CN111778270B - Method for reflecting in vitro cell-free protein expression level by integrating luminescent reporter gene - Google Patents

Abstract

The invention discloses a method for reflecting in-vitro cell-free foreign protein expression level, a strain and application thereof. Specifically, a luminescent reporter gene (such as a luciferase gene and a fluorescent protein gene) is integrated into the genome of the strain at the 5 'end and/or the 3' end of a housekeeping gene, the luminescent reporter gene can express a reporter protein in the strain, and the synthesis capacity of the in vitro cell-free exogenous protein is reflected by detecting the luminescent signal intensity of the reporter protein endogenously expressed by the strain. By using the technical scheme of the invention, the traditional in-vitro cell-free protein synthesis reaction is not needed, the gene modification effect can be rapidly detected, and the strain screening efficiency is improved.

Description

Method for reflecting in vitro cell-free protein expression level by integrating luminescent reporter gene

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for reflecting in-vitro cell-free exogenous protein expression level by integrating a luminescent reporter gene and corresponding application thereof.

Background

Proteins are important molecules in cells, and are involved in performing almost all functions of cells. The difference in the sequence and structure of the protein determines the difference in its function. In cells, proteins can catalyze various biochemical reactions as enzymes, can coordinate various activities of organisms as signaling molecules, can support biological morphology, store energy, transport molecules, and move organisms. In the biomedical field, protein antibodies are important means for treating diseases such as cancer as targeted drugs.

In addition to the understanding of intracellular protein synthesis, protein synthesis can also be carried out extracellularly. The in vitro cell-free protein synthesis system is generally characterized in that components such as mRNA or DNA template, RNA polymerase, amino acid, ATP and the like are added into a lysis system of bacteria, fungi, plant cells or animal cells to finish the rapid and efficient translation of foreign proteins. The protein expressed in the in vitro translation system does not need to be subjected to cell transformation, cell culture, cell collection and crushing, and is a rapid, time-saving and convenient protein expression mode. Currently, commercial in vitro cell-free protein expression systems that are frequently tested include the e.coli system (ECE), Rabbit Reticulocyte Lysate (RRL), Wheat Germ (WGE), Insect Cell Extract (ICE), and human-derived systems. Compared with the traditional in vivo recombinant expression system, the in vitro cell-free protein synthesis system has multiple advantages, such as the capability of expressing special proteins with toxic action on cells or containing unnatural amino acids (such as D-amino acids), capability of directly taking PCR products as templates to simultaneously synthesize multiple proteins in parallel, and development of high-throughput drug screening and proteomics research.

In the Cell-Free Protein Synthesis system (CFPS), Cell lysate or Cell extract is an important component, which is directly derived from the cells of the strain, and a wide variety of engineered strains can be obtained by genome editing techniques, but evaluation of any engineered effect ultimately requires experimental data for detection. For example, the modified strain is applied to in vitro cell-free protein synthesis, the conventional experimental steps include shake flask or fermentation tank fermentation culture, cell collection, cell disruption, solid-liquid separation, cell-free protein synthesis system construction, protein synthesis, analysis and detection and the like, the time for completing the whole process is at least about one week, the time consumption, the labor consumption and the cost are high, and the screening efficiency of the strain is not high. Therefore, a method for rapidly detecting the gene modification effect and improving the strain screening efficiency is urgently needed in the field of cell-free protein synthesis.

Disclosure of Invention

The invention aims to provide a method for rapidly detecting the gene modification effect and improving the strain screening efficiency. Specifically, the expression level of the cell-free protein in vitro is reflected by integrating a luminescent reporter gene.

In order to achieve the above objects, the first aspect of the present invention provides a method for reflecting the in vitro cell-free foreign protein synthesis capacity of a strain, comprising the steps of:

(i) integrating a luminescence reporter gene into the 5 'end and/or the 3' end of a housekeeping gene in the genome of a first target strain to obtain a first control strain integrated with the luminescence reporter gene, wherein the first target strain is an original strain or a non-original strain which is transformed by the original strain through any other genes without the luminescence reporter gene integrated;

(ii) on the basis of the first control strain and the first target strain, other optional same gene modifications except for the integration of the luminescence reporter gene are respectively carried out, a second control strain is obtained from the first control strain, and a second target strain is obtained from the first target strain; (ii) if the first target strain is a non-original strain, the genetic modification in step (i) is not the same as the genetic modification in this step;

(iii) (iii) expanding the first control strain of step (i) or the second control strain of step (ii) such that the luminescent reporter gene is expressed within the first control strain or the second control strain;

(iv) detecting the luminous signal intensity of the cultured strain without cell disruption, and reflecting the in vitro cell-free exogenous protein synthesis capacity of the first target strain or the first control strain through the luminous signal intensity of the first control strain; reflecting the in vitro cell-free exogenous protein synthesis capacity of the second target strain or the second control strain through the luminous signal intensity of the second control strain.

Preferably, the luminescent signal intensity of the first control strain is positively correlated with the in vitro cell-free foreign protein synthesis capacity of the first control strain or the first target strain; or the luminous signal intensity of the second control strain is positively correlated with the in vitro cell-free exogenous protein synthesis capacity of the second control strain or the second target strain.

Further preferably, the housekeeping gene is an actin gene, a tubulin gene, a ribosomal protein gene or a glyceraldehyde-3-phosphate dehydrogenase gene. Tubulin genes include, but are not limited to, the beta-tubulin (beta-tubulin) gene, the alpha-tubulin (alpha-tubulin) gene, glyceraldehyde-3-phosphate dehydrogenase genes include, but are not limited to, the GAPDH1, GAPDH2 genes. Preferred are the alpha-tubulin gene and the beta-tubulin gene.

Preferably, the 5 'untranslated region of the luminescent reporter gene has the same polynucleotide sequence as the 5' untranslated region of the DNA template of the foreign protein in the in vitro cell-free protein synthesis system.

Further preferably, the 3 'untranslated region of the luminescent reporter gene has the same polynucleotide sequence as the 3' untranslated region of the DNA template of the foreign protein in the in vitro cell-free protein synthesis system.

Preferably, the luminescence signal intensity is a ratio obtained by comparing the detected luminescence value with the OD value of the bacterial suspension after the amplification culture.

Wherein, the initial OD values of different first control strains before the amplification culture can be the same or different, and preferably have the same OD value; or the initial OD values of the different second control strains before the enlargement culture may be the same or different, and preferably have the same OD value.

Preferably, the luminescent reporter gene is a luciferase gene or a fluorescent protein gene. Further preferably, the luciferase gene is a luciferase NanoLuc gene.

Preferably, the intensity of the luminescence signal of the first control strain or the second control strain, which is different from the first control strain or the second control strain, into which the luciferase NanoLuc gene is incorporated, is detected immediately after the substrate specific to the luciferase NanoLuc is added to the culture broth after the amplification culture, or is detected after the reaction is carried out for the same time.

Wherein, the expanding culture process (culture condition, time, etc.) of different strains can be the same or different. Preferably, the condition and time for the expanded culture of the first target strain are the same as those of the first control strain; or the condition and time of the expanded culture of the second target strain are consistent with the condition and time of the expanded culture of the second control strain.

Preferably, the amplification conditions and time are consistent for different first target strains or different first control strains or different second target strains or different second control strains.

Preferably, the first control strain or the first target strain or the second control strain is derived from escherichia coli, yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

The second aspect of the invention provides a strain for reflecting the in vitro cell-free foreign protein synthesis capacity, wherein a luminescent reporter gene is integrated at the 5 'end and/or the 3' end of a housekeeping gene in the genome of the strain, the luminescent reporter gene can express a reporter protein in the strain, and the in vitro cell-free foreign protein synthesis capacity is reflected by detecting the luminescent signal intensity of the reporter protein.

Preferably, the strain according to the second aspect of the present invention can be used to reflect its own ability to synthesize a cell-free foreign protein in vitro. Further preferably, on the basis of the strain of the second aspect of the present invention, other arbitrary genetic modification without integrating the luminescence reporter gene is performed, and the modified strain thus obtained can reflect the influence of the aforementioned other arbitrary genetic modification on the in vitro cell-free exogenous protein synthesis capacity by detecting the luminescence in the cells of the modified strain.

