CN111118065A

CN111118065A - Gene modification method of eukaryote, corresponding gene engineering cell and application thereof

Info

Publication number: CN111118065A
Application number: CN201811286209.3A
Authority: CN
Inventors: 郭敏; 许乃庆; 姜灵轩; 娄旭; 邓蜜妮; 杨旭; 占魁; 李海洋; 于雪
Original assignee: Kangma Healthcode Shanghai Biotech Co Ltd
Current assignee: Kangma Healthcode Shanghai Biotech Co Ltd
Priority date: 2018-10-31
Filing date: 2018-10-31
Publication date: 2020-05-08

Abstract

The invention provides a gene modification method of eukaryote, which fuses eIF2B delta gene and T7RNA polymerase gene and/or fuses eIF2B epsilon gene and T7RNA polymerase gene in the genome of eukaryote by a gene editing technology. Experiments prove that the protein expression capacity of a cell-free system can be remarkably improved by respectively fusing two subunits eIF2B delta and eIF2B epsilon of the T7RNA polymerase and eIF2B complex. Meanwhile, the invention provides a gene engineering cell which is transformed by the gene transformation method and a eukaryotic cell-free protein synthesis system which comprises a cell extract prepared by the gene engineering cell.

Description

Gene modification method of eukaryote, corresponding gene engineering cell and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a method for enhancing protein synthesis capability of a eukaryotic cell-free protein reaction system by fusing eIF2B delta, eIF2B epsilon and T7RNA polymerase genes.

Background

The cell-free protein reaction system is an in vitro system for synthesizing a protein in an enzyme system of a cell extract using exogenous mRNA or DNA as a template. Compared with the traditional in vivo recombinant expression system, the cell-free protein reaction system has many advantages, such as the ability to express cytotoxic proteins or special proteins containing unnatural amino acids, and the ability to perform high-throughput drug screening and proteomics research by virtue of its ease of operation. Cell-free protein synthesis systems currently in use include prokaryotic E.coli systems, eukaryotic wheat germ extracts and rabbit reticulocyte lysate systems. The yeast cell belongs to eukaryotic cells, and simultaneously, the yeast cell can be obtained in a large amount through a fermentation way, so that the yeast cell extract system has the advantages of the protein modification function of a eukaryotic system and large-scale industrial application. However, no mature yeast cell extract system exists in the market at present, and the kluyveromyces extract system developed by people can fill the blank in the aspect.

In the process of developing a cell-free protein reaction system of Kluyveromyces lactis extract, an important aim is to improve the protein synthesis capacity of the system. Factors affecting protein synthesis in cell-free systems are many, such as the strength of DNA transcription, the stability of mRNA templates, the activity of translation-related factors, abundance of energy and raw materials, and elimination of by-products. Among them, many translation factors play a crucial role in protein synthesis, and especially the formation of a pre-translational complex is a rate-limiting step in protein translation. The functions of genes and proteins can be directionally changed through genetic engineering, so that the protein synthesis capacity of the cell-free protein synthesis system is enhanced. Meanwhile, the CRISPR-Cas9 technology which is emerging in recent years is widely applied to various cells as a tool for high-efficiency genome DNA editing. Kluyveromyces is genetically engineered by using a CRISPR-Cas9 technology, so that an extract of the Kluyveromyces has stronger protein synthesis capacity.

Kluyveromyces lactis (C.)Kluyveromyces lactisHereinafter, it is abbreviated asK. lactis) Is a yeast widely used in industry, and has many advantages compared with other yeasts, such as super strong secretion capability, good large-scale fermentation characteristic, higher food safety level, capability of protein posttranslational modification and the like. We use CRISPR-Cas9 technology to express T7 phage-derived T7RNA polymerase in fusion with the translation factor of Kluyveromyces lactis cells, in order to hopefully couple the transcription of DNA and the translation of the transcription product RNA. Surprisingly, we found that fusion of T7RNA polymerase and the two subunits eIF2B δ and eIF2B ∈ of the eIF2B complex, respectively, significantly improved protein expression in cell-free systems.

Disclosure of Invention

The invention provides a gene modification method of eukaryote, which fuses eIF2B delta gene and T7RNA polymerase gene and/or fuses eIF2B epsilon gene and T7RNA polymerase gene in the genome of eukaryote by gene editing technology.

Further, the gene editing technology is the prior art, and the CRISPR/Cas9 gene editing technology can be selected.

Further, the gene fusion adopts a direct fusion mode that two genes are directly connected or connects the two genes through a connecting sequence (Linker).

Further, the T7RNA polymerase gene is fused with eIF2B subunit (eIF 2B delta, eIF2B epsilon) gene C end or N end.

In a second aspect, the present invention provides a genetically engineered cell comprising in its genome a modification made by the method of genetic modification of the first aspect.

Further, the cell is a eukaryotic cell.

Further, the eukaryotic cell is one of a mammalian cell, a plant cell, a yeast cell, an insect cell or any combination thereof.

Further, the yeast cell is selected from one of Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces yeasts, or a combination thereof.

Further, the yeast of the genus Kluyveromyces is selected from one of Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces multibuyveri, or any combination thereof.

In a third aspect, the invention provides a eukaryotic cell-free protein synthesis system comprising at least a cellular extract from the genetically engineered cell of any one of the second aspects.

Further, T7RNA polymerase may be additionally added to the cell-free protein synthesis system.

The fourth aspect of the present invention provides the use of the method of gene engineering according to the first aspect and the use of the genetically engineered cell according to the second aspect in increasing the expression level of foreign proteins in a eukaryotic cell-free protein synthesis system.

The fifth aspect of the invention provides a method for improving the expression level of foreign proteins in a eukaryotic cell-free protein synthesis system, which comprises the following steps:

step 1, providing a eukaryotic cell-free protein synthesis system according to the third aspect;

and 2, adding DNA molecules for encoding the foreign protein into the integrated system obtained in the step 1, and incubating under certain conditions to synthesize the foreign protein.

Further, the reaction temperature is 20 to 35 ℃, preferably 20 to 30 ℃.

Further, the reaction time is 0.5-20h, preferably 1-18h, more preferably 2-15 h, more preferably 3-12 h; the reaction time can be artificially determined according to specific conditions, and can also be 3-15 h.

The main advantages of the invention include:

(1) the invention provides that the protein synthesis capacity of a cell-free system can be improved by fusing T7RNA polymerase at the C terminal of eIF2B delta subunit for the first time through gene-directed modification and activity determination.

(2) The invention provides that the fusion of T7RNA polymerase at the C end of eIF2B epsilon subunit can improve the protein synthesis capacity of a cell-free system for the first time through gene-directed modification and activity determination.

Drawings

FIG. 1 is a schematic representation of the fusion of the delta and epsilon subunits of eIF2B with T7RNA polymerase in eukaryotic genomes.

FIG. 2 shows pCas9 (u)KlPlasmid map of eIF2B δ. The plasmid hasK.lactisSNR52 promoter and SNR52 terminator with kana selection marker.

FIG. 3 is a plasmid map of pKMD1-eIF2B delta-Linker-T7. The C-terminal coding sequence 800bp of eIF2B delta is HR1, the DNA sequence of Linker and T7 transcriptase is optimized according to the codon preference of K.lactis cells, 800bp downstream of eIF2B delta stop codon is HR2, and the plasmid carries Amp selection marker.

FIG. 4 shows pCas9 (u)KlPlasmid map of eIF2B epsilon. The plasmid hasK.lactisSNR52 promoter and SNR52 terminator with kana selection marker.

FIG. 5 is a plasmid map of pKMD1-eIF2B epsilon-Linker-T7. The C-terminal coding sequence 800bp of eIF2B epsilon is HR1, and the DNA sequences of Linker and T7 transcriptases are according toK.lactisThe codon preference of the cells is optimized, the 800bp downstream of the eIF2B delta stop codon is HR2, and the plasmid carries an Amp selection marker.

FIG. 6 is a comparison of the amounts of green fluorescent protein synthesized in cell-free systems by strains eIF2B delta-T7 and eIF2B epsilon-T7 and wild type strains.

