CN108841997A

CN108841997A - A kind of kit of Electrochemistry gene chip method detection common type influenza A virus

Info

Publication number: CN108841997A
Application number: CN201810715298.2A
Authority: CN
Inventors: 蒋析文; 黄桃生; 黄志文
Original assignee: Daan Gene Co Ltd Zhongshan University
Current assignee: Daan Gene Co Ltd Zhongshan University
Priority date: 2018-06-29
Filing date: 2018-06-29
Publication date: 2018-11-20

Abstract

The present invention provides a kind of kits of Electrochemistry gene chip method detection common type influenza A virus, specifically, the present invention provides a kind of Electrochemistry gene chip methods quickly to detect influenza A virus MP, H1, H3, H5, H6, H7, H9, H10 and N1, the parting kit of N2, N6, N8, N9 and detection method, can be applied to influenza A virus and causes the laboratory Emergent detection of people and animal Outbreak and clinical quick diagnosis.Detection method and kit of the invention has high degree of specificity, good sensibility and high accuracy；And easy to operate, high degree of automation.

Description

A kind of kit of Electrochemistry gene chip method detection common type influenza A virus

Technical field

The invention belongs to vitro detection fields, specifically, the present invention relates to a kind of detection of Electrochemistry gene chip method is normal See the kit of type influenza A virus.

Background technique

Flu-A is a kind of diseases complex of infecting both domestic animals and human as caused by influenza A virus (Influenza A). There are many influenza A virus such as H1N1, H3N2, H5N1, H5N2, H5N6, H6N6, H7N2, H7N9, H9N2, H10N8 at present Deng by bird, into the mankind, the death rate is high, leads to serious public health event.

Detection influenza A virus conventional method includes virus purification culture and Serologic detection, but sensitivity, special Property, accuracy are lower and cumbersome, take a long time, are unable to satisfy Emergent detection requirement.Reverse transcription fluorescence is fixed in recent years Amount PCR is widely used in the detection of influenza A virus with its high specific and sensitivity, but sense channel is very few, single tube System at most detects 4~5 kinds of types, and micro-array chip method and high throughput sequencing technologies are although technologically advanced, and flux is high, but The disadvantage is that interpretation of result is complicated, time-consuming for detection, testing cost is high.Currently, domestic common for influenza A virus not yet Type detect and the kit of parting.Therefore, a kind of quick, cheap and all other A type streams of common type of covering are established Susceptible virus detection method certainly will have very high advantage.

Summary of the invention

The purpose of the present invention is to provide a kind of methods of Electrochemistry gene chip method detection common type influenza A virus And kit.

In the first aspect of the present invention, a kind of primer pair group for detecting influenza A virus, the primer pair group are provided Including the first primer to collection, the first primer includes to collection：

First general reverse primer：

5'-ATATCGTCTCGTATTAAGTAGAAACAAGGGTGTTAG-3'(SEQ ID NO：15)；With

Second general reverse primer：

5'-ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTAG-3'(SEQ ID NO：16).

In another preferred example, the first primer further includes one or more forward primers selected from the group below to collection：

H1 forward primer：5'-TAATAGCACCATGGTATGCTTT-3'(SEQ ID NO：3),

H3 forward primer：5'-ATGCCAAACAATGAYAATTTTGAC-3'(SEQ ID NO：4),

H5 forward primer：5'-ATCATTGACAAAATGAACACTCART-3'(SEQ ID NO：5),

H6 forward primer：5'-ACACTGGAGAYAAGTCAGTTC-3'(SEQ ID NO：6),

H7 forward primer：5'-TAAGCAGCGGCTACAAAG-3'(SEQ ID NO：7),

H9 forward primer：5'-TCAACAAACTCCACAGAAAC-3'(SEQ ID NO：8),

H10 forward primer：5'-ATAGCACCGAGCCGAGTTAG-3'(SEQ ID NO：9),

N1 forward primer：5'-AGTGCTCCTGTTATCCTGATG-3'(SEQ ID NO：10),

N2 forward primer：5'-AAGGACAACTCAATTAGGCTYTC-3'(SEQ ID NO：11),

N6 forward primer：5'-TGCATAGGATGGTCAAGCA-3'(SEQ ID NO：12),

N8 forward primer：5'-CAATGAAACAGTAAGGGTTGAGA-3'(SEQ ID NO：13),

N9 forward primer：5'-ACAACCAACACAAGCCAAAC-3'(SEQ ID NO：14).