Preferably, the housekeeping gene is an actin gene, a tubulin gene, a ribosomal protein gene or a glyceraldehyde-3-phosphate dehydrogenase gene.

Preferably, the luminescent reporter gene is a luciferase gene or a fluorescent protein gene. Further preferably, the luciferase gene is a luciferase NanoLuc gene.

Preferably, the strain is derived from escherichia coli and yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

In a third aspect, the present invention provides a use of the strain according to the second aspect of the present invention for reflecting the ability of synthesizing an in vitro cell-free foreign protein.

The beneficial effects of the invention are mainly as follows:

(1) the in vitro detection of an in vitro cell-free system is converted into the intracellular detection, the tedious work such as cell breakage is not needed, the detection result can be obtained within one day, the fluorescence data capable of preliminarily reacting the activity of the in vitro cell-free protein synthesis system can be obtained more conveniently and rapidly, the time and labor cost are reduced, the screening efficiency is improved, and the method can also be used for high-throughput experimental screening.

(2) A novel chemiluminescence protein luciferase NanoLuc (NLuc for short) gene is selected as a reporter gene, the luciferase is luciferase, a corresponding substrate of the luciferase generates glow-type signals under the action of the luciferase, the signal intensity of the luciferase is 100 times that of traditional luciferases (Firefly luciferase and Renilla luciferase), and the signals are more durable, so that the detection process is more sensitive.

(3) The site with stable transcription strength is selected as the integration site of the reporter gene and is not or hardly regulated by factors such as environment and the like. In particular, housekeeping genes are constitutively expressed and are fairly stable and not susceptible to environmental influences.

Drawings

FIG. 1 is a schematic diagram of a method for expressing a luminescent reporter gene in a cell to reflect the activity of an in vitro cell-free protein synthesis system.

FIG. 2A schematic map of plasmid pKMcas9- β tubulin-gRNA 1.

FIG. 3pCas9-53nluc plasmid map schematic.

FIG. 4 is a schematic map of pKMD 1-beta tubulin-53nluc plasmid.

FIG. 5 shows the comparison of intracellular luminescence signal intensity (a) and in vitro cell-free protein synthesis system activity (b) of three strains of TNL1, TNL2 and TNL3 and the comparison of in vitro cell-free protein synthesis system activity (c) of three strains of KM3A, KMG5 and KMP 9.

FIG. 6A schematic map of pKMcas9-TPK1-gRNA plasmid.

FIG. 7 is a schematic map of plasmid pKMD1-TPK 1-S237D.

FIG. 8 is a map of plasmid pKMcas9-EDC3-gRNA 1.

FIG. 9 is a map of plasmid pKMcas9-EDC3-gRNA 2.

FIG. 10 is a plasmid map of pKMD1-EDC 3-KO.

FIG. 11 is a graph showing comparison of intracellular luminescence signal intensity (a) and in vitro cell-free protein synthesis system activity (b) of three strains, namely YNL1, L2T4 and L2E1, and in vitro cell-free protein synthesis system activity (c) of three strains, namely Y1140, TPK1S237D and delta Edc 3.

Detailed Description

In the present invention, "in vitro cell-free protein synthesis system", "in vitro protein synthesis system", "cell-free in vitro protein expression system", "in vitro protein synthesis system", "protein in vitro synthesis system", "in vitro translation system", "in vitro protein expression system", "CFPS" and the like are used to describe the same meanings.

In the invention, the original strain can be used as an original strain, and the original strain is a strain which is not subjected to any genetic modification.

The activity of the cell-free protein synthesis system referred to in the invention refers to the ability of the cell-free protein synthesis system to synthesize foreign proteins when the cell-free protein synthesis system is used for foreign protein synthesis, and can be represented by the concentration, yield and the like of the foreign proteins, and also can be represented by any detectable signal value related to the yield of the foreign proteins; for example, when the foreign protein is a fluorescent protein, it can be expressed by relative fluorescence unit value (RFU).

In the invention, the luminescence reporter gene refers to a gene integrated into the genome of a strain, the gene can be transcribed and translated into a reporter protein in a cell, and the luminescence of the reporter protein can be detected by a laboratory instrument or directly observed by naked eyes. Such as luciferase gene, various fluorescent protein genes, etc., are transcribed and translated to obtain luciferase or fluorescent protein, which can be reacted to emit light signal directly or in combination, and the intensity (or value) of the light signal can be detected.

In the case of luciferase, the luminescence signal intensity (or luminescence value) refers to the luminescence signal intensity (or luminescence value) detected during the reaction of luciferase with its specific substrate. In the case of fluorescent proteins, the intensity (or value) of the luminescent signal refers to the intensity (or value) of fluorescence detected when the fluorescent protein molecule is excited (e.g., photoexcited) to emit fluorescence.

Although NLuc luciferases have a good advantage over other luciferases, the possibility of other luciferases as reporter proteins is not excluded. The reporter protein expressed from the intracellular luminescent reporter gene is not limited to NLuc luciferase, but other luciferases such as Firefoy luciferase and Renilla luciferase, or various Fluorescent Proteins such as Cyan Fluorescent protein (Blue Fluorescent Proteins), enhanced Green Fluorescent protein eGFP, Green Fluorescent protein (Green Fluorescent Proteins), Yellow Fluorescent protein (Yellow Fluorescent Proteins), Blue Fluorescent protein (Blue Fluorescent Proteins), Orange Fluorescent protein (Orange Fluorescent Proteins), Red Fluorescent protein (Red Fluorescent Proteins), etc. may be used, and specifically, the Fluorescent protein may be selected from Emerald, Superfolder GFP, Azami Gr, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Hire, EB 2, Aegzue, ECCyagCy, Ecnamtp, Ecnaxate, Ecnaarbor, Ecnaxate, Tangana Tosanye, Tangyfp, Tangp 6335, Oripyfp, Oripp, Oripase, or the like, DsRed, mTangerine, mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, mPlum, AQ143, moxTerlean 3, AmCyan1, MiCy, mEGFP, Clover, mVenus, mEOS3.2, mKO2, TurboRFP, tdTomato, mCardet-I, eqFP611, mKate1.3, mNeptune2, miRFP670, mTagBFP2, PAmCheerry, mAmmetrine, Azami Green, and the like.

In the present invention, a gene having a relatively stable transcription strength is selected as a site gene for integration of a reporter gene, and it is preferable to select a housekeeping gene which is not easily affected by the environment because the housekeeping gene is constitutively expressed and is relatively stable. Further preferably, the housekeeping gene is selected from the group consisting of actin (actin) gene, tubulin (tubulin) gene, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene, ribosomal protein gene, which are frequently used as internal references in western-blot and real-time PCR techniques. Preferably, the site of the beta tubulin (beta tubulin) gene with the lower transcription level is used as the site for integrating the luminescent reporter gene. The locus gene with relatively high transcription level is also suitable for the technical scheme of the invention.

In the present invention, the upstream 5 ' end sequence element and the downstream 3 ' end sequence element of the luminescence reporter gene can play a role in regulating and controlling the expression of the gene, the upstream 5 ' end sequence element can include a promoter, a 5 ' UTR (5 ' untranslated region) and other regulating or connecting elements, and the downstream 3 ' end sequence element can include a 3 ' UTR (3 ' untranslated region, 3 ' UTR includes a terminator sequence). Preferably, the 5 'untranslated region of the luminescent reporter gene has the same polynucleotide sequence as the 5' untranslated region of the DNA template of the foreign protein in the in vitro cell-free protein synthesis system. Preferably, the 3 'untranslated region of the luminescent reporter gene has the same polynucleotide sequence as the 3' untranslated region of the DNA template of the foreign protein in the in vitro cell-free protein synthesis system. Further preferably, at least a portion of the 5 'sequence element of the luminescent reporter gene has a polynucleotide sequence identical to the 5' end of the DNA template for the foreign protein in the in vitro cell-free protein synthesis system. Further preferably, at least a portion of the 3 'sequence element of the luminescent reporter gene has a polynucleotide sequence identical to the 3' end of the DNA template for the foreign protein in the in vitro cell-free protein synthesis system.