Detailed Description

The inventor finds that extracts of two engineering cell strains in different modified strains can obviously improve the synthesis of exogenous target protein through extensive and intensive research. The two engineering bacteria are characterized in that T7RNA polymerase genes are respectively fused with two subunits eIF2B delta genes and eIF2B epsilon genes of a Kluyveromyces lactis endogenous eIF2B compound to respectively obtain an eIF2B delta-T7 cell strain (eIF 2B delta-T7 engineering cell) and an eIF2B epsilon-T7 cell strain (eIF 2B epsilon-T7 engineering cell). Compared with a wild Kluyveromyces lactis cell, the in vitro cell-free protein synthesis system containing the cell extract of the eIF2B delta-T7 engineering cell and/or the eIF2B epsilon-T7 engineering cell can obviously improve the expression yield of the foreign protein.

Term(s) for

In order that the disclosure may be more readily understood, certain terms are first defined. As used in this application, each of the following terms shall have the meaning given below, unless explicitly specified otherwise herein. Other definitions are set forth throughout the application.

The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which may be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

eIF2 complex (eIF 2 complex)

The eIF2 complex is an important factor in the translation initiation process, and the GTP-bound eIF2 complex (eIF 2-GTP) can bind to and recruit initiation methionine-tRNA (initiator methyl-tRNAi) to the pre-translational complex (pre-initiation complex) 40S subunit after the initiation methionine-tNRA and initiation codon AUG are precisely paired, GTP is hydrolyzed to GDP to generate inactive eIF2-GDP, inactive eIF2-GDP is dissociated from the 40S subunit, after eIF2-GDP dissociation, the 60S subunit is recruited to form a complete translation complex, thereby initiating translation of the protein.

eIF2B complex (eIF 2B complex)

The eIF2B complex is a guanine-nucleotide exchange factor (guanine-nucleotid exchange factor) with the eIF2-GDP as a substrate, the eIF2B complex accelerates the separation of GDP from eIF2 and binds GTP to eIF2 again to form an active eIF2-GTP complex, which participates in the initiation of new protein translation, the eIF2B complex in yeast cells is composed of 5 subunits, i F2B α, i F2B β, i F2B delta, i F2B gamma and i F2B epsilon, respectively, wherein α -, 2- β -and delta-subunits constitute a regulatory sub-complex of eIF2B (regulatory subunit), and gamma-and epsilon-subunits constitute a catalytic sub-complex of eIF2B (catalytic sub-subunit).

In vitro protein synthesis system

The invention provides an in vitro protein synthesis system for expressing foreign protein, which mainly comprises:

(a) a cell extract;

(b) a substrate for synthesizing a protein;

(c) a substrate for RNA synthesis;

(d) no or additional T7RNA polymerase was added.

Wherein the cell extract is from the eIF2B delta-T7 engineering cell and/or the eIF2B epsilon-T7 engineering cell, and the two engineering cell extracts respectively contain gene fusion modification of eIF2B delta subunit and T7RNA polymerase and gene fusion modification of eIF2B epsilon subunit and T7RNA polymerase.

Further, the synthesis system further comprises one or more components selected from the group consisting of: magnesium ions, potassium ions, buffers, energy regeneration systems, polyethylene glycol (PEG) or analogs thereof, Dithiothreitol (DTT), and optionally a solvent, which is water or an aqueous solvent.

Further, the cell is a eukaryotic cell. The eukaryotic cell is one of mammalian cell, plant cell, yeast cell, insect cell or any combination thereof. Wherein the yeast cell is selected from one of saccharomyces cerevisiae, pichia pastoris and kluyveromyces or the combination thereof; the yeast of the genus Kluyveromyces is selected from one of Kluyveromyces lactis, Kluyveromyces marxianus and Kluyveromyces polybracteus or any combination thereof; preferably, the yeast cell is a Kluyveromyces, more preferably a Kluyveromyces lactis.

Further, the cell extract is an aqueous extract of yeast cells.

Further, the cell extract does not contain long-chain nucleic acid molecules endogenous to yeast.

Further, the substrate for synthesizing RNA comprises: one of nucleoside monophosphate, nucleoside triphosphate or a combination thereof.

Further, the substrate of the synthetic protein comprises: 20 natural amino acids and non-natural amino acids.

Further, the magnesium ions are derived from a magnesium ion source selected from the group consisting of: one or the combination of magnesium acetate and magnesium glutamate.

Further, the potassium ion is derived from a potassium ion source selected from the group consisting of: one or the combination of potassium acetate and potassium glutamate.

Further, the energy regeneration system is selected from the group consisting of: one or a combination of the phosphocreatine/phosphocreatine enzyme system, the glycolysis pathway, and its intermediate energy system.

Further, the energy regeneration system comprises a glucose/phosphate system, the phosphate being selected from the group consisting of: one or a combination of tripotassium phosphate, triammonium phosphate, trisodium phosphate, dipotassium hydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, monopotassium phosphate, monoammonium phosphate and monosodium phosphate.

Further, the buffer is selected from the group consisting of: 4-hydroxyethyl piperazine ethanesulfonic acid, tris (hydroxymethyl) aminomethane or a combination thereof.

Further, the in vitro protein synthesis system comprises polyethylene glycol (PEG) or an analog thereof. The concentration of polyethylene glycol or an analog thereof is not particularly limited, and usually, the concentration (w/v) of polyethylene glycol or an analog thereof is 0.1 to 8%, preferably 0.5 to 4%, more preferably 1 to 2%, based on the total weight of the protein synthesis system. Representative PEGs are selected from the group consisting of: one of PEG3000, PEG3350, PEG6000, PEG8000 or their combination.

Further, the polyethylene glycol includes polyethylene glycol with molecular weight (Da) of 200-.

Alternatively, the in vitro protein synthesis system provided by the invention comprises: yeast cell extract, 4-hydroxyethylpiperazine ethanesulfonic acid, potassium acetate, magnesium acetate, adenine nucleoside triphosphate (ATP), guanine nucleoside triphosphate (GTP), cytosine nucleoside triphosphate (CTP), thymidylate nucleoside triphosphate (TTP), amino acid mixture, phosphocreatine, Dithiothreitol (DTT), phosphocreatine kinase, RNA polymerase.

Alternatively, the in vitro protein synthesis system provided by the invention comprises: yeast cell extract, tris, potassium acetate, magnesium acetate, Adenosine Triphosphate (ATP), Guanosine Triphosphate (GTP), cytosine nucleoside triphosphate (CTP), Thymidine Triphosphate (TTP), amino acid mixture, glucose, potassium phosphate, Dithiothreitol (DTT), RNA polymerase.

In the present invention, the cell extract does not contain intact cells, and typical cell extracts include ribosomes for protein translation, transfer RNAs, aminoacyl tRNA synthetases, initiation and elongation factors required for protein synthesis, and termination and release factors. In addition, the cell extract also contains some other proteins, especially soluble proteins, which originate from the cytoplasm of the cell.

In the present invention, the protein content of the cell extract is 20-100mg/ml, preferably 50-100 mg/ml. The method for determining the protein content is a Coomassie brilliant blue determination method.

In the present invention, the preparation method of the cell extract is not limited, and a preferred preparation method comprises the steps of:

(i) providing a cell;

(ii) washing the cells to obtain washed cells;

(iii) subjecting the washed cells to cell disruption treatment, thereby obtaining a crude cell extract;

(iv) and carrying out solid-liquid separation on the cell crude extract to obtain a liquid part, namely the cell extract.

In the present invention, the solid-liquid separation method is not particularly limited, and a preferable method is centrifugation.

In the present invention, the centrifugation conditions are not particularly limited, and one preferable centrifugation condition is 5000-.

In the present invention, the centrifugation time is not particularly limited, and a preferable centrifugation time is 0.5min to 2h, preferably 20min to 50 min.

In the present invention, the temperature of the centrifugation is not particularly limited, and it is preferable that the centrifugation is performed at 1 to 10 ℃, preferably, 2 to 6 ℃.

