have employed 3 couples of sgRNA couple for different target position respectively, the sensitivity detect the Bacillus subtilis genes group in sample and specificity.Described result illustrates with the ratio of the fluorescent value recorded with blank value.Blank value be obtained by the sample not containing any DNA to be detected fluorescent value (namely signal send out N end fragment protedogenous and C end fragment due to the spontaneous false positive signal re-assemblying generation at random).The negative template that increases is using pSB1C3 plasmid as amplification template.Error bar represents the standard deviation of three parallel laboratory tests.

Fig. 8 illustrates according to embodiments of the invention 3, to the specificity that the Bacillus subtilis genes group PCR primer in sample detects.Described result illustrates with the ratio of the fluorescent value recorded with blank value.Blank value be obtained by the sample not containing any DNA to be detected fluorescent value (namely signal send out N end fragment protedogenous and C end fragment due to the spontaneous false positive signal re-assemblying generation at random).The negative template that increases is using pSB1C3 plasmid as amplification template.Black post represents the sgRNA detecting and adopt and mate with target dna.Grey post represents that detection adopts and the unmatched sgRNA of target dna (mismatchsgRNA).Error bar represents the standard deviation of three parallel laboratory tests.

Fig. 9 illustrates according to embodiments of the invention 4, first implements isothermal duplication to sample, then implements method of the present invention and detect.The gel electrophoresis figure of the fragment of (a) isothermal duplication.The result obtained when () is using isothermal duplication as pre-treatment b.Described result illustrates with the ratio of the fluorescent value recorded with amplification negative control value.Amplification negative control value is the fluorescent value (should only have pSB1C3 plasmid template in negative amplified production, this control value is make signal send out N end fragment protedogenous due to the random interaction of dCas9 structural domain and negative template and C end fragment assembles the false positive signal of generation at random) utilizing the isothermal duplication product obtained using pSB1C3 plasmid as amplification template to obtain as sample.Error bar represents the standard deviation of three parallel laboratory tests.

Embodiment

Nucleic acid detection method

Method of the present invention is used for whether there is target nucleic acid in sample detecting.In the context of the present invention, term " DNA to be detected ", " RNA to be detected " refer to DNA or RNA be present in sample respectively, this DNA or RNA can be target dna or target RNA, also can be do not comprise detect for DNA or RNA of sequence (target sequence).Sample also may not comprise any nucleic acid.When method of the present invention is used for detecting RNA, in fact first RNA reverse transcription is obtained corresponding DNA, then this DNA is operated, therefore, within a context, term " target sequence " be detect for DNA sequence dna.When detected object is DNA, described target sequence is present in target dna.When detected object is RNA, the RNA sequence corresponding to described target sequence is present in target RNA.In like manner, term " target dna " refers to the DNA comprising target sequence.When using DNA as detection target, " target dna " is and expects whether investigate it is present in nucleic acid in sample; When using RNA as detection target, " target RNA " expects investigation whether it is present in nucleic acid in sample, and " target dna " refers to the DNA with target RNA with corresponding sequence, and this target dna has target sequence equally.

The sample that the present invention detects can be the sample of the liquid or solid state obtained from number of ways.In some embodiments, described sample can be environmental sample, such as but not limited to the sample coming from underground water, Zhong Shui, seawater, mining waste material.In some embodiments, described sample can be biological sample, such as, from the sample of plant or animal and converted products thereof.In some embodiments, described sample can be the sample obtained from experimenter, such as cheek swab, blood, serum, blood plasma, phlegm, cerebrospinal fluid, urine, tear, alveolar isolate, Pleural fluid, pericardial fluid, capsule liquid, tumor tissues, tissue, slicer, saliva, or the combination of above-mentioned substance.In some embodiments, described sample can be food, tap water or Feed Sample.

Target nucleic acid as detected object of the present invention can be the nucleic acid of natural existence or synthetic, can be and comes from animal, the genetic material of plant or microorganism or transcription product.Preferably, described nucleic acid for coming from microorganism, the particularly genetic material of industrial microorganism or pathogenic agent or transcription product.

In some embodiments, described target nucleic acid is the nucleic acid coming from following microorganism: Korea Spro Se Lebatong Salmonella (Bartonellahenselae), Borrelia burgdoyferi (Borreliaburgdorferi), campylobacter jejuni (Campylobacterjejuni), campylobacter fetus (Campylobacterfetus), chlamydia trachomatis (Chlamydiatrachomatis), Chlamydia pneumoniae (Chlamydiapneumoniae), chlamydia psittaci (Chylamydiapsittaci), intestinal bacteria (Escherichiacoli) (as O157:H7 and K88), Ehrlichia chaffeensis (Ehrlichiachafeensis), Clostridium botulinum (Clostridiumbotulinum), clostridium perfringens (Clostridiumperfringens), clostridium tetani (Clostridiumtetani), enterococcus faecalis (Enterococcusfaecalis), hemophilus influenzae (Haemophiliusinfluenzae), haemophilus ducreyi (Haemophiliusducreyi), posadasis spheriforme (Coccidioidesimmitis), Bordetella pertussis (Bordetellapertussis), Coxiella burnetii (Coxiellaburnetii), ureaplasma urealyticum (Ureaplasmaurealyticum), mycoplasma genitalium (Mycoplasmagenitalium), Trichomonas vaginalis (Trichomatisvaginalis), Hp (Helicobacterpylori), liver helicobacter (Helicobacterhepaticus), legionella pneumophilia (Legionellapneumophila), mycobacterium tuberculosis (Mycobacteriumtuberculosis), Mycobacterium bovis (Mycobacteriumbovis), mycobacterium africanum (Mycobacteriumafricanum), Mycobacterium leprae (Mycobacteriumleprae), Asia mycobacterium (Mycobacteriumasiaticum), mycobacterium avium (Mycobacteriumavium), hide mycobacterium (Mycobacteriumcelatum), Mycobacterium chelonei (Mycobacteriumcelonae), mycobacterium fortutitum (Mycobacteriumfortuitum), Geneva mycobacterium (Mycobacteriumgenavense), mycobacterium haemophilum (Mycobacteriumhaemophilum), Mycobacterium intracellulare (Mycobacteriumintracellulare), mycobacterium kansasii (Mycobacteriumkansasii), Ma Ermo mycobacterium (Mycobacteriummalmoense), ocean mycobacterium (Mycobacteriummarinum), Mycobacterium scrofulaceum (Mycobacteriumscrofulaceum), mycobacterium habana (Mycobacteriumsimiae), Chu Er lid mycobacterium (Mycobacteriumszulgai), mycobacterium buruli (Mycobacteriumulcerans), mycobacterium littorale (Mycobacteriumxenopi), diphtheria corynebacterium (Corynebacteriumdiptheriae), Rhodococcus equi (Rhodococcusequi), Erichsen rickettsia (Rickettsiaaeschlimannii), Africa rickettsia (Rickettsiaafricae), dermacetor conori (Rickettsiaconorii), arcanobacterium haemolyticum (Arcanobacteriumhaemolyticum), anthrax bacillus (Bacillusanthracis), bacillus cereus (Bacilluscereus), Listeria Monocytogenes (Lysteriamonocytogenes), Yersinia pestis (Yersiniapestis), yersinia entero-colitica (Yersiniaenterocolitica), shigella dysenteriae (Shigelladysenteriae), Neisseria meningitidis (Neisseriameningitides), gonococcus (Neisseriagonorrhoeae), streptococcus bovis (Streptococcusbovis), Hemolytic streptococcus (Streptococcushemolyticus), streptococcus mutans (Streptococcusmutans), streptococcus pyogenes (Streptococcuspyogenes), streptococcus pneumoniae (Streptococcuspneumoniae), streptococcus aureus (Staphylococcusaureus), staphylococcus epidermidis (Staphylococcusepidermidis), Staphylococcus pneumoniae (Staphylococcuspneumoniae), Staphylococcus saprophyticus (Staphylococcussaprophyticus), vibrio cholerae (Vibriocholerae), Vibrio parahaemolyticus (Vibrioparahaemolyticus), salmonella typhi (Salmonellatyphi), salmonella paratyphi (Salmonellaparatyphi), Salmonella enteritidis (Salmonellaenteritidis), subtilis, Tyreponema pallidum (Treponemapallidum), ERC group virus (Humanrhinovirus), human corona virus (Humancoronavirus), dengue virus (Denguevirus), inovirus (Filoviruses) (such as Marburg (Marburg) and Ebola (Ebola) virus), Hantaan virus (Hantavirus), rift valley virus (RiftValleyvirus), hepatitis B virus, hepatitis C virus, hepatitis E virus, human immunodeficiency virus is (as HIV-1, HIV-2), HHV-8, human papillomavirus, simplexvirus (as HV-I and HV-II), human T-cell lymphotropic virus (as HTLV-I and HTLV-II), bovine leukemia virus, influenza virus, inner many viruses (Guanaritovirus) received by melon, lassa virus (Lassavirus), Measles virus, rubella virus, mumps virus, varicella (varicella virus (Varicellavirus)), monkeypox, EpsteinBahr virus, Cécile Nowak (Norwalk) (with class Cécile Nowak) virus, rotavirus, assays for parvovirus B 19, Hantaan virus (Hantaanvirus), sin nombre virus (SinNombrevirus), Venezuelan equine encephalitis virus, Sabia's virus (Sabiavirus), west Nile virus, yellow fever virus, the pathogenic thing of Transmissible spongiform encephalopathy, Creutzfeldt-Jakob pathogenic agent, anomaly Creutzfeldt-Jakob pathogenic agent, candidiasis, cryptococcus (Cryptcooccus), Cryptosporidium (Cryptosporidium), Giardia lamblia (Giardialamblia), microsporozoite (Microsporidia), Plasmodium vivax (Plasmodiumvivax), Pneumocystis carinii (Pneumocystiscarinii), toxoplasma gondii (Toxoplasmagondii), alpha fungus (Trichophytonmentagrophytes), Bi Shi intestines microsporidium (Enterocytozoonbieneusi), Cyclospora (Cyclosporacayetanensis), Helen's encephalitis microsporidium (Encephalitozoonhellem), Encephalitozoon cuniculi (Encephalitozooncuniculi).

The inventive method for target sequence be the characteristic sequence of described target nucleic acid.Such as, detecting in the purposes in genetically modified food in method of the present invention, target sequence is the exogenous array (that is, transgenic fragment sequence) be not present in natural biological.In method of the present invention in the purposes detecting hereditary feature and personalized medicine, target sequence can be the characteristic sequence of the molecule the most often changed in cancer, such as the mutantional hotspot region that lung cancer is p53, for the mutantional hotspot region that mammary cancer is BRCA1 and BRCA2.In method of the present invention in the purposes detecting microbial contamination or infection, target sequence can be the generic character sequence of microorganism to be detected, such as 16srRNA sequence.