According to the invention, a strain which is not inserted with a reporter gene and is subjected to other gene modification is taken as a basic strain, a luminescent reporter gene is further integrated at the 5 'end and/or the 3' end of a housekeeping gene in the genome of the strain, and a luminescent signal is detected after amplification culture, so that the activity of an in-vitro cell-free protein synthesis system of the basic strain, even the in-vitro exogenous protein synthesis capacity of the basic strain, is evaluated. More suitably, the method comprises the steps of taking a strain with luminescent reporter genes integrated at the 5 'end and/or the 3' end of housekeeping genes in a genome as an initial strain, carrying out various genetic modifications on the basis, detecting the luminescent signal intensity after cell culture, and evaluating the influence of various genetic modifications of the corresponding initial strain on the activity of a cell-free protein synthesis system and the cell protein synthesis capacity, namely reflecting the activity of the cell-free protein synthesis systems of various genetically modified strains or the cell-free protein synthesis capacities of various genetically modified strains.

The technical scheme of the invention can be applied to various strains, including but not limited to escherichia coli, yeast and the like, wherein the yeast can be saccharomyces cerevisiae, pichia pastoris, kluyveromyces and the like, and the kluyveromyces lactis, kluyveromyces marxianus and the like. The embodiments of the present invention can also be applied to various cell lines, including but not limited to mammalian cells (e.g., HF9, Hela, CHO, HEK293), wheat germ cells, rabbit reticulocytes, insect cells, and the like.

In the present invention, the in vitro cell-free protein synthesis system is not particularly limited, and is often differentiated by the source of cell extract or cell lysate, which may be escherichia coli, wheat germ cells, rabbit reticulocytes, insect cells, mammalian cells, yeast cells, etc.; one preferred cell-free protein synthesis system is an in vitro yeast (e.g., Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces lactis, etc.), preferably an in vitro Kluyveromyces lactis, and more preferably an in vitro Kluyveromyces lactis protein synthesis system.

Yeast (yeast) combines the advantages of simple culture, efficient protein folding, and post-translational modification. Wherein, the Saccharomyces cerevisiae (Saccharomyces cerevisiae) and the Pichia pastoris (Pichia pastoris) are model organisms for expressing complex eukaryotic proteins and membrane proteins, and the yeast can also be used as a raw material for preparing an in vitro translation system.

Kluyveromyces (Kluyveromyces) is a species of ascosporogenous yeast, of which Kluyveromyces marxianus and Kluyveromyces lactis (Kluyveromyces lactis) are industrially widely used. In comparison with other yeasts, kluyveromyces lactis has many advantages such as superior secretion ability, better large-scale fermentation characteristics, a level of food safety, and the ability to modify proteins post-translationally.

The in vitro cell-free protein synthesis system of the invention comprises: cell extracts or cell lysates, substrates for protein synthesis, substrates for RNA synthesis, and DNA templates encoding foreign proteins.

Preferably, the protein synthesis system further comprises one or more components of the group consisting of: an energy regeneration system, polyethylene glycol, magnesium ions, potassium ions, a buffer, RNA polymerase, an antioxidant, optionally an aqueous solvent.

In the present invention, the content and purity of the cell extract or cell lysate are not particularly limited. Preferably, the concentration (v/v) of the cell extract or cell lysate is 20% to 70%, preferably 30% to 60%, more preferably 40% to 50%, based on the total volume of the protein synthesis system.

In the present invention, the cell extract does not contain intact cells, and typical cell extracts include various types of RNA polymerases required for RNA synthesis, ribosomes for protein translation, transfer RNAs, aminoacyl tRNA synthetases, initiation and elongation factors required for protein synthesis, and termination and release factors. In addition, the cell extract also contains some other proteins, especially soluble proteins, which originate from the cytoplasm of the cell.

In the present invention, the preparation method of the cell extract is not limited, and a preferred preparation method comprises the steps of:

(i) providing a cell;

(ii) washing the cells to obtain washed cells;

(iii) performing cell disruption treatment on the washed cells, thereby obtaining a crude cell extract;

(iv) and carrying out solid-liquid separation on the cell crude extract to obtain a liquid part, namely the cell extract.

In the present invention, the solid-liquid separation method is not particularly limited, and a preferable method is centrifugation.

In a preferred embodiment, the centrifugation is carried out in the liquid state.

In the present invention, the centrifugation conditions are not particularly limited, and one preferable centrifugation condition is 5000-.

In the present invention, the centrifugation time is not particularly limited, and a preferable centrifugation time is 0.5min to 2 h, preferably 20min to 50 min.

In the present invention, the temperature of the centrifugation is not particularly limited, and it is preferable that the centrifugation is performed at 1 to 10 ℃, preferably, 2 to 6 ℃.

In the present invention, the washing treatment is not particularly limited, and a preferable washing treatment is a treatment with a washing solution at a pH of 7 to 8 (preferably, 7.4), the washing solution is not particularly limited, and typically the washing solution is selected from the group consisting of: 4-hydroxyethyl piperazine potassium ethanesulfonate, potassium acetate, magnesium acetate or their combination.

In the present invention, the manner of the cell disruption treatment is not particularly limited, and a preferable cell disruption treatment includes high-pressure disruption, freeze-thawing (e.g., liquid nitrogen low-temperature disruption).

In another preferred embodiment, the energy regeneration system is a system capable of generating ATP, including but not limited to: creatine phosphate and phosphocreatine enzyme systems, glycolysis pathway and its intermediate energy systems, polysaccharide and phosphate energy systems, or combinations thereof. Further, the polysaccharide is selected from starch and dextrin; the phosphate is selected from orthophosphate, dihydrogen phosphate, metaphosphate, pyrophosphate or their combination.

Further, the cell extract is an aqueous extract of cells.

Further, the cell extract does not contain endogenous long-chain nucleic acid molecules.

Further, the substrate for synthesizing RNA comprises: one of nucleoside monophosphate, nucleoside triphosphate or a combination thereof.

Further, the substrate of the synthetic protein comprises: 20 natural amino acids and non-natural amino acids.

Further, the antioxidant is Dithiothreitol (DTT).

Further, the magnesium ions are derived from a magnesium ion source selected from the group consisting of: one or the combination of magnesium acetate and magnesium glutamate.

Further, the potassium ion is derived from a potassium ion source selected from the group consisting of: one or the combination of potassium acetate and potassium glutamate.

Further, the buffer is selected from the group consisting of: 4-hydroxyethyl piperazine ethanesulfonic acid, tris (hydroxymethyl) aminomethane or a combination thereof.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. In the description of the embodiments, the concentrations of the nucleoside triphosphate mixture and the amino acid mixture refer to the concentration of a single substance in the mixture, not the total substance in the mixture. In the examples, kluyveromyces lactis is taken as an example for testing, but the test is not only applicable to kluyveromyces lactis, and the experimental design, technical idea and technical scheme of the present invention can be applied to other eukaryotic cells (such as plant cells, other yeast cells, insect cells, animal cells, etc.) and prokaryotic cells (such as escherichia coli cells). Transcriptome analysis was performed on wild-type Kluyveromyces lactis NRRL Y-1140 (Y1140) to obtain the transcription level data of most genes, including actin (actin) gene, beta tubulin (beta tubulin) gene, alpha tubulin (alpha tubulin) gene, ribosomal protein gene, GAPDH1, and GAPDH2 (both glyceraldehyde-3-phosphate dehydrogenase) genes. In the embodiment, the downstream of the beta tubulin gene with relatively low transcription level is selected as the integration site of the Nluc gene, so that the intensity of the measured luminescent signal is obviously enhanced when the intracellular expression of the Nluc protein is improved. However, this does not mean that the solution can only be used for gene loci with low transcription levels, and the solution of the present invention is equally applicable to any other housekeeping gene locus with stable transcription levels.

Example 1

1.1 determination of CRISPR gRNA sequence

The principle of gRNA selection in this example is: near the 3' end of the β tubulin gene, the GC content is moderate (40% -60%), avoiding the presence of poly T structures. In this example, β tubulin gRNA1 has sequence CAGTAGCATCTTGATATTGT.