In the present invention, the washing treatment is not particularly limited, and a preferable washing treatment is a treatment with a washing solution at a pH of 7 to 8 (preferably, 7.4), the washing solution is not particularly limited, and typically the washing solution is selected from the group consisting of: potassium 4-hydroxyethylpiperazine ethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

In the present invention, the cell disruption treatment is not particularly limited, and a preferable cell disruption treatment includes high-pressure disruption, freeze-thawing (e.g., liquid nitrogen low-temperature disruption).

The nucleoside triphosphate mixture in the in vitro protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytosine nucleoside triphosphate and uracil nucleoside triphosphate. In the present invention, the concentration of each mononucleotide is not particularly limited, and usually the concentration of each mononucleotide is 0.5 to 5mM, preferably 1.0 to 2.0 mM.

The amino acid mixture in the in vitro protein synthesis system may comprise natural or unnatural amino acids, and may comprise D-or L-amino acids. Representative amino acids include (but are not limited to) the 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine. The concentration of each amino acid is usually 0.01-0.5mM, preferably 0.02-0.2mM, such as 0.05, 0.06, 0.07, 0.08 mM.

In a preferred embodiment, the in vitro protein synthesis system comprises a saccharide selected from one of glucose, starch, glycogen, sucrose, maltose, cyclodextrin or a combination thereof. Wherein the concentration of the saccharide is not particularly limited, and usually, the concentration of the saccharide is 0.03 to 40% by weight, preferably 0.08 to 10% by weight, more preferably 0.1 to 5% by weight, based on the total weight of the protein synthesis system.

A particularly preferred in vitro protein synthesis system comprises, in addition to the yeast cell extract, the following components: 22 mM 4-hydroxyethylpiperazine ethanesulfonic acid with pH of 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM phosphocreatine, 1.7mM dithiothreitol, 0.27mg/mL phosphocreatine kinase, 1% -4% polyethylene glycol, 0.5% -2% sucrose, 0.027-0.054 mg/mL T7RNA polymerase.

A particularly preferred in vitro protein synthesis system comprises, in addition to the yeast cell extract, the following components: 22 mM 4-hydroxyethylpiperazine ethanesulfonic acid with pH of 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM tripotassium phosphate, 1.7mM dithiothreitol, 40mM glucose, 1% -4% polyethylene glycol, 0.027-0.054 mg/mL T7RNA polymerase.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press, 1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Unless otherwise specified, reagents and materials in the examples of the present invention are commercially available products.

The invention uses the lactic acid Kluyveromyces (Kluyveromyces lactis) ((R))Kluyveromyces lactis，K. lactis) For the purpose of example, the same design, analysis and experimental methods are also applicable to other lower eukaryotic cells such as yeast and higher animal cells.

General procedure

The invention provides a gene design and modification method, namely, the delta-and epsilon-subunit C ends of a translation factor eIF2B are respectively fused with T7RNA polymerase by a CRISPR-Cas9 gene editing technology, so that the protein synthesis capacity of a cell-free system is improved. The method comprises the following steps:

(1) the construction method of the Cas9-gRNA cloning vector is as follows:

A. downloading eIF2B delta (KLLA 0F08327 p) and eIF2B epsilon (KLLA 0A04235 p) gene nucleotide sequences from a gene database (Uniprot), and designing gRNA sequences guiding the genes to be cut aiming at eIF2B delta and eIF2B epsilon genes respectively, wherein the cutting sites of the two genes are positioned at the C end of a gene coding sequence;

B. recombining the gRNA sequence into a vector containing Cas9 to obtain a first vector co-expressed by the gRNA and Cas 9.

(2) Constructing donor DNA fused by T7RNA polymerase and eIF2B subunit C end, which comprises the following steps:

A. downloading eIF2B delta and eIF2B epsilon gene nucleotide sequences from a gene database, using 800bp of each upstream sequence and downstream sequence of a stop codon of the gRNA as a homologous arm, and carrying out synonymous mutation on the gRNA;

B. the Linker sequence (Linker) and the sequence of T7RNA polymerase were placed before the stop codons of both genes;

C. seamless splicing was performed using pEASY-Uni Seamless Cloning and Assembly Kit from TransGene to construct a plasmid;

D. performing PCR amplification on donor plasmids with correct sequencing by using universal primers M13F (GTAAAACGACGGCCAGT) and M13R (CAGGAAACAGCTATGAC), performing ethanol precipitation and concentration on obtained PCR products, and finally obtaining donor DNA;

(3) a T7RNA polymerase fused cell strain is obtained by the following method:

A. simultaneously transforming the first vector and the donor DNA into competent cells;

B. screening monoclonals by using the resistance on the Cas9 vector, selecting 12-24 monoclonals, carrying out PCR identification by using cell genome DNA as a template and using an identification primer, and carrying out sequencing verification on an amplified PCR product.

(4) Cell-free in vitro protein synthesis system

Preparing yeast cell lysate by using the cell strain after gene modification, adding the yeast cell lysate into a protein in-vitro translation system, reacting for 2-12 h in an environment of 20-30 ℃, and detecting the activity of the enhanced green fluorescent protein by using the reading of a multifunctional microplate reader (Perkin Elmer).

Example 1 targeted insertion of T7RNA polymerase at the C-terminus of eIF 2B. delta. Gene by CRISPR/Cas9

1.1KleIF2B delta CRISPR gRNA sequence determination

According to inKlDesign of inserting T7RNA polymerase into C end of eIF2B delta gene (SEQ ID number 1), selecting PAM sequence (NGG), and determining corresponding gRNA sequence. The principle of gRNA selection in this example is: the GC content is moderate (40% -60%), and the existence of a poly T structure is avoided. In the present embodiment, it is preferred that,Klthe eIF2B δ gRNA sequence was CGACGAAGGTAAGAATGTCA.

The plasmid construction and transformation method is as follows: use of the primer pCas9-KleIF2B δ -gRNA-PF: CGACGAAGGTAAGAATGTCAGTTTTAGAGCTAGAAATAGC and pCas9-KleIF2B δ -gRNA-PR: TGACATTCTTACCTTCGTCGAAAGTCCCATTCGCCACCCG, PCR amplification was performed using the pCAS plasmid as a template. Taking 17 muL of the amplification product, adding 1 muL Dpn I, 2 muL 10 Xdigestion buffer, mixing uniformly and then 37 muL^oAdding 10 mu L of the product after the Dpn I treatment into 50 mu L DH5 α competent cells in a C water bath for 3 h, placing the product on ice for 30min, and 42%^oAfter C heat shock for 45 s, 1 mL of LB liquid medium 37 was added^oC shaking culture for 1 h, spreading on Kan resistant LB solid culture, 37^oC, inverted culture until single clone grows out. Randomly picked 2 monoclonalsShaking culturing in LB liquid culture medium, PCR detecting positive and sequencing confirming, extracting plasmid and storing, named pCas9-KleIF2Bδ。

1.2 Donor DNA plasmid construction and amplification

In order to facilitate the preservation and amplification of the linear donor DNA, the donor DNA was inserted into a plasmid pKMD1 (one selected from commercially available plasmids such as pMD18-T, PUC, pMD19-T, pEGFP-C (KAN +), pEGFP-N (KAN +), pENTR/D-TOPO (KAN +), etc., collectively designated as pKMD1 based on the identity described below) and amplified by PCR to obtain a linear donor DNA sequence.

Using pKMD1 plasmid as a template, and primer pKMD 1-PF: ATCGTCGACCTGCAGGCATG and pKMD 1-PR: ATCTCTAGAGGATCCCCGGG PCR amplification, taking 17 muL of amplification product, adding 1 muL Dpn I, 2 muL 10 Xdigestion buffer, mixing uniformly and 37^oAnd C, water bath is carried out for 3 h, and the plasmid backbone linear fragment pKMD1-T is obtained.

1.2.1 construction of the donor plasmid pKMD1-eIF2B delta-Linker-T7

Taking Kluyveromyces lactis genome DNA as template and using primerKleIF2B delta-HR 1-PF: CAGGAAACAGCTATGACTACCCGGGGATCCTCTAGAGATTGACAAGTTACCTGTCCCAT andKleIF2B delta-gRNA mutant-PR: TTATCTTTAACGTTTTTTCCCTCATCTGCAGTAGCATTATTGGTATT PCR amplification, the product name is eIF2B delta-F1; taking Kluyveromyces lactis genome DNA as template and using primerKleIF2B delta-gRNA mutant-PF: AGATGAGGGAAAAAACGTTAAAGATAAACCAATACTAGCAG andKleIF2B delta-HR 1-PR: ACCCAATTGAACTTCCCAGAAATCTTGAGTAGCTGATGCTTTGTATTCTC PCR amplification was performed, the product being designated eIF 2B. delta. -F2.