In some embodiments, described sample can be without pretreated sample.In other embodiments, can by centrifugal, filter, ultrasonic, homogenization, heating, freezing, thaw, the combination of mechanical treatment or multiple working method, and/or add pretreated reagent, the nucleic acid in sample extracted and enrichment.Conventional pretreating reagent comprises tensio-active agent and washing composition, salt, lysis agent, anti-coagulant, degrading enzyme (such as proteolytic enzyme, lipase, nuclease, lipase, collagenase, cellulase, amylase etc.) and solution (such as damping fluid).Those skilled in the art know the pretreatment process of common sample.Such as, for food samples, after homogenization, alkaline lysis method of extracting DNA can be utilized.For blood sample, preventing blood coagulation by adding heparin, subsequently by Ag-Ab effect enrichment pathogenic bacteria, and carrying out the solid phase extractions of DNA of bacteria.For tissue sample, then need to carry out cracking to cell.The dedicated kit that QiagenInc., SigmaLifeSciences, InvitrogenCorporation and PromegaCorporation can be used to sell implements pre-treatment step.Especially, the test kit for isolation of genomic DNA from various sample type is commercially available (such as, catalog number (Cat.No.) 51104,51304,56504 and 56404; Qiagen; Germantown, MD).TRIzol extracting method or commercial kits (such as using RNeasyMicro test kit, QIAGEN) can be utilized to extract total serum IgE.

During using RNA as detected object, need first to carry out reverse transcription, and obtain the target dna of double-strand, then implement the subsequent step of the inventive method.Reverse transcription is carried out to the RNA in sample and the method obtaining corresponding DNA is known in the art.Such as, use iIIOne-StepRT-PCR test kit (Invitrogen) implements reverse transcription.Or, the isothermal amplification method (such as TMA, NASBA etc.) based on rna transcription can be utilized, obtain corresponding target dna from target RNA.

If target DNA concentration is lower in sample, can increase to target dna.PCR method can be utilized to increase, however due to PCR need use thermal cycler, therefore do not recommend.Preferred use isothermal amplification technique increases to target dna.Spendable isothermal amplification method includes but not limited to ligase chain reaction (LCR) (Wu and Wallace1989, Genomics4,560; Landegren etc., 1988, Science241,1077); Self-sustained sequence copies (SSR) (Guatelli etc., 1990, PNASUSA, 87,1874); Strand displacement amplification (SDA) (G.T.Walker etc., 1996, Clin.Chem.42:9-13 and European Patent Application No. 684315); Nickase amplified reaction (NEAR); Rolling circle amplification (RCA); Ring mediated isothermal amplification (LAMP); Cross primer constant-temperature amplification (CrossPrimingAmplification:MechanismandOptimizationforIso thermalDNAAmplification, GaoliangXu etc., SciRep.2012,2:246.); Q-β amplification system (EP4544610); OneCutEventAmplificatioN (OCEAN; ClinicalChemistry52,1855-1863 (2006)).About the comparison of multiple amplification method for example, see Point-of-careNucleicAcidTestingforInfectiousDiseases, AngelikaNiemz etc., TrendsinBiotechnology, 2011,29 (5): 240-250.It is pointed out that, before implementing present method, amplification is carried out for the object for the sensitivity of further raising method to target dna in sample, and be not the necessary step of present method.

As previously mentioned, detection method of the present invention mainly utilizes CRISPR/Cas9 system can identify the character of any DNA sequence.Those skilled in the art's instruction according to the present invention can be it is contemplated that, also other the albumen any nucleotide sequence all to programmable type binding ability can be utilized, the zinc finger protein (ZFN) of such as nuclease-deficient or transcriptional activation sample effector nuclease (TALEN), substitute nuclease-deficient Cas9 of the present invention.The recombinant protein of the albumen that have split-type signal to send out protedogenous by building this type of fusion, can optionally be combined with any DNA sequence, is converted into detectable signal by sequence information.

In the present invention, one or more pairs of target sequences according to target dna design and synthesize sgRNA couple, the nuclease-deficient Cas9 structural domain of the first fusion rotein and the second fusion rotein is guided to be bonded to described target sequence pair respectively, make the split-type signal generation albumen n end fragment of the first fusion rotein and the split-type signal generation PROTEIN C end fragment spatially vicinity of the second fusion rotein, thus described N end fragment and C end fragment spontaneously re-assembly the complete signal generation albumen for having function.This signal generation albumen participates in the chemical reaction with the generation detectable signal of signal scale effect, and sequence signal can be detected.

The acronym of the short palindrome tumor-necrosis factor glycoproteins (clusteredregularlyinterspacedshortpalindromicrepeats) of regular intervals of CRISPR and cluster, its " immunity system " as bacterium and archeobacteria is extensively present in bacterium and archeobacteria genome.The immune interference process of CRISPR system mainly comprises three phases: adapt to, express and interference.In the laundering period, the DNA short-movie section from phage or plasmid can be incorporated between leader sequence and first paragraph tumor-necrosis factor glycoproteins by CRISPR system, integrates copying all along with tumor-necrosis factor glycoproteins each time, and then repetition-intervening sequence unit that formation one is new.The foreign DNA of invasion before this intervening sequence (spacer) have recorded.At expression phase, CRISPR locus can be transcribed into one section of CRISPRRNA (crRNA) precursor (being called pre-crRNA), and this precursor is sheared by the endonuclease enzyme domains of Cas9 and is processed into little crRNA further.Ripe crRNA and Cas albumen forms Cas9-tracrRNA:crRNA complex body.In the interference stage, crRNA finds target spot by the regional guidance Cas9-tracrRNA:crRNA complex body of itself and target complement sequence, and cause the double-strand DNA cleavage of target position at target position by the nuclease of Cas albumen, thus the target DNA of invasion is made to lose original function.The identification of Cas albumen and target spot 3' hold 3 bases be close to, 5'-NGG-3'(and PAM sequence, protospaceradjacentmotif).PAM sequence can be present in arbitrary chain of double-stranded DNA.

From the CRISPR/Cas system that the CRISPR/Cas9 system of streptococcus pyogenes (Streptococcuspyogenes) is the most frequently used in molecular biology and cytobiology.Play a significant role in the maturation of Cas9 albumen at crRNA and the shearing to target DNA.Within the system, trans coding tiny RNA (trans-encodedsmallRNA, tracrRNA) plays the role of guiding.TracrRNA and spacerRNA is combined as sgRNA molecule by Jinek etc., it mixed with Cas9, discovery correctly can cut (PennisiE, TheCRISPRcraze to target dna, Science341 (6148): 833-836,2013; AProgrammableDual-RNA-GuidedDNAEndonucleaseinAdaptiveBac terialImmunity, Jinek etc., 337 (6096): 816-821).

Natural Cas9 albumen has nuclease, can cutting double-stranded DNA.Nuclease-deficient Cas9 is the Cas9 albumen that nuclease structural domain critical sites is undergone mutation, and does not have nuclease and only retain to form mixture and the ability be combined with target DNA with sgRNA.This area has been found that multiple nucleic acids deficient Cas9, and it is identical with corresponding wild-type Cas9 with the interaction sites of sgRNA.

In one embodiment, described nuclease-deficient Cas9 is the nuclease-deficient Cas9 of streptococcus pyogenes, such as dCas9.DCas9 is the Cas9 albumen that RuvC1 and HNH nuclease structural domain is undergone mutation, and has the sequence shown by SEQ.ID.NO:1.Compared with wild-type Cas9, the aspartic acid that dCas9 is the 10th is replaced by L-Ala and the Histidine of the 840th is replaced by L-Ala (D10A, H840A) (RepurposingCRISPRasanRNA-GuidedPlatformforSequence-Speci ficControlofGeneExpression, LeiQi etc., Cell, 2013,152 (5): 1173-1183).DCas9 does not have a nuclease and still can form mixture with sgRNA and the character be combined with its DNA target makes it favourablely can be used to capture the target sequence of target dna.The nuclease-deficient Cas9 of described streptococcus pyogenes also can be Cas9 (SEQ.ID.NO:2) (the OrthogonalCas9proteinsforRNA-guidedgeneregulationandedit ing with D10A, D839A, H840A and N863A sudden change, KevinMEsvelt etc., Naturemethods, doi:10.1038/nmeth.2681).In other embodiments, described nuclease-deficient Cas9 also can be nuclease-deficient mutant (the SEQ.ID.NO:3) (UniProtKB/Swiss-ProtQ03LF7.1 of the less Cas9 of thermophilus streptococcus (Streptococcusthermophilus), and there is D9A, D598A, H599A and N622A suddenlys change), nuclease-deficient Cas9 mutant (the SEQ.ID.NO:4) (UniProtKB/Swiss-ProtC9X1G5.1 of Neisseria meningitidis, and there is D16A, D587A, H588A and N611A suddenlys change), and nuclease-deficient Cas9 mutant (the SEQ.ID.NO:5) (NCBIReferenceSequenceWP_002684945.1 of treponema denticola (Treponemadenticola), and there is D13A, D878A, H879A and N902A suddenlys change).The sequence of above-mentioned nuclease-deficient Cas9 and feature, at OrthogonalCas9proteinsforRNA-guidedgeneregulationandedit ing, describe in KevinMEsvelt etc., Naturemethods, doi:10.1038/nmeth.2681.

With regard to CRISPR/Cas9 system, it is well known in the art that can for the corresponding sgRNA of any DNA fragment design and synthesis with arbitrary sequence.Cas9 albumen can carry out enzyme to this site and cut under the guiding of this sgRNA.The method designing and synthesizing the sgRNA being applicable to Cas9 known in the art can being used for the step (2) or (2') of the inventive method, designing and synthesizing the sgRNA for guiding nuclease-deficient Cas9.It is to be noted, although need the downstream of sgRNA recognition sequence to there is PAM sequence, but for double-stranded DNA, statistically every 8 bases just can occur that a 5'-NGG-3'(is positioned at positive-sense strand or antisense strand), therefore can not cause actual influence to the practicality of detection method.

The method obtaining sgRNA for particular sequence design sgRNA and in-vitro transcription is known in this area.Online CRISPR design tool can be utilized to design sgRNA sequence, and described design tool is http://www.biootools.com/en/ or http://crispr.mit.edu/ etc. such as, the sgDNA sequence corresponding to synthetic.Subsequently sgDNA is connected into sgRNA cloning vector, or obtains sgRNA transcription templates by overlap-extension PCR, and utilize t7 rna polymerase and sgRNA cloning vector to implement in-vitro transcription to obtain object sgRNA fragment.Also the test kit be purchased can be used to implement the synthesis of sgRNA, such as use T7QuickHigh-YieldRNAsynthesisKit (NEB), sgRNA in-vitro transcription and screening reagent box (Clontech, Cat.No.631439), T7sgRNAMICscript ^tMkIT/sgRNAsynthesisproduct (BiomicsBiotech) or EpicenterASF3257 in-vitro transcription test kit.

The direction of sgRNA recognition sequence is without any restriction.Each sgRNA is to the same chain of identifiable design dsDNA or identify two chains respectively.Therefore, the PAM sequence of sgRNA can be positioned at arbitrary end of target sequence.With regard to a pair sgRNA, each PAM sequence can be positioned at the same side or the opposition side of described target sequence.