In another preferred example, the first primer includes SEQ ID NO. to collection:3 to SEQ ID NO.:Shown in 14 At least two primer sequences.

In another preferred example, the first primer includes SEQ ID NO. to collection:3 to SEQ ID NO.:Shown in 16 Primer sequence.

In another preferred example, the primer pair group further includes the second primer pair collection, and the second primer pair collection includes drawing Object pair：

MP forward primer：5'-CAGATCTYGAGGCTCTCATGG-3'(SEQ ID NO：1), and

MP reverse primer：5'-GCCATCTGYTCCATAGCCTT-3'(SEQ ID NO：2).

In another preferred example, the first primer is used for multiple asymmetry to collection and/or the second primer pair collection PCR。

The second aspect of the present invention provides a kind of signal probe group for detecting Influenza A virus sequences, the signal Probe groups include one or more signal probes selected from the group below：

MP signal probe：5'-CCAGTGAGCGAGGA-3'(SEQ ID NO：17),

H1 signal probe：5'-ATGATAGATGGGTGGTATGG-3'(SEQ ID NO：18),

H3 signal probe：5'-AAACTATACATCTGGGG-3'(SEQ ID NO：19),

H5 signal probe：5'-ACTTATAAYGCTGAACT-3'(SEQ ID NO：20),

H6 signal probe：5'-ATTGATTATTTCTGGTC-3'(SEQ ID NO：21),

H7 signal probe：5'-GTTTTCTTCTTCTAGCC-3'(SEQ ID NO：22),

H9 signal probe：5'-GTGACACATGCCAAAGAA-3'(SEQ ID NO：23),

H10 signal probe：5'-AATGTTTTTGGAGAGGG-3'(SEQ ID NO：24),

N1 signal probe：5'-CAATCCACGCCCCAATG-3'(SEQ ID NO：25),

N2 signal probe：5'-GGTCTAGTTCAAGCTG-3'(SEQ ID NO：26),

N6 signal probe：5'-CCGAATAACAATGCATC-3'(SEQ ID NO：27),

N8 signal probe：5'-CACCCTTTTCCAAAGAC-3'(SEQ ID NO：28), and

N9 signal probe：5'-TGTACTATAAATTCATGGC-3'(SEQ ID NO：29).

In another preferred example, 5 ' ends of the signal probe are marked with Fc (ferrocene molecule).

The third aspect of the present invention provides a kind of capture probe group for detecting Influenza A virus sequences, the capture Probe groups include one or more capture probes selected from the group below：

MP capture probe：5'-TTGTRTTCACGCACACCGTGC-3'(SEQ ID NO：30),

H1 capture probe：5'-TCATTGAAGGGGGATGGACAGGA-3'(SEQ ID NO：31),

H3 capture probe：5'-ATGCCAAACAATGAYAATTTTGAC-3'(SEQ ID NO：32),

H5 capture probe：5'-ATGGARGACGGATTCCTAGATGTCTGG-3'(SEQ ID NO：33),

H6 capture probe：5'-TGTGAATGGTCAGAGAGGCAGA-3'(SEQ ID NO：34),

H7 capture probe：5'-TGGTTTAGCTTCGGGGCATCAT-3'(SEQ ID NO：35),

H9 capture probe：5'-CTAACAGAAAACAATGTYCCT-3'(SEQ ID NO：36),

H10 capture probe：5'-CACCAATAGACAATAATTGTGAGTCCA-3'(SEQ ID NO：37),

N1 capture probe：5'-TATATATGCAGTGGAGTTTTCGGAGA-3'(SEQ ID NO：38),

N2 capture probe：5'-ACCAAACAAGTGTGCATAGCAT-3'(SEQ ID NO：39),

N6 capture probe：5'-AGGATGTCAATATGCATATCAGGA-3'(SEQ ID NO：40),

N8 capture probe：5'-ATTGTGTGATGCTAAGGGTTTCG-3'(SEQ ID NO：41),

N9 capture probe：5'-TTTCAATAACTTAACTAAAGGGCTC-3'(SEQ ID NO：42).

In another preferred example, 3 ' ends of the capture probe are marked with C6S-S, the capture probe by C6 S-S with The form of covalent bond is fixed on printed circuit board gold electrode surfaces.

The fourth aspect of the present invention, provides a kind of kit for detecting influenza A virus, and the kit includes this Primer pair group described in invention first aspect.

In another preferred example, the kit further includes signal probe group described in second aspect of the present invention.

In another preferred example, the kit further includes capture probe group described in third aspect present invention.