The plasmid construction and transformation method is as follows: primers pCas9- β tubulin-gRNA1-PF were used: CAGTAGCATCTTGATATTGTGTTTTAGAGCTAGAAATAGC and pCas9- β tubulin-gRNA 1-PR: ACAATATCAAGATGCTACTGGATTCGAACTGCCGAGAAAGTAAC, PCR amplification was performed using the pCAS plasmid as a template. mu.L of the amplification product was taken, 1. mu.L of Dpn I and 2. mu.L of 10 Xdigestion buffer were added, and mixed well and incubated at 37 ℃ for 3 hours. Adding 10 μ L of the product after the Dpn I treatment into 50 μ L of DH5 alpha competent cells, standing on ice for 30min, thermally shocking at 42 ℃ for 45s, adding 1mL of LB liquid culture medium, performing shake culture at 37 ℃ for 1h, coating on Kan-resistant LB solid culture medium, and performing inversion culture at 37 ℃ until single clones grow out. 2 single clones were selected and cultured in LB liquid medium with shaking, after PCR detection positive and sequencing confirmation, the plasmid was extracted and stored, named pKMcas9- β tubulin-gRNA1 (FIG. 2).

1.2 construction of the Donor plasmid pKMD 1-beta tubulin-53nluc

Taking pMD18T plasmid as a template, and primer pMD 18T-PF: ATCGTCGACCTGCAGGCATG and pMD 18T-PR: ATCTCTAGAGGATCCCCGGG PCR amplification, taking 17. mu.L of amplification product, adding 1. mu.L DpnI and 2. mu.L 10 Xdigestion buffer, mixing evenly, and then water bathing at 37 ℃ for 3h to obtain the plasmid backbone linear fragment pMD 18T-vector.

Using K.lactis genomic DNA as a template, and using a primer beta tubulin-HR 1-PF: GGTATGGGTACTTTGTTGATCTC and β tubulin-gRNA 1-m-PR: CTTCAACTGTTGCGTCCTGGTACTGCTGATATTCACTTACTAAGTCATTC PCR amplification, the product name is beta tubulin-HR 1-L; using k.lactis genomic DNA as a template, with primers β tubulin-gRNA 1-m-PF: GTGAATATCAGCAGTACCAGGACGCAACAGTTGAAGATGACGAAGAATT G and β tubulin-HR 1-PR: TTACTCGAAGTTTTCAGCCA PCR amplification, the product is named as beta tubulin-HR 1-R; using pCas9-53nluc plasmid (as shown in FIG. 3, pCas9 is a plasmid backbone which only functions to form a loop with 53nluc, 53nluc is an insert, and the structure thereof sequentially comprises a T7 promoter, 5 'UTR, nluc coding frame, 3' UTR, and nluc coding frame sequence which can be found in the website of Promega corporation) as a template, a primer β tubulin-53 nluc-PF: GAACAACCAATGGCTGAAAACTTCGAGTAAGGCGTAGAGGATCGAGATC T and primer β tubulin-53 nluc-PR: TTTTCCTGCTGAAGTTTTCCTTTATATTCTATCCGGATATAGTTCCTCCT PCR amplification, the product name is 53nluc (nucleotide sequence shown in SEQ ID NO: 1); using K.lactis genomic DNA as a template, and using a primer beta tubulin-HR 2-PF: AGAATATAAAGGAAAACTTC and β tubulin-HR 2-PR: GATCAGTTACTGGCGAGTTCTCC was subjected to PCR amplification and the product was named β tubulin-HR 2.

mu.L of each of the amplification products, beta tubulin-HR1-L, beta tubulin-HR1-R, beta tubulin-HR2, 53nluc, and pMD18T-vector, was added to 5. mu.L of Cloning Mix, and the mixture was mixed and incubated at 50 ℃ for 1 hour in a water bath. After the water bath is finished, placing the mixture on ice for 2min, adding 10 mu L of reaction solution into 50 mu L of Trans-T1 competent cells, placing the mixture on ice for 30min, carrying out heat shock at 42 ℃ for 30s, adding 1mL of LB liquid culture medium, carrying out shake culture at 37 ℃ for 1h, coating the mixture on Amp resistance LB solid culture, and carrying out inversion culture at 37 ℃ until single clones grow out. 6 single clones were selected and cultured in LB liquid medium with shaking, and after positive PCR detection and sequencing confirmation, the plasmid was extracted and stored, and named pKMD1- β tubulin-53nluc (FIG. 4).

1.3 electrotransformation of Kluyveromyces lactis

Respectively making K.lactis strains (respectively named as KM3A, KMG5 and KMP9) with different genotypes into electrotransformation competence, adding 400ng of pKMCs 9-beta tubulin-gRNA1 plasmid and 1000ng of beta tubulin-53nluc fragment (plasmid pKMD 1-beta tubulin-53nluc as a template, performing PCR amplification by using a primer beta tubulin-PF-N1: CGTTGTAGAACCATACAATG and a primer beta tubulin-PR-N1: CCGTCCGACATCCTAGATTG to obtain a beta tubulin-53nluc fragment, wherein the nucleotide sequence of the fragment is shown in SEQ ID NO: 2), mixing uniformly, transferring the mixture into an electric shock cup, and performing ice bath for 2 min; putting the electric shock cup into an electric rotating instrument for electric shock (the parameters are 1.5kV, 200 omega and 25 muF); immediately adding 700 mu L YPD after the electric shock is finished, and incubating for 3h by a shaking table at 30 ℃ and 200 rpm; 100 μ L of the suspension was spread on YPD (containing G418 resistance) plates and cultured at 30 ℃ for 1 to 2 days until single colonies appeared.

1.4 Positive identification

12-24 single clones were picked from the plates after cell transformation, and the cells were used as templates, and the identification primers β tubulin-CF: CATTTTCGGTCAATCTTCAG and β tubulin-CR: CTAATGAAGAACTTGGCATG PCR detection was performed on the samples. The cell lines which are positive in PCR result and identified by sequencing are determined to be positive cell lines and are named as TNL1, TNL2 and TNL3 respectively.

1.5 detection of Nluc luminescence Signal intensity in TNL1, TNL2, TNL3

The three strains of TNL1, TNL2 and TNL3 were transferred to a test tube containing 4mLYPD medium to make the initial OD600 consistent, and cultured at 30 ℃ for about 18 h. After OD600 of the bacterial liquid is measured respectively, the bacterial liquid is diluted by 20 times by using D-PBS buffer solution, 10 mu L of the diluted bacterial liquid is added into a hole of a white enzyme label plate after being mixed uniformly, and each strain is used as three parallel samples. 10 μ L of a working concentration of substrate furimazine (furimazine purchased from Promega, CAS No.1374040-24-0, in D-PBS buffer) was added simultaneously to each well and immediately read in a microplate reader, and the results of the ratio of fluorescence to OD are shown in FIG. 5 a.

1.6 in vitro cell-free protein Synthesis System Synthesis of foreign proteins

Meanwhile, the cell-free protein synthesis activities of the six k.lactis strains (designated as KM3A, KMG5, KMP9, TNL1, TNL2, and TNL3, respectively) with different genotypes were measured by an in vitro protein synthesis reaction system according to the conventional CFPS.

The in vitro protein synthesis reaction system used was: trimethylolaminomethane (Tris-HCl) at a final concentration of 9.78mM at pH 8.0, 80mM potassium acetate, 5.0mM magnesium acetate, 1.5mM nucleoside triphosphate mixture (adenosine triphosphate, guanosine triphosphate, cytosine nucleoside triphosphate and uridine triphosphate, each at a concentration of 1.5mM), 0.7mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine, each at a concentration of 0.7mM), 1.7mM Dithiothreitol (DTT), 2% polyethylene glycol, 15mM glucose, 24mM tripotassium phosphate, 50% by volume yeast cell extract (six cell extracts from KM3A, respectively, KMG5, KMP9, TNL1, TNL2 and TNL3 strains), and 15 ng/. mu.L enhanced green fluorescent protein DNA template (the upstream 5' end sequence of the coding sequence of the green fluorescent protein in the DNA template is shown as SEQ ID NO: 3, and the downstream 3' end sequence is shown as SEQ ID NO: shown at 4).

In vitro protein synthesis reaction conditions: the reaction system was mixed well and allowed to stand at room temperature (20-30 ℃ C.) for 20 hours.

And (3) fluorescence value determination: the samples to be tested were placed in an Envision 2120 multifunctional microplate reader (Perkin Elmer), and the Relative Fluorescence Unit (RFU) value was obtained by detection, and the RFU value indicates the activity of the cell-free protein synthesis system, and the results are shown in fig. 5b and 5 c.