Method of the present invention can utilize a pair sgRNA, identify in target dna two independently target sequences, the first fusion rotein containing nuclease-deficient Cas9 structural domain and the second fusion rotein and sgRNA is made to form mixture to target dna, thus cause split-type signal to send out N end fragment and C end fragment spatially vicinity protedogenous, the spontaneous signal generation albumen being assembled into function.Preferably, for enough spaces can be had to form each nuclease-deficient Cas9 structural domain-sgRNA-target dna mixture, the target sequence in the target dna that a sgRNA of sgRNA centering and the 2nd sgRNA identifies between can have a certain distance (interval)." spacing " used in the present invention refers to when not considering sgRNA recognition sequence direction, and the shortest distance of a pair target sequence each other between immediate end, represents with bp.Such as, when each sgRNA of sgRNA centering identifies the same chain of target dna, and when on target dna, each target sequence is end to end, or, when each sgRNA of sgRNA centering identifies the different chains of target dna, and the reverse complementary sequence of a target sequence is when connecting on target dna with another target sequence head and the tail, the spacing between recognition sequence (target sequence) is 0bp.When the recognition site of sgRNA has overlap, spacing is less than 0bp, and the now combination of the first fusion rotein and the second fusion rotein and DNA may be competed.When spacing is greater than 0bp, on two nuclease-deficient Cas9 structural domains and target dna, target sequence is less to the space resistance combined.When spacing is greater than 100bp, the space length of the first fusion rotein and the second fusion rotein is comparatively far away, and signal is more weak.Preferred spacing is 5bp-100bp, more preferably 17-34bp.When at least one PAM sequence position on target dna is between two target sequences that target sequence is right, described spacing does not comprise PAM sequence.

The length of sgRNA recognition sequence is generally 19-21bp, is to improve specificity, can adopt multipair sgRNA, identifies the sequence of multipair target position of target dna, such as, identify 2 positions, 4 positions, 6 positions, 8 positions etc.On target dna each target position between spacing have no particular limits.It is pointed out that when for more than 2 target position, does not need the guiding of sgRNA to provide the fusion rotein containing nuclease-deficient Cas9 structural domain in addition because nuclease-deficient Cas9 depends on completely to the identification of DNA.

Split-type signal of the present invention sends out N end fragment protedogenous and C end fragment can be respectively N end fragment and the C end fragment of split-type protein system.Split-type albumen (splitprotein) system is also called protein fragments complementation (proteinfragmentcomplementation, PCA) system, is used for research protein-protein interaction, location and modification.Such as, in the PCA system detected for protein-interacting, interested albumen (that is, " bait " and " prey ") is covalently bound with the imperfect fragment as the 3rd albumen reporting son respectively.Interact if existed between " bait " albumen and " prey " albumen, report that two fragments of sub-albumen will enough close each other, thus form that its activity can be measured have the report of function sub.Detect " bait " and " prey " by such method and whether there is interaction.

Split-type signal is sent out protedogenous and is characterised in that, any activity is not shown during each fragment Individual existence after fractionation, and when there is another fragment interactional with it, each fragment is assembled into tool activated split-type signal generation albumen entirety by spontaneous, and the split-type signal generation albumen after re-assemblying can provide the measurement signal being easy to read.Although have multiple fractionation mode to a certain albumen, but need to ensure that the albumen after re-assemblying has function.Split-type protein system such as rnase known at present, luciferase (Fluc or sea pansy (Renilla) luciferase), beta-galactosidase enzymes (lacZ), β-lactamase, ubiquitin, fluorescin is GFP and EGFP such as, Tetrahydrofolate dehydrogenase, split-type Tobacco mosaic virus enzyme (TEV protease), chorismic acid dismutase, thymidine kinase, yeast Gal4 albumen (i.e. yeast two-hybrid system), focal adhesion kinases etc. are (for example, see Split-proteinsystems:beyondbinaryprotein-proteininteract ions, SujanSShekhawat and IndraneelGhosh, CurrentOpinioninChemicalBiology2011, 15:789-797, Proteinfragmentcomplementationstrategiesforbiochemicalne tworkmapping, StephenWMichnick, CurrentOpinioninBiotechnology2003,14:610-617).Be preferred for split-type signal generation albumen of the present invention and comprise fluorescin (fluorescin of such as GFP, EGFP, RFP or other structural similitude), beta-galactosidase enzymes, β-lactamase, luciferase (Fluc and Renilla luciferase) and Tetrahydrofolate dehydrogenase.The best of above-mentioned albumen known in the art splits mode, the mode of action and detection method.

In some embodiments, split-type signal generation albumen is Fluc (SEQ.ID.NO:6).The fractionation mode of Fluc such as can be: N end fragment has 2-398 amino acids residue, and C end fragment has 394-550 amino acids residue; Or N end fragment has 2-416 amino acids residue, and C end fragment has 398-550 amino acids residue.It is pointed out that in all cases, first amino acid is methionine(Met) corresponding to initiator codon, does not generally have a function.Therefore, complete sequence can comprise or not comprise the 1st amino acids.Fluc N end fragment after fractionation and C end fragment can re-assembly time close to each other becomes complete Fluc, at O ₂, ATP, Mg ²⁺existence under catalysis D-luciferin luminescence (550-570nm).(Kineticsofregulatedprotein-proteininteractionsrevealedwithfireflyluciferasecomplementationimagingincellsandlivinganimals)。In some embodiments, split-type signal generation albumen is Renilla luciferase (SEQ.ID.NO:7).The fractionation mode of Renilla luciferase such as can be: N end fragment has 1-229 amino acids residue, and C end fragment has 230-311 amino acids residue.Renilla luciferase N end fragment after fractionation and C end fragment can re-assembly time close to each other becomes complete Renilla luciferase, at O ₂existence under luminous (480nm) (the TECHNICALADVANCE:Splitluciferasecomplementationassaytost udyprotein-proteininteractionsinArabidopsisprotoplasts of catalysis coelenterazine (coelenterazine), YukichiFujikawa and NaohiroKato, ThePlantJournal (2007) 52,185-195; MonitoringProtein-ProteinInteractionsUsingSplitSynthetic RenillaLuciferaseProtein-Fragment-AssistedComplementatio n, R.Paulmurugan etc. (2003), Anal.Chem.75 (7), 1584-1589).Liquid scintillation instrument, bioluminescence assay instrument, CCD etc. can be used to analyze above-mentioned luminous signal.In some embodiments, split-type signal generation albumen is beta-galactosidase enzymes.The N end fragment of beta-galactosidase enzymes and C end fragment are called LacZ α and LacZ ω.This area is conventional lacZ (the GeneexpressionandcellfusionanalyzedbylacZcomplementation inmammaliancells recombinated by Δ ω (SEQ.ID.NO:8) and Δ α (SEQ.ID.NO:9) also, PNAS, 1996; Monitoringprotein-proteininteractionsinintacteukaryoticc ellsby β-galactosidasecomplementation, PNAS, 1997).Depend on added substrate, beta-galactosidase enzymes both catalysis can produce the reaction of optical signal, also catalysis can produce the reaction of electrical signal.The bromo-4-of beta-galactosidase enzymes catalysis 5-chloro-3-indyl-β-D-galactopyranoside (X-Gal) hydrolysis generates semi-lactosi and acetic acid-5-bromo-4-chloro-3-hydroxyl indoles, the latter understands spontaneous dimerization and is oxidized to blue product 5, bromo-4, the 4'-dichloro-indigo of 5'-bis-.Beta-galactosidase enzymes also catalysis ortho-nitrophenyl-β-D-galactopyranoside (ONPG) hydrolysis generates semi-lactosi and yellow product o-NP.The change of absorbancy can be detected to detect the activity of beta-galactosidase enzymes.Simultaneously, beta-galactosidase enzymes can generate electroactive product p-aminophenol by catalysis p-amino phenyl-β-D-galactopyranoside, electrochemical workstation can be utilized to detect oxidizing reaction (the On-chipelectrochemicalmeasurementofb-galactosidaseexpres sionusingamicrobialchip of p-aminophenol, Chem.Commun., 2004,248-249).In some embodiments, split-type signal generation albumen is the β-lactamase (SEQ.ID.NO:10) of no signal peptide.The 2-25 amino acids of β-lactamase is signal peptide.The fractionation mode of β-lactamase such as can be: N end fragment can be 1-171 amino acids residue, and C end fragment is 172-264 amino acids residue.For increasing stability, sudden change (the Beta-lactamaseproteinfragmentcomplementationassaysasinvi voandinvitrosensorsofproteinproteininteractions of M157T also can be carried out to sequence, NatBiotechnol., 2002,20 (6): 619-22).Beta-lactam enzyme catalysis penicillin is hydrolyzed to penicillinoicacid and causes pH to change, the change of this pH measures (Penicillinase-basedamperometricbiosensorforpenicillinG, dx.doi.org/10.1016/j.elecom.2013.11.022) by electrochemical method.In some embodiments, split-type signal generation albumen is Tetrahydrofolate dehydrogenase (SEQ.ID.NO:11).The fractionation mode of Tetrahydrofolate dehydrogenase such as can be: N end fragment is 1-86 amino acids residue, and C end fragment is 87-159 amino acids residue (C.V.Gegg, K.E.Bowers, andC.R.Matthews, ProteinSci.6,1885 (1997)).Tetrahydrofolate dehydrogenase catalysis dihydrofolate reduction is the reaction of tetrahydrofolic acid (THFA), and in this reaction, NADPH is electron donor.The amount of multiple method known in the art to NADPH can be utilized to detect, such as SIGMA-ALDRICHDihydrofolateReductaseAssayKit (CS0340-1KT) (Constructionandevaluationofthekineticschemeassociatedwit hdihydrofolatereductasefromEscherichiacoli).In some embodiments, split-type signal generation albumen is fluorescin, such as GFP (SEQ.ID.NO:12) and various variant, RFP etc.EGFP is the GFP with F64L and S65T sudden change.When split-type signal generation albumen is GFP or EGFP, fractionation mode such as can be: N end fragment is 1-157 amino acids residue, and C end fragment is 158-238 amino acids residue (IndraneelGhosh, AndrewD.Hamilton, AntiparallelLeucineZipper-DirectedProteinReassembly:Appl icationtotheGreenFluorescentProtein).When complete GFP is excited near 488nm, will near 509nm emitting fluorescence (Split-superpositiveGFPreassemblyisafast, efficient, androbustmethodfordetectingprotein-proteininteractionsin vivo, Mol.BioSyst., 2012,8,2036-2040; Split-EGFPScreensfortheDetectionandLocalisationofProtein – ProteinInteractionsinLivingYeastCells, EmmaBarnardandDavidJ.Timson, AmirSharon (ed.), MolecularandCellBiologyMethodsforFungi, MethodsinMolecularBiology, vol.638).Do not need add other reactant or catalyzer and directly excite fluorescin, and detect generation light.Those skilled in the art know can utilize microplate reader, laser apparatus and the above-mentioned detection of the enforcement such as photomultiplier, microscopic system.It is pointed out that above-mentioned signal sends out other fractionation modes protedogenous also within the scope of the invention.