The fifth aspect of the present invention provides a kind of method for detecting influenza A virus, the method includes the steps：

(1) sample to be detected is provided, and extracts RNA from the sample to be detected；

(2) step (1) is extracted into obtained RNA and is separately added into the PCR pipe equipped with the first reaction solution and the second reaction solution In, it carries out reverse transcription and carries out multiple asymmetric PCR amplification, obtain the first pcr amplification product respectively and the second PCR amplification produces Object；

It wherein, include the first primer in first reaction solution to collection；It include described the in second reaction solution Two primer pair collection；

(3) PCR product hybridization check

First pcr amplification product and the second pcr amplification product are mixed, then are added to after being mixed with electrochemical hybridization liquid On Electrochemical Detection chip, detected in Electrochemistry gene chip.

In another preferred example, the PCR amplification condition is：50 DEG C 30 minutes, 95 DEG C initial denaturation 15 minutes, then press 94 DEG C 30 seconds → 50 DEG C 30 seconds → 72 DEG C amplifications in 30 seconds, 45 circulations, last 72 DEG C extend 7 minutes.

In another preferred example, the electrochemical hybridization liquid includes：Electrochemical hybridization liquid I, NBS buffer and NaClO₄, wherein electrochemical hybridization liquid I includes signal probe group and MES buffer described in second aspect of the present invention.

In another preferred example, the concentration of each signal probe is 0.2 μM in the electrochemical hybridization liquid I.

In another preferred example, the Electrochemistry gene chip includes capture probe group described in third aspect present invention.

It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, Not repeated them here.

Detailed description of the invention

Fig. 1 shows actual sample testing result.

Specific embodiment

The present inventor obtains a kind of Electrochemistry gene chip method and quickly detects A type stream by extensive and in-depth research The detection method and kit of Influenza Virus, the experimental results showed that, detection method of the invention and kit have high special Property, good sensibility and high accuracy；And easy to operate, high degree of automation.

The purpose of the present invention is overcoming existing influenza A virus detection technique and product, there are sense channel number is very few The problem of, a kind of polygenic locus detection kit for common type influenza A virus is provided, which should have There are good specificity and sensibility.Specifically, the present invention provides a kind of Electrochemistry gene chip methods quickly to detect A type stream Influenza Virus MP, H1, H3, H5, H6, H7, H9, H10 and N1, the parting kit of N2, N6, N8, N9 and detection method, can apply Cause the laboratory Emergent detection of people and animal Outbreak and clinical quick diagnosis in influenza A virus.

Before describing the present invention, it should be understood that the present invention is not limited to the specific method and experiment conditions, because this Class method and condition can change.It should also be understood that its purpose of the term as used herein is only that description specific embodiment, and And it is not intended to be restrictive, the scope of the present invention will be limited only by the claims which follow.

Unless otherwise defined, otherwise whole technologies used herein and scientific term all have the neck as belonging to the present invention The normally understood identical meanings of the those of ordinary skill in domain.As used herein, in mentioning the numerical value specifically enumerated in use, Term " about " means that the value can change not more than 1% from the value enumerated.For example, as used herein, statement " about 100 " includes 99 and 101 and between whole values (for example, 99.1,99.2,99.3,99.4 etc.).

Although can be used in implementation or test of the invention and heretofore described similar or of equal value any method And material, place enumerates preferred method and material herein.

Electrochemistry gene chip method

Electrochemistry gene chip method (CN201310166271.X, CN201210590669.1) passes through electrochemical gene base Because chip analysis system detection goes out current value (signal value), the gene type of each point is determined, can be easily accomplished Flux detection.In addition, its is cheap, simple light and small, the easy to operate, test of equipment quick and precisely, can be applied to anyly Side, including customs, airport, Branch Clinic etc., all have unique advantage in all respects.On this basis, we establish one kind and are based on Multiple asymmetric PCR-Electrochemistry gene chip method detects recruit's diagnostic method of a variety of influenza A virus types simultaneously, and Its kit is developed, is of great significance to the clinical diagnosis and treatment of influenza A virus.

Multiple asymmetric PCR

Multiplex PCR (multiplex PCR), also known as Multiplex PCR or composite PCR, it is in same PCR reactant Two pairs or more primers are added in system, while amplifying the PCR reaction of multiple nucleic acid fragments, reaction principle, reaction reagent and behaviour It is identical as general PCR to make process.