Using synthesized T7RNA polymerase DNA as a template, primer T7RNAP-PF 1: GCATCCAGCTGGTTTGGGTAAGAAGTCTGTTACTGTTGGTGGATCTATGAACACGATTAACATCGC and T7 RNAP-PR: TTACGCGAACGCGAAGTCCGACTCTAA PCR amplification was performed, the product being named T7-F1. Using T7-F1 as a template, a primer T7RNAP-PF 2: ACTCAAGATTTCTGGGAAGTTCAATTGGGTATTAAGGGACCAAAGCATCCAGCTGGTTTGGGTAAG and T7 RNAP-PR: TTACGCGAACGCGAAGTCCGACTCTAA PCR amplification was performed, the product being named T7-F2.

Taking Kluyveromyces lactis genome DNA as template and using primerKleIF2B delta-HR 2-PF: CTTAGAGTCGGACTTCGCGTTCGCGTAAATGGAGCCCTTTGCATATAt andKleIF2B delta-HR 2-PR: GTAAAACGACGGCCAGTTGCATGCCTGCAGGTCGACGATAATCATGAACTGAAAACTCG PCR amplification, the product name is eIF2B delta-F3;

1 mu L each of the amplification products eIF2B delta-F1, eIF2B delta-F2, T7-F2, eIF2B delta-F3 and pKMD1-T was added to 5 mu LCloning Mix (Kit name: Transgene pEASY-Uni Seamless Cloning and Assembly Kit, from the whole gold Co., Ltd., the same below), and after mixing, 50 mu L of the mixture was added^oC, water bath for 1 h. Placing on ice for 2 min after the water bath is finished, adding 10 μ L of reaction solution into 50 μ L of Trans-T1 competent cells (from the whole gold company, the same below), placing on ice for 30min, and placing on 42 min^oAfter C heat shock for 30 s, 1 mL of LB liquid medium 37 was added^oC shaking culture for 1 h, plating on Amp resistant LB solid culture, 37^oC, inverted culture until single clone grows out. Randomly selecting 6 monoclonals, carrying out shake culture in an LB liquid culture medium, carrying out PCR positive detection, carrying out sequencing confirmation, extracting a plasmid, and storing the plasmid, wherein the plasmid is named as pKMD1-eIF2B delta-Linker-T7. Wherein the sequence of the modified eIF2B delta-Linker-T7 is shown as SEQ ID number 2.

1.3K. lactisElectric conversion

Taking out competence from a refrigerator at-80 ℃, thawing on ice, adding 400 ng of gRNA & Cas9 plasmid (or gRNA/Cas9 fragment) and 1000 ng of donor DNA fragment, mixing uniformly, transferring into an electric shock cup, and carrying out ice bath for 2 min; putting the electric shock cup into an electric rotating instrument for electric shock (the parameters are 1.5 kV, 200 omega and 25 muF); immediately adding 700 mu L of YPD after the electric shock is finished, and incubating for 1-3 h by using a shaking table at 30 ℃ and 200 rpm; 2-200. mu.L of the suspension was inoculated onto YPD (containing G418 resistance) plates and cultured at 30 ℃ for 2-3 days until single colonies appeared.

1.4 Positive identification

12-24 monoclonals are picked from the transformed cell plate, and the genomic DNA of the cell is taken as a template, and the identification primers eIF2B delta-CF: ATAGGTTCCATTCCTCGTTG and eIF2B delta-CR are used: AGCAGTGTTGGTACCAGTAT PCR detection was performed on the samples. The positive band is about 4700bp, and the negative band is about 2000 bp. The cell strain which is positive in PCR result and identified by sequencing is determined to be a positive cell strain and is named as eIF2B delta-T7 (namely eIF2B delta-T7 cell strain or eIF2B delta-T7 engineering cell).

Example 2 targeted insertion of T7RNA polymerase at the C-terminus of eIF2B epsilon Gene by CRISPR/Cas9

2.1KleIF2B epsilon CRISPR gRNA sequence determination

According to inKlDesigning eIF2B epsilon gene (SEQ ID number 3) C-terminal inserted T7 transcriptases, selecting PAM sequence (NGG), and determining corresponding gRNA sequence. The principle of gRNA selection in this example is: the GC content is moderate (40% -60%), and the existence of a poly T structure is avoided. In the present embodiment, it is preferred that,Klthe sequence of eIF2B epsilon gRNA is GTATGATTTGGATATCTTAG.

The plasmid construction and transformation method is as follows: use of the primer pCas9-KleIF2B epsilon-gRNA-PF: GTATGATTTGGATATCTTAGGTTTTAGAGCTAGAAATAGC and pCas9-KleIF2B epsilon-gRNA-PR: CTAAGATATCCAAATCATACAAAGTCCCATTCGCCACCCG, PCR amplification was performed using the pCAS plasmid as a template. Taking 17 muL of the amplification product, adding 1 muL Dpn I, 2 muL 10 Xdigestion buffer, mixing uniformly and then 37 muL^oAdding 10 mu L of the product after the Dpn I treatment into 50 mu L DH5 α competent cells in a C water bath for 3 h, placing the product on ice for 30min, and 42%^oAfter C heat shock for 45 s, 1 mL of LB liquid medium 37 was added^oC shaking culture for 1 h, spreading on Kan resistant LB solid culture, 37^oC, inverted culture until single clone grows out. 2 single clones are picked and shake cultured in LB liquid culture medium, PCR detection is positive, and after sequencing confirmation, plasmids are extracted and stored, named as pCas9 uKleIF2Bε。

2.2 Donor DNA plasmid construction and amplification

In order to facilitate the preservation and amplification of linear donor DNA, this example inserts the donor DNA into pKMD1 plasmid and amplifies by PCR to obtain linear donor DNA sequence.

2.2.1 construction of the donor plasmid pKMD1-eIF2B epsilon-Linker-T7

Kluyveromyces lactis geneGroup DNA as template, using primersKleIF2B ε -HR 1-PF: CAGGAAACAGCTATGACTACCCGGGGATCCTCTAGAGATTAGGATCAAACGTCACCTTG andKleIF2B ε -gRNA mutant-PR: TTCTTCAAGAATGTCAAGGTCATATAAGACATTATATACATGGAATAG PCR amplification, the product name is eIF2B epsilon-F1; taking Kluyveromyces lactis genome DNA as template and using primerKleIF2B ε -gRNA mutant-PF: TATATGACCTTGACATTCTTGAAGAAGATGTCATTTACAAATGG andKleIF2B ε -HR 1-PR: CCCAATTGAACTTCCCAGAAATCTTGAGTTTCGTCTTCGTCACTGTCTTC PCR amplification was performed, the product being designated eIF2B ε -F2.

Using the synthesized T7 transcriptase DNA as a template, the primer T7RNAP-PF 1: GCATCCAGCTGGTTTGGGTAAGAAGTCTGTTACTGTTGGTGGATCTATGAACACGATTAACATCGC and T7 RNAP-PR: TTACGCGAACGCGAAGTCCGACTCTAA PCR amplification was performed, the product being named T7-F1. Using T7-F1 as a template, a primer T7RNAP-PF 2: ACTCAAGATTTCTGGGAAGTTCAATTGGGTATTAAGGGACCAAAGCATCCAGCTGGTTTGGGTAAG and T7 RNAP-PR: TTACGCGAACGCGAAGTCCGACTCTAA PCR amplification was performed, the product being named T7-F2.