Split-type signal of the present invention sends out N end fragment protedogenous and C end fragment also can be and has interactional two albumen of specificity.This protein-interacting can be detected by follow-up signal iodine.Such as, split-type signal sends out N end fragment protedogenous and C end fragment can be respectively fluorogenic donor albumen in FRET (fluorescence resonance energy transfer) technology and fluorescent receptor albumen.FRET (fluorescence resonance energy transfer) refers to the energy transfer mechanism between two fluorescence molecules.Fluorogenic donor is excited under its excitation wavelength.This excited state is transferred to the second molecule (fluorescent receptor) non-radiatively subsequently.Or split-type signal sends out N end fragment protedogenous and C end fragment can be respectively antigen protein and antibody protein, thus can, in the mode of similar ELISA, utilize second antibody to amplify signal.Split-type signal sends out N end fragment protedogenous and C end fragment also can be acceptor and part (agonist or antagonist) thereof.

Depend on adopted split-type signal generation albumen, split-type signal sends out each fragment protedogenous and can directly be conjugated to N-terminal or the C-terminal of nuclease-deficient Cas9, as long as ensure that N end fragment and C end fragment still have activity after re-assemblying.Or split-type signal is sent out a fragment protedogenous by available connection peptides (linkerpeptide) and nuclease-deficient Cas9 puts together.Connection peptides does not comprise any active structure domain, is preferably made up of glycine and/or Serine, is preferably 6-12 amino acid whose peptide.In one embodiment, the sequence of connection peptides is GGGGSGGGGS (SEQ.ID.NO:13).

When not affecting activity, by fusion rotein N end or C end add label so that expression and purification.Described label includes but not limited to histidine-tagged, c-myc label, Halo label, Flag label etc.

As mentioned above, the reaction and the detection method thereof that produce detectable signal depend on adopted signal generation albumen.Other parts when herein have listed split-type signal generation albumen and reaction mechanism thereof and detection method, the substrate and/or enzyme that add required for for each split-type signal generation albumen can have been known in this area.Can adjust the concentration of each reactant and reaction conditions, obtain stronger signal to improve sensitivity.

The inventive method step (3) and (4') in, the selection of incubation conditions makes nuclease-deficient Cas9 albumen can be directed to target dna by sgRNA.Such as, 20min to 2h can be hatched at 37 DEG C.

Consider the efficiency re-assemblied, preferably the first fusion rotein and the second fusion rotein are isoconcentration mixing, and each sgRNA mixes isoconcentration.When two sites for target dna, the fusion rotein total concn provided, sgRNA to the preferred 5-30:80-150:1 of the mol ratio of target dna, more preferably 10:100:1.The possibility of non-specific binding during too high fusion rotein concentration is adopted to raise.Consider for site increase after diluting effect, in order to obtain stronger signal, suitably can improve the concentration of fusion rotein.

Preferably, first a sgRNA of each sgRNA centering and the first fusion rotein can be hatched jointly, and another sgRNA and the second fusion rotein are hatched jointly, again the two mixed subsequently and add the target dna that (3') sample or step obtain, improving detection signal further.

Although it is pointed out that and give in the context of the present invention respectively to the method that target dna and target RNA detect.In actual applications, can integrate above-mentioned two kinds of methods, multiple target dna and target RNA be detected simultaneously.Such as, by following step, target dna and target RNA are detected:

(1 ") the first fusion rotein and the second fusion rotein are provided; and wherein; described first fusion rotein is the fusion rotein of split-type signal generation albumen n end fragment and nuclease-deficient Cas9 albumen; described second fusion rotein is the fusion rotein of split-type signal generation PROTEIN C end fragment and nuclease-deficient Cas9 albumen, the described signal generation albumen be made up of described N end fragment and described C end fragment can participate in the chemical reaction producing detectable signal;

(2 ") for the multipair target sequence in the DNA sequence dna corresponding with described target RNA reverse transcription product and target dna, design and synthesize sgRNA couple;

(3 ") for the target RNA in described sample, implement the target dna of reverse transcription also corresponding to acquisition.

Each sgRNA that described first fusion rotein that the target dna that sample, step (3 ") obtain by (4 "), step (1 ") provide and described second fusion rotein, step (2 ") obtain to and participate in other reactant of the chemical reaction producing detectable signal and/or catalyzer is hatched jointly, generate detectable signal; And

(5 ") described detectable signal is measured.

The method can be advantageously used in the detection simultaneously to the microbial pathogen (such as RNA viruses and DNA virus) of number of different types.Those skilled in the art know above-described technology contents and also can properly use in the method.

To the test kit that target nucleic acid detects

Present invention also offers the test kit for implementing the inventive method.Described test kit comprises the first fusion rotein and the second fusion rotein, wherein, described first fusion rotein is the fusion rotein of split-type signal generation albumen n end fragment and nuclease-deficient Cas9 albumen, described second fusion rotein is the fusion rotein of split-type signal generation PROTEIN C end fragment and nuclease-deficient Cas9 albumen, and the described signal generation albumen be made up of described N end fragment and described C end fragment can participate in the chemical reaction producing detectable signal.Described test kit also optionally comprises the reactant and/or catalyzer that participate in the chemical reaction producing detectable signal.

Other reactant react preferred split-type signal generation albumen and participation detectable signal and/or the description of catalyzer are see other parts herein.

To the equipment that target nucleic acid detects

Present invention also offers the equipment for implementing the inventive method.Described equipment comprises raising module and detection module, described raising module be used for step of the present invention (3), (4') and the reaction mixture of (4 ") hatch, described detection module is for implementing step of the present invention (4), (5') and (5 ").

Described raising module can comprise temperature-control device, timing device and/or adjustable inlet system or leak-tight system.Such as, utilizing luciferase may need to provide oxygen in addition as during signal generation albumen.

Described detection module can be used for sensed light signal and/or electrical signal.Such as, when for sensed light signal, detection module can comprise CCD camera, Kamera, imaging film (photographicfilm), laser scanning device, photofluorometer, photorectifier, quantum counter, epifluorescence microscope (epifluorescencemicroscopes), flying-spot microscope, flow cytometer, fluorescence microplate reader (fluorescencemicroplatereaders) or use photomultiplier to carry out signal amplification.When for detecting electrical signal, detection module can comprise electrochemical analysis system, such as, comprise and have fluid inlet and liquid outlet, and is provided with the electrolysis liquid pool to electrode and reference electrode.

The embodiment of each side described herein can be illustrated by the paragraph of numbering as follows:

1., to the method that whether there is target nucleic acid in sample and detect, described target nucleic acid is target dna, and described method comprises following steps:

(4) described detectable signal is measured.

2., to the method that whether there is target nucleic acid in sample and detect, described target nucleic acid is target RNA, and described method comprises following steps:

(5') described detectable signal is measured.

3. the method as described in paragraph 1 or 2, wherein, described sample is environmental sample, such as, be the sample of underground water, Zhong Shui, seawater, mining waste material.

4. the method as described in paragraph 1 or 2, wherein, described sample is biological sample, particularly from the sample of experimenter, such as, for being selected from following sample one or more: cheek swab, blood, serum, blood plasma, phlegm, cerebrospinal fluid, urine, tear, alveolar isolate, Pleural fluid, pericardial fluid, capsule liquid, tumor tissues, tissue, slicer, saliva.

5. the method as described in paragraph 1 or 2, wherein, described sample comes from food, tap water or feed.

6. the method according to any one of paragraph 1-5, wherein, described target nucleic acid is the nucleic acid of natural existence or synthetic, such as come from animal, the genetic material of plant or microorganism or transcription product, preferably, described nucleic acid for coming from microorganism, the particularly genetic material of industrial microorganism or pathogenic agent or transcription product.

7. the method according to any one of paragraph 1-6, wherein, described target sequence is the characteristic sequence of described target nucleic acid, such as, be transgenic fragment sequence, the characteristic sequence of molecule the most often changed in disease or generic character sequence.

8. the method as described in paragraph 7, wherein, described target sequence is the generic character sequence of tubercule bacillus.

9. the method according to any one of paragraph 1-8, wherein, described sample is through pretreated sample or not pretreated sample.

10. the method as described in paragraph 9, wherein, uses and is selected from following method and carries out pre-treatment to described sample: centrifugal, filter, ultrasonic, homogenization, heating, freezing, thaw, mechanical treatment and/or PCR.

11. methods as described in paragraph 9, wherein, implement described pre-treatment by the isothermal amplification method be selected from group formed by the following method:

Ligase chain reaction, self-sustained sequence copy, strand displacement amplification, nickase amplified reaction, rolling circle amplification, ring mediated isothermal amplification, cross primer constant-temperature amplification, Q-β amplification system and OneCutEventAmplificatioN.

12. methods according to any one of paragraph 1-11, wherein, described nuclease-deficient Cas9 is the nuclease-deficient Cas9 of streptococcus pyogenes, thermophilus streptococcus, Neisseria meningitidis or treponema denticola, preferably there is the nuclease-deficient Cas9 of the aminoacid sequence of SEQ.ID.NO:1-SEQ.ID.NO:5, preferred dCas9.

13. methods according to any one of paragraph 1-12, wherein, utilize connection peptides to connect described nuclease-deficient Cas9 structural domain and described split-type signal and send out N end fragment or C end fragment protedogenous, described connection peptides is preferably made up of glycine and/or Serine, there is 6-12 amino-acid residue, such as, there is the aminoacid sequence of SEQ.ID.NO:13.

14. methods according to any one of paragraph 1-13, wherein, described fusion rotein also can comprise the label facilitating its expression and purification, the label be such as made up of 6 Histidines.

15. methods according to any one of paragraph 1-14, wherein, described split-type signal generation albumen is selected from any one in the group be made up of following albumen:

Rnase, luciferase, beta-galactosidase enzymes, β-lactamase, ubiquitin, fluorescin, Tetrahydrofolate dehydrogenase, TEV protease, chorismic acid dismutase, thymidine kinase, yeast Gal4 albumen and focal adhesion kinase.

16. methods as described in paragraph 15, wherein, described split-type signal generation albumen is Fluc, and other reactant that described participation produces the chemical reaction of detectable signal comprises ATP, D-luciferin and Mg ²⁺, described detectable signal is luminous signal.

17. methods as described in paragraph 16, wherein, described Fluc has the aminoacid sequence of SEQ.ID.NO:6, and preferably, described N end fragment has 2-398 amino acids residue, and described C end fragment has 394-550 amino acids residue; Or described N end fragment has 2-416 amino acids residue, and described C end fragment is 398-550 amino acids residue.

18. methods as described in paragraph 15, wherein, described split-type signal generation albumen is Renilla luciferase, and other reactant that described participation produces the chemical reaction of detectable signal comprises coelenterazine, and described detectable signal is luminous signal.

19. methods as described in paragraph 18, wherein, described Renilla luciferase has the aminoacid sequence of SEQ.ID.NO:7, and preferably, described N end fragment has 1-229 amino acids residue, and described C end fragment has 230-311 amino acids residue.

20. methods as described in paragraph 15, wherein, described split-type signal generation albumen is beta-galactosidase enzymes, described other reactant participating in the chemical reaction producing detectable signal comprises the chloro-3-indyl of the bromo-4-of 5--β-D-galactopyranoside or ortho-nitrophenyl-β-D-galactopyranoside, and described detectable signal is light absorption value; Or described other reactant participating in the chemical reaction producing detectable signal comprises p-amino phenyl-β-D-galactopyranoside, and described detectable signal is electrical signal.