Asymmetric PCR (asymmetric PCR) is the pair of primers with inequality, is generated after PCR amplification a large amount of single Chain DNA (ssDNA).This is referred to as unrestricted primer and restricted primer to primer, and ratio is preferably 5-20: 1.In PCR In the initial 10-15 circulation of reaction, amplified production is mainly double-stranded DNA, but when restricted primer (low concentration primer) disappears After having consumed, the PCR of non-limiting primer (high density primer) guidance will generate a large amount of single stranded DNA.The pass of asymmetric PCR Key is the absolute magnitude for controlling restricted primer, need to repeatedly grope the ratio for optimizing two primers.Still an alternative is that first use etc. The primer PCR of concentration expands, and prepares double-stranded DNA, (dsDNA), then using this dsDNA as template, then with a primer therein Second of PCR is carried out, ssDNA is prepared.The ssDNA of asymmetric PCR preparation, is mainly used for determining nucleic acid sequence.

The many because being known as of multiple asymmetric PCR reaction are influenced, such as：

(1) reaction system is uneven, and the imbalance of reaction system leads to certain advantage primers in several wheels reaction of early period And its template expands rapidly, obtains a large amount of amplified production, and these amplified productions are the good suppression of archaeal dna polymerase simultaneously Preparation.So the polymerizing power of polymerase is therefore, preceding by more more and more intense inhibition with a large amount of appearance of amplified production The primer and its template that phase is in a disadvantageous position, are at this moment just more difficult to react, and it is very small to eventually lead to amplified production amount, so that In can not detect.

(2) primer specificity, if primer and the non-target gene fragment binding force of other in system are stronger, purpose The ability of gene combination primer just will receive strives unexpectedly, so as to cause amplification efficiency decline.

(3) optimum annealing temperature is inconsistent, and multipair primer is placed into a system and is expanded, due to carrying out PCR reaction Annealing temperature it is identical, it requires that the optimum annealing temperature of every pair of primers is close.

(4) primer dimer, including between primer dimer and primer itself be formed by hairpin structure, there are also one Class is the aggressiveness that third party DNA is mediated, these dimers and non-specific primer is the same can all interfere primer and target binding site Strive unexpectedly, influence amplification efficiency.

Although above-mentioned be referred to the several factors for influencing amplification efficiency, more factors are unclear.To being at present Only, there are no the effective ways that one can clearly predict amplification efficiency.

The present inventor to existing MP, H1, H3, H5, H6, H7, H9, H10 and N1, N2, N6, N8, N9 gene order, into After row deeply compares analysis, primer and probe is devised, then the primer and probe of design is in optimized selection and is verified, most The primer and probe sequence that can be used for multiple asymmetric PCR amplification have been determined eventually, has provided common type first on this basis Type influenza virus PCR- Electrochemistry gene chip method detection kit.

The present inventor design and has tested in the course of the research, to common type influenza A virus PCR amplification primer Verifying.The result shows that using multiplexed PCR amplification system, at the same detect this 13 (MP, H1, H3, H5, H6, H7, H9, H10, N1, N2, N6, N8, N9 gene order) influenza A genes sequence difficulty it is very big.It is by further investigation and repeatedly real It tests, inventors have surprisingly discovered that, in addition to MP gene is using specific downstream primer, other genes share 2 downstream primers, That is universal primer, and upstream primer and probe are directed to the design of respective sequence-specific respectively, and by 13 influenza A virus bases Because being divided to two groups (i.e. the first primer is to collection and second primer pair collection) to carry out multiplexed PCR amplification, it is multiple right to well solve The biggest problem of inhibition is interfered with each other between title PCR system primer, while the design of specific primer and probe ensure that this electrification Learn the good specificity of gene chips：

One group of primer for all influenza A virus of M genetic test, sequence are as follows：

MP forward primer：5'-CAGATCTYGAGGCTCTCATGG-3'(SEQ ID NO：1),

MP reverse primer：5'-GCCATCTGYTCCATAGCCTT-3'(SEQ ID NO：2),

One group of forward primer for all H1 of HA genetic test, sequence are as follows：

H1 forward primer：5'-TAATAGCACCATGGTATGCTTT-3'(SEQ ID NO：3),

One group of forward primer for all H3 of HA genetic test, sequence are as follows：

H3 forward primer：5'-ATGCCAAACAATGAYAATTTTGAC-3'(SEQ ID NO：4),

One group of forward primer for all H5 of HA genetic test, sequence are as follows：