Taking Kluyveromyces lactis genome DNA as template and using primerKleIF2B ε -HR 2-PF: ATCTTAGAGTCGGACTTCGCGTTCGCGTAAGTCAATAACGTCATAAATGC andKleIF2B ε -HR 2-PR: : GTAAAACGACGGCCAGTTGCATGCCTGCAGGTCGACGATAAATCTATCTGAGTACCCAC PCR amplification, the product name is eIF2B epsilon-F3;

adding 5 mu LCringing Mix into 1 mu L of each of amplification products eIF2B epsilon-F1, eIF2B epsilon-F2, T7-F2, eIF2B epsilon-F3 and pKMD1-T, and mixing uniformly to obtain 50 mu LCringing Mix^oC, water bath for 1 h. Placing on ice for 2 min after the water bath is finished, adding 10 muL of reaction solution into 50 muL of Trans-T1 competent cells, placing on ice for 30min, and 42 min^oAfter C heat shock for 30 s, 1 mL of LB liquid medium 37 was added^oC shaking culture for 1 h, plating on Amp resistant LB solid culture, 37^oC, inverted culture until single clone grows out. And (3) selecting 6 monoclonals, carrying out shake culture in an LB liquid culture medium, carrying out PCR positive detection, carrying out sequencing confirmation, extracting a plasmid, and storing the plasmid, wherein the plasmid is named as pKMD1-eIF2B epsilon-Linker-T7. Wherein the sequence of the modified eIF2B epsilon-Linker-T7 is shown as SEQ ID number 4.

2.3K. lactisElectric conversion

Same as 1.3 in example 1.

2.4 Positive identification

12-24 monoclonals are picked from the transformed cell plate, and the genomic DNA of the cell is taken as a template, and the identification primers eIF2B epsilon-CF: AGATTGGAGAAGGTACAGTC and eIF2B epsilon-CR are used: GTAAGAGCCGAACATTCAAC PCR detection was performed on the samples. The positive band is about 4700bp, and the negative band is about 2000 bp. The cell strain which is positive in PCR result and identified by sequencing is determined to be a positive cell strain and is named as eIF2B epsilon-T7 (namely eIF2B epsilon-T7 cell strain or eIF2B epsilon-T7 engineering cell).

EXAMPLE 3 in vitro protein Synthesis System

3.1 preparation of cell extracts

The preparation method of the cell extract comprises the following steps:

(i) providing cells which are the eIF2B δ -T7 cell line prepared in example 1 and the eIF2B ∈ -T7 cell line prepared in example 2;

(ii) washing the cells to obtain washed cells;

(iv) and carrying out solid-liquid separation on the cell crude extract to obtain a liquid part, namely the cell extract. The cell extract comprises any one of eIF2B delta-T7, eIF2B epsilon-T7 or a combination of the two.

The solid-liquid separation method is not particularly limited, and centrifugation is used as the method selected in the present example. The centrifugation conditions were 30000 Xg; centrifuging for 30 min; centrifugation 4^oAnd C, performing.

The washing treatment method is not particularly limited, and the washing treatment method selected in this example is a method of treating the substrate with a washing solution at a pH of 7.4, the washing solution is not particularly limited, and typically the washing solution is selected from the following group: potassium 4-hydroxyethylpiperazine ethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof. Potassium acetate was chosen for this example.

Wherein, the cell disruption treatment is not particularly limited, and a preferable cell disruption treatment includes high pressure disruption, freeze-thaw (e.g., liquid nitrogen low temperature) disruption.

3.2 preparation of in vitro protein Synthesis System

4-hydroxyethylpiperazine ethanesulfonic acid at a final concentration of 22 mM and a pH of 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4mM nucleoside triphosphate mixtures (adenosine triphosphate, guanosine triphosphate, cytosine nucleoside triphosphate and uracil nucleoside triphosphate), 0.08-0.24 mM amino acid mixtures (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine), 25 mM creatine phosphate, 1.7mM dithiol, 0.27mg/mL creatine phosphate kinase, 1-4% polyethylene glycol, 0.5-2% sucrose, finally 50% by volume of the cell extract was added.

Of course, a synthesis system with additional addition of T7RNA polymerase can be selected, other components are consistent with the above, and 0.027-0.054 mg/mL T7RNA polymerase is additionally added.

3.3 in vitro protein Synthesis reactions

Placing the reaction system in an environment with the temperature of 20-30 ℃ for reaction for 2-12 h;

enhanced green fluorescent protein (eGFP) activity assay: after several hours of reaction, 10 μ L of the reaction solution was added to a 96-well white plate or a 384-well white plate, and immediately placed in an Envision 2120 multifunctional microplate reader (Perkin Elmer), and the enhanced green fluorescent protein activity was measured by reading, with the Relative Fluorescence Unit (RFU) as the activity Unit, as shown in fig. 6.

The results of the embodiment of the invention show that:

the results of example 3 of the invention show that: compared with wild cell strains, the modified cell strain of the invention has obviously improved cell-free protein synthesis capacity.

Wherein, the synthesis amount (relative fluorescence unit value is 313.67) of the cell strain eIF2B delta-T7 of the cell-free green fluorescent protein is improved by nearly 4 times compared with that of a wild strain (relative fluorescence unit value is 79.3);

the synthesis amount of the cell-free green fluorescent protein (the relative fluorescence unit value is 388.67) of the eIF2B epsilon-T7 cell strain is improved by nearly 5 times compared with that of a wild strain (the relative fluorescence unit value is 79.3).

The cell extract prepared by mixing the two cell strains has higher synthesis amount of cell-free green fluorescent protein compared with the wild strain.

All the results show that the invention carries out directional modification on the genes of two subunits delta-and epsilon-of the eIF2B complex, and the modified strain can effectively improve the expression quantity of foreign proteins in a cell-free system of the cell strain by fusing the genes of T7RNA polymerase respectively.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Kangma (Shanghai) Biotech Co., Ltd

<120> eukaryotic gene modification method, corresponding gene engineering cell and application thereof

<130>2018

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1809

<212>DNA

<213> Kluyveromyces lactis (Kluyveromyces lactis)

<400>1

atgacaggag gagctaagga ggcttcaggg aaagaaacta atactgaaaa gacggcaaat 60

gcacaagaag gagaaaaacc tttatctaat aaagagttga aggaactgaa aaagaaggag 120

aaggctgcaa agagagcagc cagtaagcaa gctagtggta tctctattga aaaacagcag 180

cagcaagctg ctgctaagcg tgaaaagaag cagcaacaaa gagatctctt agctgcaaaa 240

aagaataaag cagccgaccc ggtcaaacat gataccaaga agtcgactct atttggtcat 300

ctagagactg ctgaagaaag aagagcttct ttacttgcag tttcgagtgc tatcacttct 360

acaggtacct caaggattac tgctaatggg ttagtattgc ctttacttgc tactacaccc 420

gcggttgcgg tttcccaacc aatgtctgca tctcctttga gttcaaacct ttctggaagc 480

aatactaatt tggcaggttt ggctcattca gaagattttg aagcccatca aatgctaaat 540

tccttgtccc ttgatgaatc gtcttcattt gtcccaggaa tatcatccgt cattccaaat 600

accatgactt cacaatttac aaatcaacaa tcgattgcct ctgtaaaaga attgattgcc 660

aatcgcgaaa tgttacatcc cgctatcacc tctctgactt tggattatgc attctataaa 720

attataggtt ccattcctcg ttgtattgcc atgttagagg cattccaact ggttgtcaga 780

gactacaaga ctccagaagg tactactctt tcacgtaatt tgacaagtta cctgtcccat 840

caaattgatt tcttgaagaa gtcaagacca ttgagtgtaa ccatgggtaa tgccattaga 900

tggttgaagc aagaaatctc tctaatcgat ccttcaacac cggattcaaa ggccaaaaaa 960

gaactttgtg ataagattgc acagttcgct agagaaagag tgcagttggc tgatcaactt 1020

atcattgaaa cagcttcaca acatattgaa gaaggcagca ctatattgac ctatggctgt 1080

tccaaggttt taactgattt attcctacac aacgccataa atttcggtaa gaacttccaa 1140

attgttatag tggacagtag acctttgttt gagggtcgta aaatggcaga atctttgaga 1200

aatcaaggtc ttaatgtttt gtatgttccc attacagcat tgggtaccgt attcaatatg 1260

gatatcaaat atgtgttttt gggagcgcat tcgattcttt caaatggttt cctatattca 1320

agagtcggta ctgctcagat cgctatgttg gcaagcagaa gaaatattcc tgtacttgta 1380

tgctgtgagt ctttaaagtt ctctcaaagg gtacagcttg atagtgtcac atctaatgaa 1440

cttgctgatc caaacgattt ggtaaccatt gactctgcta atcctgtaca gagacgtaac 1500

aacaatgggt tcttattaca gcaatttatc aaagagcgtg aagcgcagca gaaggaagtc 1560

gagaatagct ctaagcaaaa taataaatct ggcagtgcta ataccaataa tgctactgcc 1620

gacgaaggta agaatgtcaa ggataaacca atactagcag agtgggagaa atcacctaat 1680

ttgcacatct tcaatataat gtacgattta acaccccctg actacatcaa gaagatcatt 1740

acagaatttg gttcgttgcc accatcttctgttcccgtgg ttcttagaga atacaaagca 1800

tcagcttga 1809

<210>2

<211>4548

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgacaggag gagctaagga ggcttcaggg aaagaaacta atactgaaaa gacggcaaat 60