21. methods as described in paragraph 20, the N end fragment of described beta-galactosidase enzymes and C end fragment are respectively the mutant of LacZ α and LacZ ω or above-mentioned fragment, preferably, described N end fragment and C end fragment have the aminoacid sequence of SEQ.ID.NO:8 and SEQ.ID.NO:9 respectively.

22. methods as described in paragraph 15, wherein, described split-type signal generation albumen is β-lactamase, and other reactant that described participation produces the chemical reaction of detectable signal comprises penicillin, and described detectable signal is electrical signal.

23. methods as described in paragraph 22, wherein, described β-lactamase has the aminoacid sequence of SEQ.ID.NO:10, and preferably, described N end fragment has 1-171 amino acids residue, and described C end fragment has 172-264 amino acids residue.

24. methods as described in paragraph 23, wherein, described β-lactamase has the aminoacid sequence of SEQ.ID.NO:10, and has M157T sudden change.

25. methods as described in paragraph 15, wherein, described split-type signal generation albumen is Tetrahydrofolate dehydrogenase, and other reactant that described participation produces the chemical reaction of detectable signal comprises NADPH, and described detectable signal is fluorescent signal.

26. methods as described in paragraph 25, wherein, described Tetrahydrofolate dehydrogenase has the aminoacid sequence of SEQ.ID.NO:11, and preferably, described N end fragment has 1-86 amino acids residue, and described C end fragment has 87-159 amino acids residue.

27. methods as described in paragraph 15, wherein, described split-type signal generation albumen is fluorescin, and do not need to add other reactant or catalyzer, described detectable signal is fluorescent signal.

26. methods as described in paragraph 25, wherein, described fluorescin is GFP (SEQ.ID.NO:12) or EGFP, preferably, described N end fragment has SEQ.ID.NO:12 1-157 amino acids residue, and described C end fragment has SEQ.ID.NO:12 158-238 amino acids residue.

27. methods according to any one of paragraph 1-14, wherein, described split-type signal is sent out each fragment protedogenous and is respectively antigen protein and primary antibodie albumen, described other reactant of chemical reaction participating in producing detectable signal comprises two anti-, hydrogen peroxide and the chromogenic substrate of horseradish peroxidase-labeled, and described detection signal is absorbancy or fluorescent signal.

28. methods as described in paragraph 27, wherein, described chromogenic substrate is for being selected from the one in the group that is made up of following substrate:

Dianisidine, Ortho Toluidine indigo plant, potassiumiodide, 3,3', 5,5'-tetramethyl benzidines and syringaldazine, bisphosphate primaquine, thiazole yellow G and anhydrous auramine O.

29. methods according to any one of paragraph 1-28, wherein, design by the following method and synthesize sgRNA by in-vitro transcription: first in described target dna sequence, search " NGG " sequence, wherein N represents any Nucleotide, designs the sgRNA for this site; The in-vitro transcription template of described sgRNA is obtained subsequently by over-lap PCR; Utilize t7 rna polymerase to carry out in-vitro transcription, obtain described sgRNA.

30. methods as described in paragraph 29, wherein, the in-vitro transcription template of described sgRNA comprises T7 promotor, crRNA and tracrRNA sequence.

31. methods according to any one of paragraph 1-30, wherein, having spacing, described spacing >0bp between each target sequence location of described target dna, such as, is 5bp-100bp, more preferably 17bp-34bp.

32. methods according to any one of paragraph 1-31, wherein, step (3) or (4') in, described first fusion rotein and described second fusion rotein are isoconcentration mixing, and each sgRNA mixes for isoconcentration.

33. methods according to any one of paragraph 1-32, wherein, step (3) or (4') in, the fusion rotein total concn provided, sgRNA to the preferred 5-30:80-150:1 of the mol ratio of target dna, more preferably 10:100:1.

34. methods according to any one of paragraph 1-33, wherein, step (3) or (4') in, a sgRNA of each sgRNA centering and the first fusion rotein are hatched jointly, and another sgRNA and the second fusion rotein are hatched jointly, again the two mixed subsequently and add the target dna that (3') sample or step obtain.

35. 1 kinds of test kits, described test kit comprises: the first fusion rotein and the second fusion rotein, described first fusion rotein is the fusion rotein of split-type signal generation albumen n end fragment and nuclease-deficient Cas9 albumen, described second fusion rotein is the fusion rotein of split-type signal generation PROTEIN C end fragment and nuclease-deficient Cas9 albumen, and the described signal generation albumen be made up of described N end fragment and described C end fragment can participate in the chemical reaction producing detectable signal.

36. test kits as described in paragraph 35, described test kit also comprises the reactant and/or catalyzer that participate in the chemical reaction producing detectable signal.

37. test kits as described in paragraph 35 or 36, wherein, described nuclease-deficient Cas9 is the nuclease-deficient Cas9 of streptococcus pyogenes, thermophilus streptococcus, Neisseria meningitidis or treponema denticola, preferably there is the nuclease-deficient Cas9 of the aminoacid sequence of SEQ.ID.NO:1-SEQ.ID.NO:5, preferred dCas9.

38. test kits according to any one of paragraph 35-37, wherein, utilize connection peptides to connect described nuclease-deficient Cas9 structural domain and described split-type signal and send out N end fragment or C end fragment protedogenous, described connection peptides is preferably made up of glycine and/or Serine, there is 6-12 amino-acid residue, such as, there is the aminoacid sequence of SEQ.ID.NO:13.

39. test kits according to any one of paragraph 35-38, wherein, described fusion rotein also can comprise the label facilitating its expression and purification, the label be such as made up of 6 Histidines.

40. test kits according to any one of paragraph 35-39, wherein, described split-type signal generation albumen is selected from any one in the group be made up of following albumen:

41. test kits as described in paragraph 40, wherein, described split-type signal generation albumen is Fluc, and other reactant that described participation produces the chemical reaction of detectable signal comprises ATP, D-luciferin and Mg ²⁺.

42. test kits as described in paragraph 41, wherein, described Fluc has the aminoacid sequence of SEQ.ID.NO:6, and preferably, described N end fragment has 2-398 amino acids residue, and described C end fragment has 394-550 amino acids residue; Or described N end fragment has 2-416 amino acids residue, and described C end fragment has 398-550 amino acids residue.

43. test kits as described in paragraph 40, wherein, described split-type signal generation albumen is Renilla luciferase, and other reactant that described participation produces the chemical reaction of detectable signal comprises coelenterazine.

44. test kits as described in paragraph 43, wherein, described Renilla luciferase has the aminoacid sequence of SEQ.ID.NO:7, and preferably, described N end fragment has 1-229 amino acids residue, and described C end fragment has 230-311 amino acids residue.

45. test kits as described in paragraph 40, wherein, described split-type signal generation albumen is beta-galactosidase enzymes, and other reactant that described participation produces the chemical reaction of detectable signal comprises the chloro-3-indyl of the bromo-4-of 5--β-D-galactopyranoside, ortho-nitrophenyl-β-D-galactopyranoside or p-amino phenyl-β-D-galactopyranoside.

46. test kits as described in paragraph 45, the N end fragment of described beta-galactosidase enzymes and C end fragment are respectively the mutant of LacZ α and LacZ ω or above-mentioned fragment, preferably, described N end fragment and C end fragment have the aminoacid sequence of SEQ.ID.NO:8 and SEQ.ID.NO:9 respectively.

47. methods as described in paragraph 40, wherein, described split-type signal generation albumen is β-lactamase, and other reactant that described participation produces the chemical reaction of detectable signal comprises penicillin.

48. methods as described in paragraph 47, wherein, described β-lactamase has the aminoacid sequence of SEQ.ID.NO:10, and preferably, described N end fragment has 1-171 amino acids residue, and described C end fragment has 172-264 amino acids residue.

49. test kits as described in paragraph 47, wherein, described β-lactamase has the aminoacid sequence of SEQ.ID.NO:10, and has M157T sudden change.

50. test kits as described in paragraph 40, wherein, described split-type signal generation albumen is Tetrahydrofolate dehydrogenase, and other reactant that described participation produces the chemical reaction of detectable signal comprises NADPH.

51. test kits as described in paragraph 50, wherein, described Tetrahydrofolate dehydrogenase has the aminoacid sequence of SEQ.ID.NO:11, and preferably, described N end fragment has 1-86 amino acids residue, and described C end fragment has 87-159 amino acids residue.

52. test kits as described in paragraph 40, wherein, described split-type signal generation albumen is fluorescin.

53. test kits as described in paragraph 52, wherein, described fluorescin is GFP (SEQ.ID.NO:12) or EGFP, preferably, described N end fragment has SEQ.ID.NO:12 1-157 amino acids residue, and described C end fragment has SEQ.ID.NO:12 158-238 amino acids residue.

54. test kits according to any one of paragraph 35-39, wherein, described split-type signal is sent out each fragment protedogenous and is respectively antigen protein and primary antibodie albumen, and other reactant that described participation produces the chemical reaction of detectable signal comprises two anti-, hydrogen peroxide and the chromogenic substrate of horseradish peroxidase-labeled.

55. test kits as described in paragraph 54, wherein, described chromogenic substrate is selected from the one in the group be made up of following substrate:

56. 1 kinds of equipment, described equipment comprises raising module and detection module, described raising module is used for hatching the step (3) such as according to any one of paragraph 1-34 or reaction mixture (4'), and described detection module is for implementing step (4) according to any one of paragraph 1-34 or (5').

Method according to any one of 57. paragraph 1-34, the test kit according to any one of paragraph 35-55 or the equipment described in paragraph 56 purposes in medical diagnosis on disease, pollution detection or detection GMOs.

The following example illustrates some embodiments of the present invention and aspect.It is evident that concerning various equivalent modifications, can carry out various amendment, increase, replacement etc. when not changing the spirit or scope of the present invention, these modifications and variations are all covered by within the scope of the present invention that appended claims limits.Following embodiment, only for illustration of object, limits the invention never in any form.

Embodiment

Embodiment 1

Embodiment 1 adopts split-type Fluc (nucleotide sequence is as shown in SEQ.ID.NO:14) as signal generation albumen, its N end fragment (Nfluc) has the aminoacid sequence by the nucleotide coding of the 1st-1248, and C end fragment (Cfluc) has the aminoacid sequence by the nucleotide coding of the 1194th-1650.Adopt dCas9 (nucleotide sequence is as shown in SEQ.ID.NO:15) as nuclease-deficient Cas9.Described first fusion rotein is have connection peptides and histidine-tagged and merge at N end and have the dCas9 albumen (Nfluc-dCas9) of Fluc N end fragment, the second fusion rotein to be have connection peptides and histidine-tagged and merge at N end the dCas9 albumen (Cfluc-dCas9) having Fluc C end fragment.Wherein, the nucleotides sequence of connection peptides of encoding is classified as GGTGGCGGTGGCtctGGTGGCGGTGGCTCT (SEQ.ID.NO:16).