H5 forward primer：5'-ATCATTGACAAAATGAACACTCART-3'(SEQ ID NO：5),

One group of forward primer for all H6 of HA genetic test, sequence are as follows：

H6 forward primer：5'-ACACTGGAGAYAAGTCAGTTC-3'(SEQ ID NO：6),

One group of forward primer for all H7 of HA genetic test, sequence are as follows：

H7 forward primer：5'-TAAGCAGCGGCTACAAAG-3'(SEQ ID NO：7),

One group of forward primer for all H9 of HA genetic test, sequence are as follows：

H9 forward primer：5'-TCAACAAACTCCACAGAAAC-3'(SEQ ID NO：8),

One group of forward primer for all H10 of HA genetic test, sequence are as follows：

H10 forward primer：5'-ATAGCACCGAGCCGAGTTAG-3'(SEQ ID NO：9),

One group of forward primer for all N1 of NA genetic test, sequence are as follows：

N1 forward primer：5'-AGTGCTCCTGTTATCCTGATG-3'(SEQ ID NO：10),

One group of forward primer for all N2 of NA genetic test, sequence are as follows：

N2 forward primer：5'-AAGGACAACTCAATTAGGCTYTC-3'(SEQ ID NO：11),

One group of forward primer for all N6 of NA genetic test, sequence are as follows：

N6 forward primer：5'-TGCATAGGATGGTCAAGCA-3'(SEQ ID NO：12),

One group of forward primer for all N8 of NA genetic test, sequence are as follows：

N8 forward primer：5'-CAATGAAACAGTAAGGGTTGAGA-3'(SEQ ID NO：13),

One group of forward primer for all N9 of NA genetic test, sequence are as follows：

N9 forward primer：5'-ACAACCAACACAAGCCAAAC-3'(SEQ ID NO：14),

Two can expand the reverse primer of HA and NA gene simultaneously, and sequence is as follows：

General reverse primer 01：

5'-ATATCGTCTCGTATTAAGTAGAAACAAGGGTGTTAG-3'(SEQ ID NO：15),

General reverse primer 02：

5'-ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTAG-3'(SEQ ID NO：16),

One group of signal probe for all Influenza A virus sequences of M genetic test, sequence are as follows：

MP signal probe：5'-Fc-CCAGTGAGCGAGGA-3'(SEQ ID NO：17),

One group of signal probe for all H1 sequences of HA genetic test, sequence are as follows：

H1 signal probe：5'-Fc-ATGATAGATGGGTGGTATGG-3'(SEQ ID NO：18),

One group of signal probe for all H3 sequences of HA genetic test, sequence are as follows：

H3 signal probe：5'-Fc-AAACTATACATCTGGGG-3'(SEQ ID NO：19),

One group of signal probe for all H5 sequences of HA genetic test, sequence are as follows：

H5 signal probe：5'-Fc-ACTTATAAYGCTGAACT-3'(SEQ ID NO：20),

One group of signal probe for all H6 sequences of HA genetic test, sequence are as follows：

H6 signal probe：5'-Fc-ATTGATTATTTCTGGTC-3'(SEQ ID NO：21),

One group of signal probe for all H7 sequences of HA genetic test, sequence are as follows：

H7 signal probe：5'-Fc-GTTTTCTTCTTCTAGCC-3'(SEQ ID NO：22),

One group of signal probe for all H9 sequences of HA genetic test, sequence are as follows：

H9 signal probe：5'-Fc-GTGACACATGCCAAAGAA-3'(SEQ ID NO：23),

One group of signal probe for all H10 sequences of HA genetic test, sequence are as follows：

H10 signal probe：5'-Fc-AATGTTTTTGGAGAGGG-3'(SEQ ID NO：24),

One group of signal probe for all N1 sequences of NA genetic test, sequence are as follows：

N1 signal probe：5'-Fc-CAATCCACGCCCCAATG-3'(SEQ ID NO：25),

One group of signal probe for all N2 sequences of NA genetic test, sequence are as follows：

N2 signal probe：5'-Fc-GGTCTAGTTCAAGCTG-3'(SEQ ID NO：26),

One group of signal probe for all N6 sequences of NA genetic test, sequence are as follows：

N6 signal probe：5'-Fc-CCGAATAACAATGCATC-3'(SEQ ID NO：27),

One group of signal probe for all N8 sequences of NA genetic test, sequence are as follows：

N8 signal probe：5'-Fc-CACCCTTTTCCAAAGAC-3'(SEQ ID NO：28),

One group of signal probe for all N9 sequences of NA genetic test, sequence are as follows：