gcacaagaag gagaaaaacc tttatctaat aaagagttga aggaactgaa aaagaaggag 120

aaggctgcaa agagagcagc cagtaagcaa gctagtggta tctctattga aaaacagcag 180

cagcaagctg ctgctaagcg tgaaaagaag cagcaacaaa gagatctctt agctgcaaaa 240

aagaataaag cagccgaccc ggtcaaacat gataccaaga agtcgactct atttggtcat 300

ctagagactg ctgaagaaag aagagcttct ttacttgcag tttcgagtgc tatcacttct 360

acaggtacct caaggattac tgctaatggg ttagtattgc ctttacttgc tactacaccc 420

gcggttgcgg tttcccaacc aatgtctgca tctcctttga gttcaaacct ttctggaagc 480

aatactaatt tggcaggttt ggctcattca gaagattttg aagcccatca aatgctaaat 540

tccttgtccc ttgatgaatc gtcttcattt gtcccaggaa tatcatccgt cattccaaat 600

accatgactt cacaatttac aaatcaacaa tcgattgcct ctgtaaaaga attgattgcc 660

aatcgcgaaa tgttacatcc cgctatcacc tctctgactt tggattatgc attctataaa 720

attataggtt ccattcctcg ttgtattgcc atgttagagg cattccaact ggttgtcaga 780

gactacaaga ctccagaagg tactactctt tcacgtaatt tgacaagtta cctgtcccat 840

caaattgatt tcttgaagaa gtcaagacca ttgagtgtaa ccatgggtaa tgccattaga 900

tggttgaagc aagaaatctc tctaatcgat ccttcaacac cggattcaaa ggccaaaaaa 960

gaactttgtg ataagattgc acagttcgct agagaaagag tgcagttggc tgatcaactt 1020

atcattgaaa cagcttcaca acatattgaa gaaggcagca ctatattgac ctatggctgt 1080

tccaaggttt taactgattt attcctacac aacgccataa atttcggtaa gaacttccaa 1140

attgttatag tggacagtag acctttgttt gagggtcgta aaatggcaga atctttgaga 1200

aatcaaggtc ttaatgtttt gtatgttccc attacagcat tgggtaccgt attcaatatg 1260

gatatcaaat atgtgttttt gggagcgcat tcgattcttt caaatggttt cctatattca 1320

agagtcggta ctgctcagat cgctatgttg gcaagcagaa gaaatattcc tgtacttgta 1380

tgctgtgagt ctttaaagtt ctctcaaagg gtacagcttg atagtgtcac atctaatgaa 1440

cttgctgatc caaacgattt ggtaaccatt gactctgcta atcctgtaca gagacgtaac 1500

aacaatgggt tcttattaca gcaatttatc aaagagcgtg aagcgcagca gaaggaagtc 1560

gagaatagct ctaagcaaaa taataaatct ggcagtgcta ataccaataa tgctactgca 1620

gatgagggaa aaaacgttaa agataaacca atactagcag agtgggagaa atcacctaat 1680

ttgcacatct tcaatataat gtacgattta acaccccctg actacatcaa gaagatcatt 1740

acagaatttg gttcgttgcc accatcttct gttcccgtgg ttcttagaga atacaaagca 1800

tcagctactc aagatttctg ggaagttcaa ttgggtatta agggaccaaa gcatccagct 1860

ggtttgggta agaagtctgt tactgttggt ggatctatga acacgattaa catcgctaag 1920

aacgacttct ctgacatcga actggctgct atcccgttcaacactctggc tgaccattac 1980

ggtgagcgtt tagctcgcga acagttggcc cttgagcatg agtcttacga gatgggtgaa 2040

gcacgcttcc gcaagatgtt tgagcgtcaa cttaaagctg gtgaggttgc ggataacgct 2100

gccgccaagc ctctcatcac taccctactc cctaagatga ttgcacgcat caacgactgg 2160

tttgaggaag tgaaagctaa gcgcggcaag cgcccgacag ccttccagtt cctgcaagaa 2220

atcaagccgg aagccgtagc gtacatcacc attaagacca ctctggcttg cctaaccagt 2280

gctgacaata caaccgttca ggctgtagca agcgcaatcg gtcgggccat tgaggacgag 2340

gctcgcttcg gtcgtatccg tgaccttgaa gctaagcact tcaagaaaaa cgttgaggaa 2400

caactcaaca agcgcgtagg gcacgtctac aagaaagcat ttatgcaagt tgtcgaggct 2460

gacatgctct ctaagggtct actcggtggc gaggcgtggt cttcgtggca taaggaagac 2520

tctattcatg taggagtacg ctgcatcgag atgctcattg agtcaaccgg aatggttagc 2580

ttacaccgcc aaaatgctgg cgtagtaggt caagactctg agactatcga actcgcacct 2640

gaatacgctg aggctatcgc aacccgtgca ggtgcgctgg ctggcatctc tccgatgttc 2700

caaccttgcg tagttcctcc taagccgtgg actggcatta ctggtggtgg ctattgggct 2760

aacggtcgtc gtcctctggc gctggtgcgt actcacagta agaaagcact gatgcgctac 2820

gaagacgttt acatgcctga ggtgtacaaa gcgattaaca ttgcgcaaaa caccgcatgg 2880

aaaatcaaca agaaagtcct agcggtcgcc aacgtaatca ccaagtggaa gcattgtccg 2940

gtcgaggaca tccctgcgat tgagcgtgaa gaactcccga tgaaaccgga agacatcgac 3000

atgaatcctg aggctctcac cgcgtggaaa cgtgctgccg ctgctgtgta ccgcaaggac 3060

aaggctcgca agtctcgccg tatcagcctt gagttcatgc ttgagcaagc caataagttt 3120

gctaaccata aggccatctg gttcccttac aacatggact ggcgcggtcg tgtttacgct 3180

gtgtcaatgt tcaacccgca aggtaacgat atgaccaaag gactgcttac gctggcgaaa 3240

ggtaaaccaa tcggtaagga aggttactac tggctgaaaa tccacggtgc aaactgtgcg 3300

ggtgtcgata aggttccgtt ccctgagcgc atcaagttca ttgaggaaaa ccacgagaac 3360

atcatggctt gcgctaagtc tccactggag aacacttggt gggctgagca agattctccg 3420

ttctgcttcc ttgcgttctg ctttgagtac gctggggtac agcaccacgg cctgagctat 3480