The target dna that the present embodiment adopts is SEQ.ID.NO:17, contrast DNA is pSB1C3 plasmid (its sequence is see http://parts.igem.org/cgi/partsdb/puttext.cgi) and pET28a plasmid (GenbankAccessNO:KJ782405.1).Target sequence is to being the 1189-1208 position of target dna and 1236-1255 bit sequence, for above-mentioned target sequence to design sgRNA couple, be called 3L and 3R (recognition sequence is respectively tcttcagggaaaagctgggt and ttaggcccgtttcatcaggaa).

The substratum used in embodiment and reagent:

LB substratum:

Add in the distilled water of 1L

Peptone: 10g (OXOIDLP0042);

NaCl:10g (Beijing Chemical Plant, purity >=99.5%, pH:5.0 ~ 8.0);

Yeast powder: 5g (OXOIDLP0021),

121 DEG C of autoclaving 20min.

PBS damping fluid:

NaCl:7.9g (Beijing Chemical Plant, purity >=99.5%, pH:5.0 ~ 8.0);

KCl:0.2g (Beijing Chemical Plant, purity >=99.5%, pH:5.0 ~ 8.0);

KH ₂pO ₄: 0.24g (Beijing Chemical Plant, purity>=99.5%, pH:4.2 ~ 4.5);

K ₂hPO ₄: 1.8g (Beijing Chemical Plant, purity>=99.0%, pH:8.9 ~ 9.4),

Be dissolved in 800ml distilled water, last adding distil water is settled to 1L, by the pH value to 7.4 of HCl (analytical pure, Chemical Reagent Co., Ltd., Sinopharm Group) regulator solution.

the preparation of fusion rotein and preservation

1. build pET21a-6 × His-Nfluc-dCas9 expression vector

Adopt pET21a plasmid (sequence is see https: //www.addgene.org/vector-database/2549/) as setting out plasmid, the histidine-tagged DNA sequence dna of coding 6, the N end of coding Fluc or the DNA sequence dna of the DNA sequence dna of C end fragment, connection peptides of encoding and dCas9 is inserted, construction recombination plasmid after T7-tagATG initiator codon.Expression of recombinant plasmid Nfluc-dCas9 or Cfluc-dCas9.

With connecting product conversion DH5 α competent cell, picked clones, amplification plasmid.

2. the expression and purification of fusion rotein

By the plasmid transformation escherichia coli BL21 competence of positive colony extracted, picking mono-clonal colony inoculation in 50mLLB (Amp resistance) substratum, 37 DEG C of incubated overnight.Second day, overnight culture be inoculated into the ratio of 1:100 in the large bottle of the 2LLB substratum containing Amp resistance, 37 DEG C of shaking tables are cultured to OD600 when being about 0.6 ~ 0.8, and add the IPTG that final concentration is 0.2mM, 16 DEG C are continued to cultivate 16h.Subsequently, at 4 DEG C, 6,000rpm centrifugal 15min, collect thalline.Every 2L thalline PBS (pH7.4) of about 50mL precooling suspends.Suspension is placed on ice, ultrasonic degradation thalline (SCIENTZJY92-IID ultrasonic cell disruptor, ultrasonic 6s, interval 12s, 300W, 99 times).By lysate 15,000rpm, 4 DEG C of centrifugal 30min, remove precipitation, collect supernatant liquor.The filter membrane of 0.22 μm is utilized by supernatant to filter.

At 4 DEG C, utilize peristaltic pump, with the speed of 1-2ml/min, the supernatant liquor containing fusion rotein is injected into 5mlHisTrap prepacked column (GE), thus make to be with the albumen of histidine-tagged (6 × Histag) to be combined with His-Beads.AKTA (GeHealthcareLifeSciences) is utilized to carry out the separation and purification of protein.Wherein, A liquid is 20mMTris, 500mMNaCl, pH8.0.B liquid is 20mMTris, 500mMNaCl, 300mM imidazoles, pH8.0.Carry out gradient elution, imidazole concentration gradient is: 20mM, 50mM, 100mM, 200mM, 300mM.

10%SDS-PAGE electrophoresis detection is carried out to the albumen of wash-out under different gradient, determines that suitable imidazoles wash-out concentration is 200mM.After can utilizing 5mM imidazoles wash-out impurity, utilize 200mM imidazoles wash-out target protein.

Then with molecular sieve gel chromatography, purifying is carried out to the albumen after wash-out.

Specific as follows: implementing to change liquid and be concentrated into volume with the evaporating pipe that molecular weight cut-off is 30kD (MWCO) is 3-5mL.Use gel chromatography column Hiload16/60, initialization system, with molecular sieve damping fluid, (molecular sieve damping fluid (20mMHepes, 150mMKCl, PH:7.5) balances pillar about 1 column volume.Wash loading ring with molecular sieve damping fluid, draw the protein sample of previous step wash-out, carry out loading, observe the ultraviolet absorption value of 280nM, when absorption value arrives more than 30mAU, collect sample.SDS-PAGE protein electrophoresis is utilized to identify the sample collected.Judge protein purification effect.Finally the albumen evaporating pipe collected is concentrated into more than 5mg/ml.

3. the mensuration of the concentration of fusion rotein

Utilize BCAproteinassay test kit (Quan Shijin, EasyIIProteinQuantitativeKit (BCA) DQ111-01), the mensuration of protein concentration is implemented in the explanation according to manufacturers:

Get A liquid 980.4ml and B liquid 19.6ml, mixing.Get albumen and be diluted to 50 μ l, add A liquid and the B liquid of mixing, mixing.Mixture is hatched 30min by 37 degree of water-baths.After temperature return to room temperature, OD562 surveys absorbance, then calculates protein concentration mg/ml.Method of calculation are: protein concentration=OD value × albumen extension rate × slope of standard curve.

4. the preservation of fusion rotein

Utilize the glycerine of 50v/v%, at-20 DEG C, albumen is preserved.1mMDTT is added ,-80 DEG C of preservations during long-term preservation.

the design of sgRNA and preparation

Utilize http://crispr-era.stanford.edu/InitAction.action, (2015, HongleiLiu, ZhengWei, AntoniaDominguez, YandaLi, XiaowoWang, andLeiS.Qi; CRISPR-ERA:acomprehensivedesigntoolforCRISPR-mediatedgen eediting, repressionandactivation) online tool design sgDNA.

First build the sgRNA expression vector of T7 promoters driven, the fragment comprising promotor, sgDNA sequence and terminator is carried out pcr amplification, purifying reclaims.Use T7RNA rapidly and efficiently synthetic agent box (NEB company, #E2050S) carries out RNA in-vitro transcription to PCR primer, uses RNAcleanRNA cleaning and purifying test kit (Bo Maide company, RN1402) to carry out purifying.By frozen at-20 DEG C for the sgRNA after purifying.Constructed sgRNA order comprises crRNA sequence, tracRNA sequence and recognition sequence.Its structure see AProgrammableDual-RNA-GuidedDNAEndonucleaseinAdaptiveBac terialImmunity, the description in 2012.

detection method

With molecular sieve damping fluid, fusion rotein liquid storage is diluted to 0.5 μM, with DEPC water, sgRNA is diluted to 100nM.

Adopt following 30 μ l systems, respectively the single sgRNA of working concentration and single fusion rotein are hatched the 10min: the one sgRNA and the first fusion rotein, the 2nd sgRNA and the second fusion rotein at 25 DEG C; Or, a sgRNA and the second fusion rotein, the 2nd sgRNA and the first fusion rotein.For each sgRNA and each fusion rotein, adopt identical working concentration.Such process can improve strength of signal.

Two portions solution equal-volume mixing of will separately hatch subsequently, after adding target dna or contrast DNA (pSB1C3 plasmid), hatches 30min for 37 DEG C.

System is transferred to the 96 orifice plate (Corning being preheated to 37 DEG C assayPlate3925) in, every hole adds the luciferase assay kit (LuciferaseAssayReagent, Promega, E4550) that 100 μ L are preheated to 37 DEG C, puts into microplate reader immediately and measures (ThermoVarioskan ^tMflashMultimodeReader#5250030), luminous signal is read.Measuring parameter is: single hole Measuring Time is 1000ms, and dynamicrange is automatic or low.

Research 1: the suitableeest working concentration of fusion rotein

The suitableeest working concentration of this research to fusion rotein measures.The working concentration of each sgRNA used is 150nM, and the final concentration of target dna is 30nM.The working concentration of each fusion rotein of testing is respectively 3nM, 6nM, 15nM and 30nM.Experiment finds, when fusion rotein concentration is too small, signal is more weak.And when fusion rotein working concentration is 30nM, due to non-specific interaction, also there is positive signal in a kind of sgRNA only adding sgRNA centering.Can find out, fusion rotein working concentration suitable in the system of the present embodiment is 15nM.

The relative position of research 2:PAM sequence and fusion rotein is on the impact of fluorescence signal intensity

In order to study the different building modes of fusion rotein to the impact of detection signal strength, the method that present invention employs as hereinbefore constructs dCas9 and merges fusion rotein (dCas9-Nfluc and dCas9-Cfluc) at split-type Fluc each fragment N end, and described fusion rotein comprises connection peptides and histidine-tagged equally.

In addition, in order to study the direction of PAM sequence and position to the impact of detection signal strength, present invention employs the set-up mode of four kinds of target sequences.Wherein, iL represent 3L for target sequence be sense strand sequence, PAM sequence be positioned at this target sequence 3' end.EL represent 3L for target sequence be antisense strand sequence, PAM sequence be positioned at this target sequence 3' end.IR represent 3R for target sequence be antisense strand sequence, PAM sequence be positioned at this target sequence 3' end.ER represent 3R for target sequence be sense strand sequence, PAM sequence be positioned at this target sequence 3' end.Thus iL+iR represents two PAM sequences (PAM-in) between two target sequences, eL+eR represents that two PAM sequences are positioned at (PAM-out) (DimericCRISPRRNA-guidedFokInucleasesforhighlyspecificgen omeediting) outside two target sequences.

The building mode of the position of PAM sequence and direction and fusion rotein is on the impact of strength of signal comparatively complicated (as shown in Figure 2).Such as, when using Nfluc-dCas9/Cfluc-dCas9 fusion rotein, the effect of eL+eR is best, when using dCas9-Nfluc/dCas9-Cfluc fusion rotein, the effect of iL+iR is best, and in these two kinds of situations, the close together of two fusion roteins, easily re-assemblies; IL+eR or eL+iR effect is bad, and supposition may be that dCas9 fusion rotein is relatively large, and same DNA chain re-assemblies comparatively difficulty.The concentration of two dCas9 fusion roteins used in experiment is 15nM, and the DNA concentration participating in test is 1.5nM.In research thereafter, dCas9-Nfluc/dCas9-Cfluc fusion rotein and target sequence direction is adopted to be eL/eR.