As can be seen from fig. 5, the luminescence reporter values (fig. 5a) of the three strains TNL1, TNL2, and TNL3 containing the NanoLuc gene are positively correlated with the activity (fig. 5b and 5c) of the in vitro cell-free protein synthesis system.

Example 2

2.1 construction of the Strain YNL1

With reference to the procedure of example 1.3, a wild-type Kluyveromyces lactis NRRL Y-1140 (abbreviated as Y1140) was transformed into competent cells, and positive identification was performed with reference to the procedure of example 1.4, and the obtained positive cell line was designated YNL 1.

2.2 determination of CRISPR gRNA sequence

Experiments in the applied patent (patent application number: 2018114520758) show that S237D modification of TPK1 gene in K.lactis (the obtained strain is TPK1S237D) can improve CFPS activity, and by searching PAM sequence (NGG) near the S237 residue, the corresponding gRNA is determined to cut to cause double-strand break, and the selection principle of the gRNA is as follows: the GC content is moderate (40% -60%), and the existence of a poly T structure is avoided. Finally, the gRNA sequence of TPK1 in this example was GTCTCAAAGGTTCCCAAACC.

The primers used were TPK 1-gRNA-PF: GTCTCAAAGGTTCCCAAACCGTTTTAGAGCTAGAAATAGC and primer TPK 1-gRNA-PR: GGTTTGGGAACCTTTGAGACGATTCGAACTGCCGAGAAAGTAAC are provided. PCR amplification was performed using the pCAS plasmid as a template. Taking 17 mu L of amplification product, adding 0.2 mu L of Dpn I and 2 mu L of 10 Xdigestion buffer, mixing uniformly, and then bathing in water at 37 ℃ for 3 h. Adding 10 mu L of the product after the Dpn I treatment into 50 mu L of DH5 alpha competent cells, standing on ice for 30min, after heat shock for 45s at 42 ℃, adding 1mL of LB liquid culture medium, performing shake culture at 37 ℃ for 1h, coating on Kan resistant LB solid culture medium, and performing inversion culture at 37 ℃ until a single clone grows out. 2 single clones were selected and cultured in LB liquid medium with shaking, after PCR detection positive and sequencing confirmation, plasmids were extracted and stored, named pKMcas9-TPK1-gRNA (FIG. 6).

2.3 construction of the donor plasmid pKMD1-TPK1-S237D

Taking pMD18T plasmid as a template, and primer pMD 18T-PF: ATCGTCGACCTGCAGGCATG and pMD 18T-PR: ATCTCTAGAGGATCCCCGGG PCR amplification, taking 17. mu.L of amplification product, adding 1. mu.L DpnI and 2. mu.L 10 Xdigestion buffer, mixing evenly, and then water bathing at 37 ℃ for 3h to obtain the plasmid backbone linear fragment pMD 18T-vector.

Taking K.lactis genomic DNA as a template, and carrying out reaction by using a primer KlTPK1-HR 1-PF: GAGCTCGGTACCCGGGGATCCTCTAGAGATGAACCGCTATATCTTGCATG and KlTPK 1-mutant-PR: GACTGGATTAGGAAAACGCTGGTCTTTCCTTAAAAGAGAGAATAG PCR amplification, the product name is TPK1-HR 1;

using K.lactis genomic DNA as a template, and using a primer KlTPK 1-mutant-PF: AAGGAAAGACCAGCGTTTTCCTAATCCAGTCGCGAAGTTTTATGCAGCAG and KlTPK1-HR 2-PR: GCATGCCTGCAGGTCGACGATTAACGGCAGCGTTTCTGAAG PCR amplification, the product name is TPK1-HR 2;

mu.L each of the amplification products TPK1-HR1, TPK1-HR2 and pMD18T-vector was added to 3. mu.L of Cloning Mix (Transgene pEASY-Uni nucleic Cloning and Assembly Kit, all-purpose gold, infra), and the mixture was mixed in water bath at 50 ℃ for 1 hour. Placing on ice for 2min after the water bath is finished, adding 6 mu L of reaction liquid into 50 mu L of Trans-T1 competent cells, placing on ice for 30min, performing heat shock at 42 ℃ for 30s, adding 1mL of LB liquid culture medium, performing shake culture at 37 ℃ for 1h, coating on Amp resistant LB solid culture, and performing inversion culture at 37 ℃ until single clones grow out. 6 single clones were picked and cultured in LB liquid medium with shaking, and after positive PCR detection and confirmation of sequencing, the plasmid was extracted and stored, and named pKMD1-TPK1-S237D (FIG. 7).

2.4 electrotransformation of Kluyveromyces lactis

The YNL1 strain obtained in example 2.1 is made into electrotransformation competence, 400ng gRNA & Cas9 plasmid (or gRNA/Cas9 fragment) and 1000ng donor DNA fragment (plasmid pKMD1-TPK1-S237D are taken as template, PCR amplification is carried out by using primer KlTPK1-HR1-PF and primer KlTPK1-HR2-PR to obtain donor DNA fragment, the nucleotide sequence is shown as SEQ ID NO: 5), all the donor DNA fragments are transferred into an electric shock cup after mixing evenly, and ice bath is carried out for 2 min; putting the electric shock cup into an electric rotating instrument for electric shock (the parameters are 1.5kV, 200 omega and 25 muF); immediately adding 700 mu L of YPD after the electric shock is finished, and incubating for 1-3 h by using a shaking table at 30 ℃ and 200 rpm; 2-200. mu.L of the suspension was inoculated onto YPD (containing G418 resistance) plates and cultured at 30 ℃ for 2-3 days until single colonies appeared.

2.5 Positive identification

12-24 monoclonals were picked from the transformed plates, and the cells were used as templates, and the DNA fragments were analyzed by using the identifying primers F: AGTCTCAAAGGTTCCCAAAC and R: ATAAGATTATTGCATCGAGC PCR detection was performed on the samples. The negative strain had no PCR band. The cell strain which is positive in PCR result and identified by sequencing through a primer pair F: GGGTATTTCGAATAAGGGAC, R: ATAAGATTATTGCATCGAGC is determined to be a positive cell strain and is named as L2T 4.

Example 3

3.1 determination of CRISPR gRNA sequence

Experiments in the filed patent (patent application No. 2018116083534) showed that the knockout of EDC3 gene in k.lactis (the strain obtained was Δ EDC3) could improve CFPS activity, and the principle of gRNA selection in this example was: near the ends of the interior of the EDC3 gene, the GC content was moderate (40% -60%), avoiding the presence of poly T structures. In this example, the EDC3gRNA1 sequence was TCAAATTGAGATCGAATTGA, EDC3gRNA2 sequence GGACATATACCCGGGTTTCT.

The plasmid construction and transformation method is as follows: primers pCas9-EDC3-gRNA1-PF were used: TCAAATTGAGATCGAATTGAGTTTTAGAGCTAGAAATAGC and pCas9-EDC3-gRNA 1-PR: TCAATTCGATCTCAATTTGAGATTCGAACTGCCGAGAAAGTAAC, PCR amplification was performed using pCAS plasmid as a template. Taking 17 mu L of amplification product, adding 1 mu L of Dpn I and 2 mu L of 10 Xdigestion buffer, mixing uniformly, and then bathing at 37 ℃ for 3 h. Adding 10 μ L of the product after the Dpn I treatment into 50 μ L of DH5 alpha competent cells, standing on ice for 30min, thermally shocking at 42 ℃ for 45s, adding 1mL of LB liquid culture medium, performing shake culture at 37 ℃ for 1h, coating on Kan-resistant LB solid culture medium, and performing inversion culture at 37 ℃ until single clones grow out. 2 single clones were picked and shake-cultured in LB liquid medium, PCR was performed to detect positive and after confirmation of sequencing, a plasmid was extracted and stored, and named pKMcas9-EDC3-gRNA1 (FIG. 8).

Similarly, primers pCas9-EDC3-gRNA2-PF were used: GGACATATACCCGGGTTTCTGTTTTAGAGCTAGAAATAGC and pCas9-EDC3-gRNA 2-PR: AGAAACCCGGGTATATGTCCGATTCGAACTGCCGAGAAAGTAAC, the constructed plasmid was named pKMcas9-EDC3-gRNA2 (FIG. 9).