aactgctccc ttccgctggc gtttgacggg tcttgctctg gcatccagca cttctccgcg 3540

atgctccgag atgaggtagg tggtcgcgcg gttaacttgc ttcctagtga aaccgttcag 3600

gacatctacg ggattgttgc taagaaagtc aacgagattc tacaagcaga cgcaatcaat 3660

gggaccgata acgaagtagt taccgtgacc gatgagaaca ctggtgaaat ctctgagaaa 3720

gtcaagctgg gcactaaggc actggctggt caatggctgg cttacggtgt tactcgcagt 3780

gtgactaagc gttcagtcat gacgctggct tacgggtcca aagagttcgg cttccgtcaa 3840

caagtgctgg aagataccat tcagccagct attgattccg gcaagggtct gatgttcact 3900

cagccgaatc aggctgctgg atacatggct aagctgattt gggaatctgt gagcgtgacg 3960

gtggtagctg cggttgaagc aatgaactgg cttaagtctg ctgctaagct gctggctgct 4020

gaggtcaaag ataagaagac tggagagatt cttcgcaagc gttgcgctgt gcattgggta 4080

actcctgatg gtttccctgt gtggcaggaa tacaagaagc ctattcagac gcgcttgaac 4140

ctgatgttcc tcggtcagtt ccgcttacag cctaccatta acaccaacaa agatagcgag 4200

attgatgcac acaaacagga gtctggtatc gctcctaact ttgtacacag ccaagacggt 4260

agccaccttc gtaagactgt agtgtgggca cacgagaagt acggaatcga atcttttgca 4320

ctgattcacg actccttcgg taccattccg gctgacgctg cgaacctgtt caaagcagtg 4380

cgcgaaacta tggttgacac atatgagtct tgtgatgtac tggctgattt ctacgaccag 4440

ttcgctgacc agttgcacga gtctcaattg gacaaaatgc cagcacttcc ggctaaaggt 4500

aacttgaacc tccgtgacat cttagagtcg gacttcgcgt tcgcgtaa 4548

<210>3

<211>2211

<212>DNA

<213> Kluyveromyces lactis (Kluyveromyces lactis)

<400>3

atgagtggaa agaagaccaa atctggtaaa gccaatcaga ataagaaaca agaggttgtt 60

caagatgaac gtttacaagc gattgttttg actgactcgt ttgagactag gtttatgcct 120

ttgacttcgg tgaaaccaag atgtttgttg ccgttggcca acattccctt gattgaatat 180

actttggagt tcttagctaa ggccggagtc aacgaagttt atctgatttg tgcatcgcat 240

ggtgaacaga tccaggaata tatcgatcag tccaaatgga gtttaccatg ggctccgttt 300

aaggtgaata ccatcatgtc gctagagtcc agatctgttg gagatgcaat gagagatgtc 360

gataaccgtg ggctaattac cggtgatttc gtacttgtta gtggtgattt ggtgactaat 420

atggactttg aaaaggcttt agatattcat aaacaaagga gaaaggctga taaggatcat 480

attgtcacta tgtgcctaag taaagcgact cagtttcata agacaaggtc tcatgaacca 540

gcaacgttca tttttgataa gtctaatgat agatgtattt actaccagga tatcccattg 600

gctagctcta gagaaaaaac taccattgat attgatcctg aacttctgga aggtgttgac 660

gagtttgtgt tacgcaacga tttgattgat tgccatgtag atatctgttc tcctcatgtc 720

cctgctattt tccaagagaa tttcgattac caattcttga gaagagattt tgttagaggt 780

gtgctttcta gtgatttgtt gaagaaacat atctacgggt acattaccga cgaatacacc 840

actagagcag aaagttggca aacgtatgat gctatctcgc aagattttat tgctagatgg 900

tgttacccat tggttcttaa tgccaacctt ttaaagggcc aaacttattc atacgaaagc 960

caacacattt ataaggaaaa agacgtggta ttagcgcagt cctgtaagat aaagaaaaac 1020

acggccatcg gctcaggatc caagattgga gaaggtacag tcattgaaaa tagtgttgtt 1080

ggtagaaatt gtaaaattgg ctcaaacatc agaatcaaaa acagttacat ttgggacaat 1140

gttgtcattg atgataacac tacaattgag cactctttag ttgcttcaga tgttaaatta 1200

ggatcaaacg tcaccttgaa tgatggttcc attatcggat tcaatgtagt gattgacgat 1260

aatgttacaa tcccagttgg aaccaagatt tcagcggttc cagtacagag gaacacagct 1320

caattcttag atacagcaca taatctttct tccagcgatg aggacgaaga aggaagcaca 1380

ttcaccagaa attcatcttc tttatcaatc agtaattccg atgaagttgc cgatgcgaag 1440

attaaactat ctaagcagtt ggttgggcca aacgggagag gcgtactata cgaaagtgat 1500

gatgaggatg aagatgaaga tggatcgacc gaaaagggta ttgcgaacac attaacgtac 1560

agagacgatg acatttattt atcggatact tccatatcat ccatcactca aaaacataga 1620

aagaggagaa ccatgtcgat gactagtatc tatactgatt acgaaggaga agaagacgaa 1680

gaagaagatt tcgaaaaaga agccatcgca acagttgaaa gagctataga gaacaaccac 1740

gatttagaca catcaatgct tgaactaaac actttgagaa tgagtatgaa cgtcacttat 1800

catgaagtca ggaatgcttc tgttatcgct atattcagaa gagtttacca ctttgtagcc 1860

acacaaacac taggtccaaa ggacgctgtc actaaagtct tacaacaatg gggtcctgtg 1920

tttaagagac aagcatttga tagtgatgag ttcattgatc taatgaatat cattctggat 1980

cgtgtgctag atcagaaatt cgataaacca gatttcattc tattccatgt atataatgtc 2040

ttgtatgatt tggatatctt agaggaagat gtcatttaca aatggtggga ctctgtaagc 2100

ggtgattcaa aatacagcga agttactgct ctactggcca aatgggtgga ctggctaaag 2160

actgcagatg aagaatcatc tgatgaagaa gacagtgacg aagacgaata a 2211

<210>4

<211>4950

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgagtggaa agaagaccaa atctggtaaa gccaatcaga ataagaaaca agaggttgtt 60