Research 3: the relation of target sequence spacing and relative signal intensity

This research have adjusted for the spacing of target sequence, have studied the relation of target sequence spacing and relative signal intensity.In the experiment increasing spacing, the base sequence of insertion is stochastic generation.Each fusion rotein concentration is 15nM, and target DNA concentration is 1.5nM, and the working concentration of each sgRNA is 150nM.As shown in Figure 3, relative signal intensity illustrates with the ratio of the fluorescent value recorded with blank value.Blank value is the fluorescent value obtained by the sample not containing any DNA to be detected.Along with the increase of spacing, luminous signal first raises rear reduction.When target sequence spacing is 21bp, strength of signal is maximum.And when spacing is 27-34bp, because duplex DNA is as target, DNA phase place is now conducive to re-assemblying of fusion rotein.And when spacing is greater than 35bp beyond two combinable distances of fusion rotein, increase the difficulty that luciferase is reassembled into activated catalyzer.This research is that the selection of target sequence in actual detection provides enlightenment.

Research 4: the sensitivity of detection

As shown in Figure 4, relative signal intensity illustrates with the ratio of the fluorescent value recorded with negative control value.Negative control value is by adding the fluorescent value obtained without the sample of the DNA to be detected of target sequence.When target DNA concentration is less than 1.5nM, along with DNA concentration increases, the strength of signal detected increases, and the strength of signal detected when 1.5nM is the strongest; The strength of signal continuing to detect when increasing DNA concentration reduces, and represent that effect (non-specific binding) of missing the target increases, the dCas9 fusion rotein concentration that actual participation albumen re-assemblies combination reduces, and fluorescence signal intensity weakens.The concentration of two fusion roteins used in experiment is 15nM, and the DNA concentration participating in test is 1.5nM, and error bar represents the standard deviation of three parallel laboratory tests.

Research 5: the specificity of detection

Go out as shown in Figure 5, pET-28a, pSB1C3 be two not containing the sgRNA of the present embodiment to the plasmid of recognition site, only add a kind of sgRNA (working concentration is 300nM) in 3L, 3R expression system respectively.Target107 and Target27 is illustrated respectively on described target dna, and the spacing of target sequence is 107bp and 27bp.In the experiment of Target107, the space length of the dCas9 structural domain of each fusion rotein is comparatively far away, and luciferase is two-part re-assemblies comparatively difficulty (as shown in Figure 3), and its strength of signal comparatively Target27 is low.The concentration of two dCas9 fusion roteins used in experiment is 15nM, and the DNA concentration participating in test is 1.5nM, and relative signal intensity illustrates with the ratio of the fluorescent value recorded with blank value.Blank value is the fluorescent value obtained by the sample not containing any DNA to be detected.Error bar represents the standard deviation of three parallel laboratory tests.

Embodiment 2

The present embodiment adopts the fusion rotein identical with embodiment 1, using Bacillus subtilis genes group (NCBIaccessNO:NC_000964) as target dna.

Utilize the method identical with embodiment 1, for the specific sequence of Bacillus subtilis genes group, designed and synthesized three couples of sgRNA, be called sgRNAPair6, sgRNAPair7 and sgRNAPair8.In sample, the concentration of Bacillus subtilis genes group DNA is 318.4ng/ μ L.The final concentration of the Bacillus subtilis genes group DNA adopted in detection is 0.012nM.Employing is added with the sample of genome of E.coli (NCBIaccessNO:NC_000913) as negative control, and in detection, the final concentration of genome of E.coli DNA is 0.015nM.

SgRNA is to sequence

sgRNAPair6atcatcccctcatcaatgggggcatccaccatctttgtcc

sgRNAPair7tggtatgaatcccatggttatgctgagactgttatcatat

sgRNAPair8ggaggttttggtaagggtatgtgatggtcaaggcaacaat

Described result illustrates with the ratio of the fluorescent value recorded with blank value.Blank value be obtained by the sample not containing any DNA to be detected fluorescent value (namely signal send out N end fragment protedogenous and C end fragment due to the spontaneous false positive signal re-assemblying generation at random).As shown in Figure 6, during using Bacillus subtilis genes group as DNA to be detected, the Fluorescent signal of acquisition is 5 times of blank (namely not adding any DNA to be detected).During using genome of E.coli as DNA to be detected, the Fluorescent signal intensity obtained is less than blank, do not wish by theoretical restriction, this to move at random along genome of E.coli DNA due to the first fusion rotein and the second fusion rotein and combines the three-dimensional random collision reducing signal generation albumen n end fragment and C end fragment.

In addition, use unmatched sgRNA to (3L, 3R), when detecting target dna (Bacillus subtilis genes group) and negative control (genome of E.coli) respectively, the signal of acquisition and blank cannot be distinguished.Embodiment 3

The present embodiment adopts PCR as pre-treatment, and adopt the fusion rotein identical with embodiment 1, the setting of detected object is identical with embodiment 2.In amplification negative control, adopt the pSB1C3 plasmid of same concentrations as amplification template.

In pre-treatment step, utilize the primer pair (forward primer: aacgaacagctgaaatggaagtgc that can carry out specific amplification to subtilis yraO gene fragment; Reverse primer: gcgcattcttggaggtgtaatatg), implement Standard PCR and amplified production (size is 2k) is reclaimed.In initial sample, the concentration of Bacillus subtilis genes group DNA is 318.4ng/ μ L (identical with embodiment 2).Using the product after recovery as sample (wherein the final concentration of DNA is for 3nM), by the step identical with embodiment 2, add fusion rotein and sgRNA couple, implement detection method of the present invention.

As shown in Figure 6, compared with embodiment 2, adopt PCR, as pre-treatment, the relative intensity of detection signal is improve 8 times nearly.Adopt signal that negative amplification template (pSB1C3 plasmid) obtains also much smaller than positive template.In addition, adopt different sgRNA to the strength of signal that can obtain difference to some extent.As shown in Figure 7, adopted three pairs of sgRNA centerings, adopt the sensitivity of sgRNAPair8 the highest, specificity is the most weak.Especially, the specificity that the right quantity of sgRNA can increase the inventive method is increased.

In order to get rid of the impact that PCR system measures fluorescent value, adopt pSB1C3 plasmid as amplification template.Due to any amplified production can not be produced, thus the fluorescence caused by PCR system itself is detected.In addition, in order to prove the specificity of sgRNA, additionally using and can not identify that the contrast sgRNA of target dna is to (3L, 3R) (the grey rod of Fig. 6 and Fig. 8).The result of these contrasts shows, could obtain higher detection signal when only having sgRNA pair to mate with DNA to be detected.

In order to measure the sensitivity of the present embodiment method, PCR primer being diluted, gathering the relative signal under each concentration.When PCR primer concentration is low to moderate 0.024nM (concentration corresponding to Bacillus subtilis genes group is 2.55ng/ μ L), the signal (Fig. 7) higher than blank and negative control still can be obtained.Utilize PCR to carry out sensitivity that pre-treatment significantly improves the inventive method.

Embodiment 4

The present embodiment adopts isothermal duplication as pre-treatment, adopts the fusion rotein identical with embodiment 1, and detected object is Target20 (namely in embodiment 1 and Fig. 3, spacing is the target sequence of 20bp).As amplification negative control, adopt the pSB1C3 plasmid of same concentrations as amplification template.SgRNA pair of the present embodiment use identical with embodiment 1, is 3L and 3R.

Three are used to implement Bst isothermal duplication to different primers.Wherein, the primer pair that the 228bp fragment that increases uses is ggccgcccttgcccttttttgccgga and gcggccgcgtcgatggagcaagtgga.The primer pair of amplification 524bp fragment is ggccgcccttgcccttttttgccgga and gcggcccccagatttcgggaggttgg.The primer pair of amplification 1060bp fragment is ggccgcccttgcccttttttgccgga and gcggccggccatggtaactcaagcgac.

Loopamp bright report DNA cloning test kit (SLP204) is utilized to implement isothermal duplication.Amplification system is

Temperature of reaction is 63 DEG C or 60 DEG C, 60min, subsequently at 80 DEG C of heating 10min deactivation BstDNA polysaccharases; See TwoMethodsforIncreasedSpecificityandSensitivityinLoop-Me diatedIsothermalAmplification.The electrophoresis detection result of amplified production is as shown in Fig. 9 (a).

Wherein, swimming lane 19 adds the Target20 plasmid of high density.Swimming lane 20 is for adding pSB1C3 plasmid.Swimming lane M is Marker (BM5000DNAMarker, DM0203).Owing to not carrying out purifying to isothermal amplified production, non-detectable level.1 × represent in 20 μ L incubation systems and add 2 μ L isothermal duplication products, 5 × represent first by after isothermal duplication product dilution 5 times, then carry out subsequent operations.Result is as shown in Fig. 9 (b).Adopt the strength of signal difference to some extent that different isothermal duplication conditions obtains different fragment amplifications, but be all significantly higher than amplification negative control.

The above results shows, method of the present invention has excellent sensitivity and specificity.PCR or isothermal duplication is utilized to can further improve sensitivity as pre-treatment.

Claims

(4) described detectable signal is measured.

(1 ') provides the first fusion rotein and the second fusion rotein, wherein, described first fusion rotein is the fusion rotein of split-type signal generation albumen n end fragment and nuclease-deficient Cas9 albumen, described second fusion rotein is the fusion rotein of split-type signal generation PROTEIN C end fragment and nuclease-deficient Cas9 albumen, and the described signal generation albumen be made up of described N end fragment and described C end fragment can participate in the chemical reaction producing detectable signal;

(2 '), for the one or more pairs of target sequence in the target dna corresponding to described target RNA, designs and synthesizes sgRNA couple;

(3 '), for the described target RNA in described sample, implements the target dna of reverse transcription also corresponding to acquisition;

Described first fusion rotein that the target dna that step (3 ') obtains by (4 '), step (1 ') provide and each sgRNA that described second fusion rotein, step (2 ') obtain to and participate in other reactant of the chemical reaction producing detectable signal and/or catalyzer is hatched jointly, generate detectable signal; And

(5 ') measures described detectable signal.

3. method as claimed in claim 1 or 2, wherein, described sample is environmental sample, such as, be the sample of underground water, Zhong Shui, seawater, mining waste material; Or, described sample is biological sample, particularly from the sample of experimenter, such as, for being selected from following sample one or more: cheek swab, blood, serum, blood plasma, phlegm, cerebrospinal fluid, urine, tear, alveolar isolate, Pleural fluid, pericardial fluid, capsule liquid, tumor tissues, tissue, slicer, saliva; Or described sample comes from food, tap water or feed; And/or

Wherein, described target nucleic acid is the nucleic acid of natural existence or synthetic, such as, come from animal, the genetic material of plant or microorganism or transcription product, preferably, described nucleic acid for coming from microorganism, the particularly genetic material of industrial microorganism or pathogenic agent or transcription product; And/or

Wherein, described target sequence is the characteristic sequence of described target nucleic acid, and be such as transgenic fragment sequence, the characteristic sequence of molecule the most often changed in disease or generic character sequence, especially, described target sequence is the generic character sequence of tubercule bacillus.