3.2 construction of the donor plasmid pKMD1-EDC3-KO

Taking K.lactis genomic DNA as a template, and performing amplification reaction by using primers EDC3-HR 1-PF: GGTAGCTCCAATAATCCAAG and EDC3-HR 1-PR: ACACATCTATCTTTACAGATATAAGTCAAAAGTGACTTGTTCTATAAACT PCR amplification, the product name is EDC3-HR 1; taking K.lactis genomic DNA as a template, and performing amplification reaction by using primers EDC3-HR 2-PF: AGAAGCTATAAGTTTATAGAACAAGTCACTTTTGACTTATATCTGTAAAG and EDC3-HR 2-PR: AACTCCAACAACGACGTCAC PCR amplification was performed, the product was named EDC3-HR 2.

mu.L of each of the amplification products EDC3-HR1, EDC3-HR2 and pMD18T-vector was added to 3.5. mu.L of Cloning Mix and 0.5. mu.L of water, and the mixture was mixed and then washed with water at 50 ℃ for 1 hour. After the water bath is finished, placing the mixture on ice for 2min, adding 10 mu L of reaction solution into 50 mu L of Trans-T1 competent cells, placing the mixture on ice for 30min, carrying out heat shock at 42 ℃ for 30s, adding 1mL of LB liquid culture medium, carrying out shake culture at 37 ℃ for 1h, coating the mixture on Amp resistance LB solid culture, and carrying out inversion culture at 37 ℃ until single clones grow out. 6 single clones were picked and cultured in LB liquid medium with shaking, and after positive PCR detection and confirmation of sequencing, the plasmid was extracted and stored, and designated pKMD1-EDC3-KO (FIG. 10).

3.3 electrotransformation of Kluyveromyces lactis

The YNL1 strain obtained in example 2.1 is made into electrotransformation competence, pKMas 9-EDC3-gRNA1 plasmid and pKMas 9-EDC3-gRNA2 plasmid are added for 200ng each, 1000ng of EDC3-KO fragment (obtained by PCR amplification with the plasmid pKMD1-EDC3-KO as a template and primers EDC3-HR1-PF and EDC3-HR2-PR, and the nucleotide sequences are shown in SEQ ID NO: 6) fragments are added, mixed uniformly and then all transferred into a shock cup to be iced for 2 min; putting the electric shock cup into an electric rotating instrument for electric shock (the parameters are 1.5kV, 200 omega and 25 muF); immediately adding 700 mu L YPD after the electric shock is finished, and incubating for 3h by a shaking table at 30 ℃ and 200 rpm; 100 μ L of the suspension was spread on YPD (containing G418 resistance) plates and cultured at 30 ℃ for 1 to 2 days until single colonies appeared.

3.4 Positive identification

12-24 single clones were picked from the transformed plates, and the cells were used as templates, and the identification primers EDC3-CF: CGAATCAAACGTTAAACATC and EDC 3-CR: AGAAATTCCCATTTCCATTG PCR detection was performed on the samples. The cell strain which is positive in PCR result and identified by sequencing is determined to be a positive cell strain and is respectively named as L2E 1.

Example 4

4.1 Nluc fluorescence measurements of YNL1, L2T4, L2E1

YNL1 strain obtained in example 2.1, L2T4 strain obtained in example 2, and L2E1 strain obtained in example 3 were each transferred to a test tube containing 4mL of YPD medium with the same initial OD600 and cultured at 30 ℃ for about 18 hours. After OD600 of the bacterial liquid is measured respectively, the bacterial liquid is diluted by 20 times by using D-PBS buffer solution, 10 mu L of the diluted bacterial liquid is added into a hole of a white enzyme label plate after being mixed uniformly, and each strain is used as three parallel samples. 10 μ L of a working concentration of substrate furimazine (furimazine purchased from Promega, CAS No.1374040-24-0, in D-PBS buffer) was added simultaneously to each well and immediately read in a microplate reader, and the results of the ratio of fluorescence to OD are shown in FIG. 11 a.

4.2 in vitro Synthesis of foreign proteins by cell-free protein Synthesis System

Meanwhile, the cell-free protein synthesis activity of each of the six strains (YNL1, L2T4, L2E1, and Y1140, TPK1S237D, Δ Edc3) was measured in an in vitro protein synthesis reaction system according to a conventional CFPS.

The in vitro protein synthesis reaction system used was: tris (Tris-HCl) at a final concentration of 9.78mM pH 8.0, potassium acetate 80mM, magnesium acetate 5.0mM, a mixture of 1.5mM nucleoside triphosphates (adenosine triphosphate, guanosine triphosphate, cytosine triphosphate and uridine triphosphate, each at a concentration of 1.5mM), an amino acid mixture of 0.7mM (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine, each at a concentration of 0.7mM), 1.7mM threitol (DTT), 2% polyethylene glycol, 15mM glucose, 24mM tripotassium phosphate, 50% by volume yeast cell extracts (six cell extracts from YNL1, respectively, above, L2T4, L2E1, Y1140, TPK1S237D and delta Edc3, 15 ng/. mu.L enhanced green fluorescent protein DNA template (the upstream sequence of the coding sequence of the green fluorescent protein in the DNA template is shown as SEQ ID NO: 3, and the downstream sequence is shown as SEQ ID NO: shown at 4).

In vitro protein synthesis reaction conditions: the reaction system was mixed well and allowed to stand at room temperature (20-30 ℃ C.) for 20 hours.

And (3) fluorescence value determination: the samples to be tested were placed in an Envision 2120 multifunctional microplate reader (Perkin Elmer), and the Relative Fluorescence Unit (RFU) value was obtained by detection, and the RFU value indicates the activity of the cell-free protein synthesis system, and the results are shown in fig. 11b and 11 c.

As can be seen from FIG. 11, the luminescence reporter values (FIG. 11a) of the NanoLuc gene-containing three strains YNL1, L2T4 and L2E1 were positively correlated with the activity of the in vitro cell-free protein synthesis system (FIG. 11b and FIG. 11 b).

As shown in fig. 5 and 11, according to the technical scheme of the present invention, the activity of the cell-free protein synthesis system of the genetically modified strain can be reflected by integrating a luminescent reporter gene (e.g., Nluc gene) into the genome of the strain and expressing the reporter gene in cells, that is, the expression level of the foreign protein in the cell-free protein synthesis system, so that the detection of the activity of the cell-free protein synthesis system of the genetically modified strain is greatly facilitated.

All documents mentioned in this application are incorporated by reference in this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications can be made by those skilled in the art after reading the above disclosure, and equivalents also fall within the scope of the invention as defined by the appended claims.

Sequence listing

<110> Kangma (Shanghai) Biotechnology Co., Ltd

<120> method for reflecting in vitro cell-free protein expression level by integrating luminescent reporter gene

<130> 2019

<141> 2019-04-03

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1074

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

gaacaaccaa tggctgaaaa cttcgagtaa ggcgtagagg atcgagatct cgcgaaatta 60

atacgactca ctatagggaa aaaagaaatc tctcaagctg aaattaaacc aaaactctaa 120

tataagaaaa aaaaatagaa aggtattttt acaacaatta ccaacaacaa caaacaacaa 180

acaacattac aattactatt tacaattaca aaaaaaaaaa atggtcttca cactcgaaga 240

tttcgttggg gactggcgac agacagccgg ctacaacctg gaccaagtcc ttgaacaggg 300

aggtgtgtcc agtttgtttc agaatctcgg ggtgtccgta actccgatcc aaaggattgt 360

cctgagcggt gaaaatgggc tgaagatcga catccatgtc atcatcccgt atgaaggtct 420

gagcggcgac caaatgggcc agatcgaaaa aatttttaag gtggtgtacc ctgtggatga 480

tcatcacttt aaggtgatcc tgcactatgg cacactggta atcgacgggg ttacgccgaa 540

catgatcgac tatttcggac ggccgtatga aggcatcgcc gtgttcgacg gcaaaaagat 600

cactgtaaca gggaccctgt ggaacggcaa caaaattatc gacgagcgcc tgatcaaccc 660

cgacggctcc ctgctgttcc gagtaaccat caacggagtg accggctggc ggctgtgcga 720

acgcattctg gcgtaaataa ggattaatta cttggatgcc aataaaaaaa aaaaagcgac 780

atagccaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 840

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaacga actcgagcac caccaccacc 900