caagatgaac gtttacaagc gattgttttg actgactcgt ttgagactag gtttatgcct 120

ttgacttcgg tgaaaccaag atgtttgttg ccgttggcca acattccctt gattgaatat 180

actttggagt tcttagctaa ggccggagtc aacgaagttt atctgatttg tgcatcgcat 240

ggtgaacaga tccaggaata tatcgatcag tccaaatgga gtttaccatg ggctccgttt 300

aaggtgaata ccatcatgtc gctagagtcc agatctgttg gagatgcaat gagagatgtc 360

gataaccgtg ggctaattac cggtgatttc gtacttgtta gtggtgattt ggtgactaat 420

atggactttg aaaaggcttt agatattcat aaacaaagga gaaaggctga taaggatcat 480

attgtcacta tgtgcctaag taaagcgact cagtttcata agacaaggtc tcatgaacca 540

gcaacgttca tttttgataa gtctaatgat agatgtattt actaccagga tatcccattg 600

gctagctcta gagaaaaaac taccattgat attgatcctg aacttctgga aggtgttgac 660

gagtttgtgt tacgcaacga tttgattgat tgccatgtag atatctgttc tcctcatgtc 720

cctgctattt tccaagagaa tttcgattac caattcttga gaagagattt tgttagaggt 780

gtgctttcta gtgatttgtt gaagaaacat atctacgggt acattaccga cgaatacacc 840

actagagcag aaagttggca aacgtatgat gctatctcgc aagattttat tgctagatgg 900

tgttacccat tggttcttaa tgccaacctt ttaaagggcc aaacttattc atacgaaagc 960

caacacattt ataaggaaaa agacgtggta ttagcgcagt cctgtaagat aaagaaaaac 1020

acggccatcg gctcaggatc caagattgga gaaggtacag tcattgaaaa tagtgttgtt 1080

ggtagaaatt gtaaaattgg ctcaaacatc agaatcaaaa acagttacat ttgggacaat 1140

gttgtcattg atgataacac tacaattgag cactctttag ttgcttcaga tgttaaatta 1200

ggatcaaacg tcaccttgaa tgatggttcc attatcggat tcaatgtagt gattgacgat 1260

aatgttacaa tcccagttgg aaccaagatt tcagcggttc cagtacagag gaacacagct 1320

caattcttag atacagcaca taatctttct tccagcgatg aggacgaaga aggaagcaca 1380

ttcaccagaa attcatcttc tttatcaatc agtaattccg atgaagttgc cgatgcgaag 1440

attaaactat ctaagcagtt ggttgggcca aacgggagag gcgtactata cgaaagtgat 1500

gatgaggatg aagatgaaga tggatcgacc gaaaagggta ttgcgaacac attaacgtac 1560

agagacgatg acatttattt atcggatact tccatatcat ccatcactca aaaacataga 1620

aagaggagaa ccatgtcgat gactagtatc tatactgatt acgaaggaga agaagacgaa 1680

gaagaagatt tcgaaaaaga agccatcgca acagttgaaa gagctataga gaacaaccac 1740

gatttagaca catcaatgct tgaactaaac actttgagaa tgagtatgaa cgtcacttat 1800

catgaagtca ggaatgcttc tgttatcgct atattcagaa gagtttacca ctttgtagcc 1860

acacaaacac taggtccaaa ggacgctgtc actaaagtct tacaacaatg gggtcctgtg 1920

tttaagagac aagcatttga tagtgatgag ttcattgatc taatgaatat cattctggat 1980

cgtgtgctag atcagaaatt cgataaacca gatttcattc tattccatgt atataatgtc 2040

ttatatgacc ttgacattct tgaagaagat gtcatttaca aatggtggga ctctgtaagc 2100

ggtgattcaa aatacagcga agttactgct ctactggcca aatgggtgga ctggctaaag 2160

actgcagatg aagaatcatc tgatgaagaa gacagtgacg aagacgaaac tcaagatttc 2220

tgggaagttc aattgggtat taagggacca aagcatccag ctggtttggg taagaagtct 2280

gttactgttg gtggatctat gaacacgatt aacatcgcta agaacgactt ctctgacatc 2340

gaactggctg ctatcccgtt caacactctg gctgaccatt acggtgagcg tttagctcgc 2400

gaacagttgg cccttgagca tgagtcttac gagatgggtg aagcacgctt ccgcaagatg 2460

tttgagcgtc aacttaaagc tggtgaggtt gcggataacg ctgccgccaa gcctctcatc 2520

actaccctac tccctaagat gattgcacgc atcaacgact ggtttgagga agtgaaagct 2580

aagcgcggca agcgcccgac agccttccag ttcctgcaag aaatcaagcc ggaagccgta 2640

gcgtacatca ccattaagac cactctggct tgcctaacca gtgctgacaa tacaaccgtt 2700

caggctgtag caagcgcaat cggtcgggcc attgaggacg aggctcgctt cggtcgtatc 2760

cgtgaccttg aagctaagca cttcaagaaa aacgttgagg aacaactcaa caagcgcgta 2820

gggcacgtct acaagaaagc atttatgcaa gttgtcgagg ctgacatgct ctctaagggt 2880

ctactcggtg gcgaggcgtg gtcttcgtgg cataaggaag actctattca tgtaggagta 2940

cgctgcatcg agatgctcat tgagtcaacc ggaatggtta gcttacaccg ccaaaatgct 3000

ggcgtagtag gtcaagactc tgagactatc gaactcgcac ctgaatacgc tgaggctatc 3060

gcaacccgtg caggtgcgct ggctggcatc tctccgatgt tccaaccttg cgtagttcct 3120

cctaagccgt ggactggcat tactggtggt ggctattggg ctaacggtcg tcgtcctctg 3180

gcgctggtgc gtactcacag taagaaagca ctgatgcgct acgaagacgt ttacatgcct 3240

gaggtgtaca aagcgattaa cattgcgcaa aacaccgcat ggaaaatcaa caagaaagtc 3300

ctagcggtcg ccaacgtaat caccaagtgg aagcattgtc cggtcgagga catccctgcg 3360

attgagcgtg aagaactccc gatgaaaccg gaagacatcg acatgaatcc tgaggctctc 3420

accgcgtgga aacgtgctgc cgctgctgtg taccgcaagg acaaggctcg caagtctcgc 3480

cgtatcagcc ttgagttcat gcttgagcaa gccaataagt ttgctaacca taaggccatc 3540

tggttccctt acaacatgga ctggcgcggt cgtgtttacg ctgtgtcaat gttcaacccg 3600

caaggtaacg atatgaccaa aggactgctt acgctggcga aaggtaaacc aatcggtaag 3660

gaaggttact actggctgaa aatccacggt gcaaactgtg cgggtgtcga taaggttccg 3720

ttccctgagc gcatcaagtt cattgaggaa aaccacgaga acatcatggc ttgcgctaag 3780

tctccactgg agaacacttg gtgggctgag caagattctc cgttctgctt ccttgcgttc 3840

tgctttgagt acgctggggt acagcaccac ggcctgagct ataactgctc ccttccgctg 3900

gcgtttgacg ggtcttgctc tggcatccag cacttctccg cgatgctccg agatgaggta 3960

ggtggtcgcg cggttaactt gcttcctagt gaaaccgttc aggacatcta cgggattgtt 4020

gctaagaaag tcaacgagat tctacaagca gacgcaatca atgggaccga taacgaagta 4080

gttaccgtga ccgatgagaa cactggtgaa atctctgaga aagtcaagct gggcactaag 4140

gcactggctg gtcaatggct ggcttacggt gttactcgca gtgtgactaa gcgttcagtc 4200

atgacgctgg cttacgggtc caaagagttc ggcttccgtc aacaagtgct ggaagatacc 4260

attcagccag ctattgattc cggcaagggt ctgatgttca ctcagccgaa tcaggctgct 4320

ggatacatgg ctaagctgat ttgggaatct gtgagcgtga cggtggtagc tgcggttgaa 4380

gcaatgaact ggcttaagtc tgctgctaag ctgctggctg ctgaggtcaa agataagaag 4440

actggagaga ttcttcgcaa gcgttgcgct gtgcattggg taactcctga tggtttccct 4500

gtgtggcagg aatacaagaa gcctattcag acgcgcttga acctgatgtt cctcggtcag 4560

ttccgcttac agcctaccat taacaccaac aaagatagcg agattgatgc acacaaacag 4620

gagtctggta tcgctcctaa ctttgtacac agccaagacg gtagccacct tcgtaagact 4680

gtagtgtggg cacacgagaa gtacggaatc gaatcttttg cactgattca cgactccttc 4740

ggtaccattc cggctgacgc tgcgaacctg ttcaaagcag tgcgcgaaac tatggttgac 4800

acatatgagt cttgtgatgt actggctgat ttctacgacc agttcgctga ccagttgcac 4860

gagtctcaat tggacaaaat gccagcactt ccggctaaag gtaacttgaa cctccgtgac 4920

atcttagagt cggacttcgc gttcgcgtaa 4950

Claims

1. A method for genetically modifying a eukaryote, comprising: the elf 2B delta gene is fused to the T7RNA polymerase gene and/or the eIF2B epsilon gene is fused to the T7RNA polymerase gene in the genome of eukaryotes by gene editing techniques.

2. A genetically engineered cell, characterized by: the genetically engineered cell comprises in its genome a modification made by the genetic modification method of claim 1.

3. The genetically engineered cell of claim 2, wherein: the cell is a eukaryotic cell.

4. The genetically engineered cell of claim 3, wherein: the eukaryotic cell is one of mammalian cell, plant cell, yeast cell, insect cell or any combination thereof.

5. The genetically engineered cell of claim 4, wherein: the yeast cell is selected from one of Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces yeast or their combination.

6. The genetically engineered cell of claim 5, wherein: the yeast of the genus Kluyveromyces is selected from one of Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces polybracteus, or any combination thereof.

7. A eukaryotic cell-free protein synthesis system, characterized by: the synthesis system at least comprises a cell extract from the genetically engineered cell of any one of claims 2 to 6.

8. The use of the genetic modification method of claim 1 to increase the amount of foreign protein expressed in a eukaryotic cell-free protein synthesis system.

9. Use of the genetically engineered cell of any one of claims 2 to 6 for increasing the expression level of a foreign protein in a eukaryotic cell-free protein synthesis system.

10. A method for improving the expression level of foreign proteins in a eukaryotic cell-free protein synthesis system comprises the following steps:

step 1, providing a eukaryotic cell-free protein synthesis system according to claim 7;

and 2, adding DNA molecules for encoding the foreign protein into the synthesis system in the step 1, reacting for a period of time under a certain temperature condition, and incubating to synthesize the foreign protein.