4. the method as described in any one of claim 1-3, wherein, described sample is through pretreated sample or not pretreated sample; Preferably, use and be selected from following method pre-treatment is carried out to described sample: centrifugal, filter, ultrasonic, homogenization, heating, freezing, thaw, mechanical treatment and/or PCR; Especially, described pre-treatment is implemented by the isothermal amplification method be selected from group formed by the following method: ligase chain reaction, self-sustained sequence copy, strand displacement amplification, nickase amplified reaction, rolling circle amplification, ring mediated isothermal amplification, cross primer constant-temperature amplification, Q-β amplification system and OneCutEventAmplificatioN.

5. the method as described in any one of claim 1-4, wherein, described nuclease-deficient Cas9 is the nuclease-deficient Cas9 of streptococcus pyogenes, thermophilus streptococcus, Neisseria meningitidis or treponema denticola, preferably there is the nuclease-deficient Cas9 of the aminoacid sequence of SEQ.ID.NO:1-SEQ.ID.NO:5, preferred dCas9; And/or

Wherein, utilize connection peptides to connect described nuclease-deficient Cas9 structural domain and described split-type signal and send out N end fragment or C end fragment protedogenous, described connection peptides is preferably made up of glycine and/or Serine, there is 6-12 amino-acid residue, such as, there is the aminoacid sequence of SEQ.ID.NO:13; And/or

Wherein, described fusion rotein also can comprise the label facilitating its expression and purification, the label be such as made up of 6 Histidines; And/or

Wherein, described split-type signal generation albumen is selected from any one in the group be made up of following albumen: rnase, luciferase, beta-galactosidase enzymes, β-lactamase, ubiquitin, fluorescin, Tetrahydrofolate dehydrogenase, TEV protease, chorismic acid dismutase, thymidine kinase, yeast Gal4 albumen and focal adhesion kinase, when described split-type signal generation albumen is Fluc, other reactant that described participation produces the chemical reaction of detectable signal comprises ATP, D-luciferin and Mg ²⁺, described detectable signal is luminous signal, and preferably, described Fluc has the aminoacid sequence of SEQ.ID.NO:6, and preferably, described N end fragment has 2-398 amino acids residue, and C end fragment has 394-550 amino acids residue, or described N end fragment has 2-416 amino acids residue, and described C end fragment has 398-550 amino acids residue, when described split-type signal generation albumen is Renilla luciferase, described other reactant participating in the chemical reaction producing detectable signal comprises coelenterazine, described detectable signal is luminous signal, preferably, described Renilla luciferase has the aminoacid sequence of SEQ.ID.NO:7, preferably, described N end fragment has 1-229 amino acids residue, and described C end fragment has 230-311 amino acids residue, when described split-type signal generation albumen is beta-galactosidase enzymes, described other reactant participating in the chemical reaction producing detectable signal comprises the chloro-3-indyl of the bromo-4-of 5--β-D-galactopyranoside or ortho-nitrophenyl-β-D-galactopyranoside, described detectable signal is light absorption value, or described other reactant participating in the chemical reaction producing detectable signal comprises p-amino phenyl-β-D-galactopyranoside, described detectable signal is electrical signal, preferably, the N end fragment of described beta-galactosidase enzymes and C end fragment are respectively the mutant of LacZ α and LacZ ω or above-mentioned fragment, preferably, described N end fragment and C end fragment have the aminoacid sequence of SEQ.ID.NO:8 and SEQ.ID.NO:9 respectively, when described split-type signal generation albumen is β-lactamase, described other reactant participating in the chemical reaction producing detectable signal comprises penicillin, described detectable signal is electrical signal, preferably, described β-lactamase has the aminoacid sequence of SEQ.ID.NO:10, preferably, described N end fragment has 1-171 amino acids residue, and described C end fragment has 172-264 amino acids residue, or described β-lactamase has the aminoacid sequence of SEQ.ID.NO:10, and there is M157T sudden change, when described split-type signal generation albumen is Tetrahydrofolate dehydrogenase, described other reactant participating in the chemical reaction producing detectable signal comprises NADPH, described detectable signal is fluorescent signal, preferably, wherein, described Tetrahydrofolate dehydrogenase has the aminoacid sequence of SEQ.ID.NO:11, preferably, described N end fragment has 1-86 amino acids residue, and described C end fragment has 87-159 amino acids residue, when described split-type signal generation albumen is fluorescin, do not need to add other reactant or catalyzer, described detectable signal is fluorescent signal, preferably, described fluorescin is GFP (SEQ.ID.NO:12) or EGFP, preferably, described N end fragment has SEQ.ID.NO:12 1-157 amino acids residue, and described C end fragment has SEQ.ID.NO:12 158-238 amino acids residue, antigen protein and primary antibodie albumen is respectively when described split-type signal sends out each fragment protedogenous, described other reactant of chemical reaction participating in producing detectable signal comprises two anti-, hydrogen peroxide and the chromogenic substrate of horseradish peroxidase-labeled, described detection signal is absorbancy or fluorescent signal, preferably, described chromogenic substrate is for being selected from the one in the group that is made up of following substrate: dianisidine, Ortho Toluidine indigo plant, potassiumiodide, 3,3 ', 5,5 '-tetramethyl benzidine and syringaldazine, bisphosphate primaquine, thiazole yellow G and anhydrous auramine O.

6. the method according to any one of claim 1-5, wherein, design by the following method and synthesize sgRNA by in-vitro transcription: first in described target dna sequence, search " NGG " sequence, wherein N represents any Nucleotide, designs the sgRNA for this site; The in-vitro transcription template of described sgRNA is obtained subsequently by over-lap PCR; Utilize t7 rna polymerase to carry out in-vitro transcription, obtain described sgRNA; Especially, the in-vitro transcription template of described sgRNA comprises T7 promotor, crRNA and tracrRNA sequence.

7. the method according to any one of claim 1-6, wherein, having spacing, described spacing >0bp between each target sequence location of described target dna, such as, is 5bp-100bp, more preferably 17bp-34bp.

8. the method according to any one of claim 1-7, wherein, in step (3) or in (4 '), described first fusion rotein and described second fusion rotein are isoconcentration mixing, each sgRNA is to being isoconcentration mixing, preferably, the fusion rotein total concn provided, sgRNA to the preferred 5-30:80-150:1 of the mol ratio of target dna, more preferably 10:100:1; Preferably, in step (3) or in (4 '), a sgRNA of each sgRNA centering and the first fusion rotein are hatched jointly, and another sgRNA and the second fusion rotein are hatched jointly, again the two mixed subsequently and add the target dna that sample or step (3 ') obtain.

9. a test kit, described test kit comprises: the first fusion rotein and the second fusion rotein, described first fusion rotein is the fusion rotein of split-type signal generation albumen n end fragment and nuclease-deficient Cas9 albumen, described second fusion rotein is the fusion rotein of split-type signal generation PROTEIN C end fragment and nuclease-deficient Cas9 albumen, the described signal generation albumen be made up of described N end fragment and described C end fragment can participate in the chemical reaction producing detectable signal

Preferably, described test kit also comprises the reactant and/or catalyzer that participate in the chemical reaction producing detectable signal;

Preferably, described nuclease-deficient Cas9 is the nuclease-deficient Cas9 of streptococcus pyogenes, thermophilus streptococcus, Neisseria meningitidis or treponema denticola, preferably there is the nuclease-deficient Cas9 of the aminoacid sequence of SEQ.ID.NO:1-SEQ.ID.NO:5, preferred dCas9;

Preferably, utilize connection peptides to connect described nuclease-deficient Cas9 structural domain and described split-type signal and send out N end fragment or C end fragment protedogenous, described connection peptides is preferably made up of glycine and/or Serine, there is 6-12 amino-acid residue, such as, there is the aminoacid sequence of SEQ.ID.NO:13;

Preferably, described fusion rotein also can comprise the label facilitating its expression and purification, the label be such as made up of 6 Histidines;

Preferably, described split-type signal generation albumen is selected from any one in the group be made up of following albumen: rnase, luciferase, beta-galactosidase enzymes, β-lactamase, ubiquitin, fluorescin, Tetrahydrofolate dehydrogenase, TEV protease, chorismic acid dismutase, thymidine kinase, yeast Gal4 albumen and focal adhesion kinase; When described split-type signal generation albumen is Fluc, other reactant that described participation produces the chemical reaction of detectable signal comprises ATP, D-luciferin and Mg ²⁺, preferably, described Fluc has the aminoacid sequence of SEQ.ID.NO:6, and preferably, described N end fragment has 2-398 amino acids residue, and described C end fragment has 394-550 amino acids residue; Or described N end fragment has 2-416 amino acids residue, and described C end fragment has 398-550 amino acids residue; When described split-type signal generation albumen is Renilla luciferase, described other reactant participating in the chemical reaction producing detectable signal comprises coelenterazine, preferably, described Renilla luciferase has the aminoacid sequence of SEQ.ID.NO:7, preferably, described N end fragment has 1-229 amino acids residue, and described C end fragment has 230-311 amino acids residue; When described split-type signal generation albumen is beta-galactosidase enzymes, described other reactant participating in the chemical reaction producing detectable signal comprises the chloro-3-indyl of the bromo-4-of 5--β-D-galactopyranoside, ortho-nitrophenyl-β-D-galactopyranoside or p-amino phenyl-β-D-galactopyranoside, preferably, the N end fragment of described beta-galactosidase enzymes and C end fragment are respectively the mutant of LacZ α and LacZ ω or above-mentioned fragment, preferably, described N end fragment and C end fragment have the aminoacid sequence of SEQ.ID.NO:8 and SEQ.ID.NO:9 respectively; When described split-type signal generation albumen is β-lactamase, described other reactant participating in the chemical reaction producing detectable signal comprises penicillin, preferably, described β-lactamase has the aminoacid sequence of SEQ.ID.NO:10, and preferably, described N end fragment has 1-171 amino acids residue, and described C end fragment has 172-264 amino acids residue, preferably, described β-lactamase has the aminoacid sequence of SEQ.ID.NO:10, and has M157T sudden change; When described split-type signal generation albumen is Tetrahydrofolate dehydrogenase, described other reactant participating in the chemical reaction producing detectable signal comprises NADPH, preferably, described Tetrahydrofolate dehydrogenase has the aminoacid sequence of SEQ.ID.NO:11, preferably, described N end fragment has 1-86 amino acids residue, and described C end fragment has 87-159 amino acids residue; When described split-type signal generation albumen is fluorescin, preferably, described fluorescin is GFP (SEQ.ID.NO:12) or EGFP, preferably, described N end fragment has SEQ.ID.NO:12 1-157 amino acids residue, and described C end fragment has SEQ.ID.NO:12 158-238 amino acids residue; Antigen protein and primary antibodie albumen is respectively when described split-type signal sends out each fragment protedogenous, described other reactant of chemical reaction participating in producing detectable signal comprises two anti-, hydrogen peroxide and the chromogenic substrate of horseradish peroxidase-labeled, described chromogenic substrate is preferably selected from the one in the group be made up of following substrate: dianisidine, Ortho Toluidine indigo plant, potassiumiodide, 3,3 ', 5,5 '-tetramethyl benzidine and syringaldazine, bisphosphate primaquine, thiazole yellow G and anhydrous auramine O.

10. the method according to any one of claim 1-8 or the purposes of test kit according to claim 9 in pollution detection or detection GMOs.