accactgaga tccggctgct aacaaagccc gaaaggaagc tgagttggct gctgccaccg 960

ctgagcaata actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc 1020

tgaaaggagg aactatatcc ggatagaata taaaggaaaa cttcagcagg aaaa 1074

<210> 2

<211> 2571

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

cgttgtagaa ccatacaatg ccactctatc tgtacaccaa ttagtcgaac acgctgatga 60

aactttctgt atcgataatg aagcccttta cgatatatgt caaactactc taaaattacc 120

acaaccagat tatgcgaact tgaaccattt agtttcaagt gtcatgtctg gtgtcactac 180

atccctacgt tacccaggtc aattgaactc agatctaaga aaattggccg tgaatttggt 240

gcccttccca agattacact tcttcatggt tggttatgct ccattaacct cgattggtgc 300

ccaatctttc agatccctat ctgtatcaga attgacccaa caaatgttcg attcaagaaa 360

tatgatggct gcatctgatc caagaaacgg aaggtacttg actgttgctg cattcttccg 420

tggtaaagta agcgtgaaag aagttgaaga tgaaatgcat aaggttcaaa ctagaaactc 480

gtcgtacttc gtagaatgga ttccaaacaa cgtgcaaaca gccgtctgtt ctgtacctcc 540

aaaggactta gacatgtctg ctactttcat tggtaactct acatccatcc aagaattatt 600

cagaagggtc ggagatcaat ttagtgttat gttcaagaag agagctttct tgcattggta 660

tactaatgaa ggtatggaag aaattgaatt ttctgaagct gaatctaaca tgaatgactt 720

agtaagtgaa tatcagcagt accaggacgc aacagttgaa gatgacgaag aattggaatt 780

cgttgacgaa caaccaatgg ctgaaaactt cgagtaaggc gtagaggatc gagatctcgc 840

gaaattaata cgactcacta tagggaaaaa agaaatctct caagctgaaa ttaaaccaaa 900

actctaatat aagaaaaaaa aatagaaagg tatttttaca acaattacca acaacaacaa 960

acaacaaaca acattacaat tactatttac aattacaaaa aaaaaaaatg gtcttcacac 1020

tcgaagattt cgttggggac tggcgacaga cagccggcta caacctggac caagtccttg 1080

aacagggagg tgtgtccagt ttgtttcaga atctcggggt gtccgtaact ccgatccaaa 1140

ggattgtcct gagcggtgaa aatgggctga agatcgacat ccatgtcatc atcccgtatg 1200

aaggtctgag cggcgaccaa atgggccaga tcgaaaaaat ttttaaggtg gtgtaccctg 1260

tggatgatca tcactttaag gtgatcctgc actatggcac actggtaatc gacggggtta 1320

cgccgaacat gatcgactat ttcggacggc cgtatgaagg catcgccgtg ttcgacggca 1380

aaaagatcac tgtaacaggg accctgtgga acggcaacaa aattatcgac gagcgcctga 1440

tcaaccccga cggctccctg ctgttccgag taaccatcaa cggagtgacc ggctggcggc 1500

tgtgcgaacg cattctggcg taaataagga ttaattactt ggatgccaat aaaaaaaaaa 1560

aagcgacata gccaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1620

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaacgaact cgagcaccac 1680

caccaccacc actgagatcc ggctgctaac aaagcccgaa aggaagctga gttggctgct 1740

gccaccgctg agcaataact agcataaccc cttggggcct ctaaacgggt cttgaggggt 1800

tttttgctga aaggaggaac tatatccgga tagaatataa aggaaaactt cagcaggaaa 1860

aaaaaaggaa taaggaacaa agatcagatg tgtacagaag ataagtttat cattttgaga 1920

gcagtaccac tgaaagcaaa ttatttggac acgagataaa caataaacaa tgtacttcag 1980

aaagatattt tctttcttct tatagttttc ctttcgttac ttctactatt ctaatactat 2040

tccccacacc actagtagaa gcggaaaatt tcgaaatatg ataccaccct tactataatt 2100

tatatgcttt ttgtttctct gctcaatgat atgtactatc aatgtgaccc aaaacatttc 2160

tttagtattt gtttctattt ttttttaata atatcatatc ttactacata attttagtct 2220

tcacattata atacgtgatt cttcatgata tatttgactc agatgtcaac acagtagtat 2280

gtgaatgttt caatgactta tcctcttccc caggcctgat caatcatttc acagatcaac 2340

gaaacatacc aagaacaaaa agaaataaat ttttcacaat agtacccgaa gaaaaaaatt 2400

aataaggaac taaactgatg tgaaatattg aactgaagct catctcccct ctcatctctc 2460

aaaaatagac caacaaccaa ggactaccag ttgatcagtc tacttggaat aggtgatata 2520

aaggtagcgg catgctcagg atatctagga ccaatctagg atgtcggacg g 2571

<210> 3

<211> 170

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

cgcgaaatta atacgactca ctatagggaa aaaagaaatc tctcaagctg aaattaaacc 60

aaaactctaa tataagaaaa aaaaatagaa aggtattttt acaacaatta ccaacaacaa 120

caaacaacaa acaacattac aattactatt tacaattaca aaaaaaaaaa 170

<210> 4

<211> 283

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ataaggatta attacttgga tgccaataaa aaaaaaaaag cgacatagcc aaaaaaaaaa 60

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 120

aaaaaaaaaa aaaaaaaaaa acgaactcga gcaccaccac caccaccact gagatccggc 180

tgctaacaaa gcccgaaagg aagctgagtt ggctgctgcc accgctgagc aataactagc 240

ataacccctt ggggcctcta aacgggtctt gaggggtttt ttg 283

<210> 5

<211> 1571

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

gaaccgctat atcttgcatg aggcaagacc tgcaaagaga agaaagatga gaccttttga 60

caacgaatcc aagggatttc tttctggccg aacagatcaa attgaattac ctgtggtaca 120

ggctgtttca acaagttcaa attctcaaga accacttctt tctagcaaag acccactacg 180

agatggaagc aacgtgggga ataggttgag tggaaacagc gaaactctga taaccaactc 240

tgatgctgat catcctatgg agacggataa taataactct aatcttaata atactaattc 300

ctctactaat actaatgata acaaagattc gtcatccaat tccagcaata atgaaaatgg 360

ggacagtagc aacaattcaa atagaaggca tagcaaccat tgtcacaagc ataaccatct 420

aagcagcact tctaccctca aggcaagagt tacttctgga aaatatgcat tatatgattt 480

tcagattctg agaactttgg gtacaggttc gtttggtaga gttcatttgg tgagatccaa 540

tcacaacggc aggttctatg caatgaaagt tttgaaaaaa aacaccgttg tcaaattgaa 600

acaagtggag cataccaacg atgaaagaaa tatgctaagt atagtatccc atcctttcat 660

aattagaatg tggggaactt tccaggactc acagcaattg tttatgatca tggattacat 720

cgaaggtggt gaactattct ctcttttaag gaaagaccag cgttttccta atccagtcgc 780

gaagttttat gcagcagaag tttgtcttgc gttggaatac ctacattcta aaggcatcat 840

ttacagagat ttgaaaccag aaaatatcct tttagataag aacggacata tcaagttaac 900

tgatttcggg ttcgctaaat atgttcctga tgtcacttac actctctgtg gaacaccgga 960

ctatatcgca cctgaagtgg taagcacaaa accttacaac aaatctgtgg attggtggag 1020

ttttggtgtt ttaatctacg aaatgttagc aggatataca cctttctacg attcaaacac 1080

aattaagacc tatgagaata ttctaaatgc tccagtaaga ttcccaccat ttttccattc 1140

tgatgctcaa gatctaatat cgaaactcat cacaagagac ttaagtcaac ggctaggtaa 1200

tttacaaaat ggaagtgagg acgtaaagaa tcatccgtgg ttcagcgagg ttgtgtggga 1260

aaaactactc tgcaaaaaca ttgaaactcc atatgaacct cctattcagg ccggacaagg 1320

cgatacctct caatacgata ggtatccaga ggaagaggtt aattatggca ttcaaggcga 1380

agatccgtac catagtattt tcaccaactt ttagcaggca tacttgctca tgaaattcag 1440

atatcaacat gcctcttatc ttgcatctac acaatatgta aactttaaca cgcctttccc 1500

cccgttagtc ccttttcttt ttttttttgt tttgatatat cggctcattg ccttcagaaa 1560

cgctgccgtt a 1571

<210> 6

<211> 1767

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ggtagctcca ataatccaag catatctaac attttgtctc tgatcaactc aactatctca 60

aaactatgtc tattcgcaac gctgtacatc aagatacacc ctgcaacacc aagcatagac 120

ttggcattga tcatagagaa ttcatcttgt cctgacgtat ccacgatatc taggttaaat 180

tttaactcgg ttccgttggg tttctttaat acgaattcat gtatgaactg attctcgatc 240

gttggataat acgattcgac aaaatgagac tctgtaagtt gtaccaataa agttgtcttg 300

ccgacattcc gcgaccccaa gacaataatc tttctatccc tgactgacat atttcctaaa 360

aaatccctac tgtatcgatt caaaagtcgc ttaccagatc ggaaaacact caaaaagcta 420

aatggaaagt tgtaacaaag aggaaaaaac gagccgaaac cagtaaatcc aaacaagaaa 480

gctttaacgg ttatagcact gatatacctt gcccaaaaca aatgatccct gatatactta 540

taggtctaga aatcaaaata tacatgtcta tgtcggagcg ttctgtccag aagtgatgga 600

tgatgtatca cattttttat aatttgaagt ttttgtaaaa aaaaaatatt gaaaagtatg 660

aaggcatgaa aagtgtcgaa tcaaacgtta aacatctaat agatatagct ctaaattctg 720

agagatccga ctgttcttcg ctgtcaatag gcttatacaa agttgctata attttatttg 780

tgaacgatat actagtgatt gtccaaaaac ctttggttgc ttgaaagaaa gagagagaga 840

tagaaattta gaagctataa gtttatagaa caagtcactt ttgacttata tctgtaaaga 900

tagatgtgta atatatagta attgtaatag agacgatacc aagatctaat agtccaatga 960

aatgggccag gaccatccgg aggatggtcc ttgccatgag ctggtcaagc atataccgat 1020

gccagcgtcc atcccaacgt ccatcactct ctacgagccg cgtttttcag tgcattccaa 1080

tggaaatggg aatttctctt tactcgcgca aagggggcga aaaggcagtt ttccaaagaa 1140

aggaactaaa gaaaaaaatc tttaattaca gaaacacaga aaacaaacag acagaaacaa 1200

caacaacaat aagacaggtg agagacagag gtctgtatac agtgactgct gtgttattgc 1260

gagcggcttc tgtactggtt atttttgtgt ttgcacaggg ttagtcaggt tgaaaaagat 1320

ttgagatata gagagagaga gagagagaga cgcgcgcgct tgtgagtgtt ctgtgtgtat 1380

ccggttttgt gtgcaaaatt gagagaacgg aattataaga ggaaacgaat aaataaagca 1440

gagacaagaa gtgcagttgg gttgttgaac gtgacattta aagttagctg tgtttcgtga 1500

gtgtagagtt tagtctgttt tgttttgtct cttaacgttt cgaggattaa taaactgaat 1560

taaacgaaca tattaaagaa agtttgagac agggaagaga aaagaaaaaa agaaaattac 1620

tataactgta aaaggaagat aaatattaca atacaaggct atggggttat gctgtagttg 1680

tttgagaggt gaaagttctc tcgaggattc gacagggttg cccattgcag aaaatgaaag 1740

ggaagcagtg acgtcgttgt tggagtt 1767

Claims (22)

1. A method for reflecting the in vitro cell-free foreign protein synthesis capacity of a strain is characterized by comprising the following steps:

the method comprises the following steps:

(i) integrating a luminescence reporter gene into the 5 'end and/or the 3' end of a housekeeping gene in the genome of a first target strain to obtain a first control strain integrated with the luminescence reporter gene, wherein the first target strain is an original strain or a non-original strain which is transformed by the original strain through any other genes without the luminescence reporter gene integrated;

(ii) on the basis of the first control strain and the first target strain, other optional same gene modifications except for the integration of the luminescence reporter gene are respectively carried out, a second control strain is obtained from the first control strain, and a second target strain is obtained from the first target strain; (ii) if the first target strain is a non-original strain, the genetic modification in step (i) is not the same as the genetic modification in this step;

(iii) (iii) expanding the first control strain of step (i) or the second control strain of step (ii) such that the luminescent reporter gene is expressed within the first control strain or the second control strain;

(iv) detecting the luminous signal intensity of the cultured strain without cell disruption, and reflecting the in vitro cell-free exogenous protein synthesis capacity of the first target strain or the first control strain through the luminous signal intensity of the first control strain; reflecting the in vitro cell-free exogenous protein synthesis capacity of the second target strain or the second control strain through the luminous signal intensity of the second control strain,

wherein the 5 'untranslated region of the luminescent reporter gene has a polynucleotide sequence identical to the 5' untranslated region of the DNA template of the foreign protein in the in vitro cell-free protein synthesis system,

the 3 'untranslated region of the luminescent reporter gene has the same polynucleotide sequence as the 3' untranslated region of the DNA template of the foreign protein in the in vitro cell-free protein synthesis system.

2. The method of claim 1, wherein:

the luminescent signal intensity of the first control strain is positively correlated with the in vitro cell-free foreign protein synthesis capacity of the first control strain or the first target strain; or

The luminous signal intensity of the second control strain is positively correlated with the in vitro cell-free exogenous protein synthesis capacity of the second control strain or the second target strain.

3. The method of claim 1, wherein: the housekeeping gene is actin gene, tubulin gene, ribosomal protein gene or glyceraldehyde-3-phosphate dehydrogenase gene.

4. The method of claim 2, wherein the housekeeping gene is an actin gene, a tubulin gene, a ribosomal protein gene, or a glyceraldehyde-3-phosphate dehydrogenase gene.

5. The method according to any one of claims 1 to 4, wherein the luminescence signal intensity is a ratio obtained by comparing a detected luminescence value with an OD value of a bacterial suspension after the culture expansion.

6. The method of any one of claims 1 to 4, wherein the luminescent reporter gene is a luciferase gene or a fluorescent protein gene.

7. The method of claim 5, wherein the luminescent reporter gene is a luciferase gene or a fluorescent protein gene.

8. The method according to claim 6, wherein the luciferase gene is a NanoLuc gene.

9. The method of claim 7, wherein the luciferase gene is a NanoLuc gene.

10. The method of any one of claims 1 to 4, wherein the strain is derived from Escherichia coli, yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

11. The method of claim 5, wherein the strain is derived from Escherichia coli, yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

12. The method of claim 6, wherein the strain is derived from Escherichia coli, yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

13. The method of claim 7, wherein the strain is derived from Escherichia coli, yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

14. The method of claim 8, wherein the strain is derived from escherichia coli, yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

15. The method of claim 9, wherein the strain is derived from escherichia coli, yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

16. A strain for reflecting the in vitro cell-free foreign protein synthesis capability, wherein a luminescent reporter gene is integrated at the 5 'end and/or the 3' end of a housekeeping gene in the genome of the strain, the luminescent reporter gene can express a reporter protein in the strain, and the in vitro cell-free foreign protein synthesis capability is reflected by detecting the luminescent signal intensity of the reporter protein.

17. The strain of claim 16, wherein the housekeeping gene is an actin gene, a tubulin gene, a ribosomal protein gene, or a glyceraldehyde-3-phosphate dehydrogenase gene.

18. The strain of claim 16, wherein the luminescent reporter gene is a luciferase gene or a fluorescent protein gene.

19. The strain of claim 17, wherein the luminescent reporter gene is a luciferase gene or a fluorescent protein gene.

20. The strain of claim 18, wherein the luciferase gene is a NanoLuc gene.

21. The strain of any one of claims 16 to 20, wherein:

the strain is derived from escherichia coli and yeast cells; the yeast cell is derived from saccharomyces cerevisiae, pichia pastoris and kluyveromyces; the Kluyveromyces lactis is Kluyveromyces lactis.

22. Use of a strain according to any one of claims 16 to 21 for reflecting the capacity of in vitro cell-free synthesis of a foreign protein.

Images