N9 signal probe：5'-Fc-TGTACTATAAATTCATGGC-3'(SEQ ID NO：29),

MP capture probe：5'-TTGTRTTCACGCACACCGTGC-C6S-S-3'(SEQ ID NO：30),

One group of capture probe for all H1 sequences of HA genetic test, sequence are as follows：

H1 capture probe：5'-TCATTGAAGGGGGATGGACAGGA-C6S-S-3'(SEQ ID NO：31),

One group of capture probe for all H3 sequences of HA genetic test, sequence are as follows：

H3 capture probe：5'-ATGCCAAACAATGAYAATTTTGAC-C6S-S-3'(SEQ ID NO：32),

One group of capture probe for all H5 sequences of HA genetic test, sequence are as follows：

H5 capture probe：5'-ATGGARGACGGATTCCTAGATGTCTGG-C6S-S-3'(SEQ ID NO：33),

One group of capture probe for all H6 sequences of HA genetic test, sequence are as follows：

H6 capture probe：5'-TGTGAATGGTCAGAGAGGCAGA-C6S-S-3'(SEQ ID NO：34),

One group of capture probe for all H7 sequences of HA genetic test, sequence are as follows：

H7 capture probe：5'-TGGTTTAGCTTCGGGGCATCAT-C6S-S-3'(SEQ ID NO：35),

One group of capture probe for all H9 sequences of HA genetic test, sequence are as follows：

H9 capture probe：5'-CTAACAGAAAACAATGTYCCT-C6S-S-3'(SEQ ID NO：36),

One group of capture probe for all H10 sequences of HA genetic test, sequence are as follows：

H10 capture probe：5'-CACCAATAGACAATAATTGTGAGTCCA-C6S-S-3'(SEQ ID NO：37),

One group of capture probe for all N1 sequences of NA genetic test, sequence are as follows：

N1 capture probe：5'-TATATATGCAGTGGAGTTTTCGGAGA-C6S-S-3'(SEQ ID NO：38),

One group of capture probe for all N2 sequences of NA genetic test, sequence are as follows：

N2 capture probe：5'-ACCAAACAAGTGTGCATAGCAT-C6S-S-3'(SEQ ID NO：39),

One group of capture probe for all N6 sequences of NA genetic test, sequence are as follows：

N6 capture probe：5'-AGGATGTCAATATGCATATCAGGA-C6S-S-3'(SEQ ID NO：40),

One group of capture probe for all N8 sequences of NA genetic test, sequence are as follows：

N8 capture probe：5'-ATTGTGTGATGCTAAGGGTTTCG-C6S-S-3'(SEQ ID NO：41),

One group of capture probe for all N9 sequences of NA genetic test, sequence are as follows：

N9 capture probe：5'-TTTCAATAACTTAACTAAAGGGCTC-C6S-S-3'(SEQ ID NO：42),

One group of high RST point (His Control) and low signal point (Los Control) for chip interior Quality Control is caught Probe is obtained, sequence is as follows：

High RST point (His Control) capture probe：5'-GAAAACGCTTGTACACTCA-C6 S-S-3'(SEQ ID NO：43),

Low signal point (Los Control) capture probe：5'-TTTCTCAAATAATTCACCAAAT-C6 S-S-3'(SEQ ID NO：44),

H7N9 viral gene standard items：For the viral RNA simultaneously containing H7 and N9 Partial Fragment, concentration is 1 × 10⁴Copies/mL, sequence are as follows：

AUCUGGCUGAUUCAGAAAUGGACAAACUGUACGAACGAGUGAAAAGACA GCUGAGAGAGAAUGCUGAAGAAGAUGGCACUGGUUGCUUUGAAAUAUUUCAC AAGUGUGAUGAUGACUGUAUGGCCAGUAUUAGAAAUAACACCUAUGAUCACA GCAAAUACAGGGAAGAGGCAAUGCAAAAUAGAAUACAGAUUGACCCAGUCAA ACUAAGCAGCGGCUACAAAGAUGUGAUACUUUGGUUUAGCUUCGGGGCAUCA UGUUUCAUACUUCUAGCCAUUGUAAUGGGCCUUGUCUUCAUAUGUGUAAAGA AUGGAAACAUGCGGUGCACUAUUUGUAUAUAGAGAUGUUAAAAGUGCCAAA UGCAUUGACAGAUGAUAGAUCAAAGCCCAUUCAAGGUCAGACAAUUGUAUUA AACGCUGACUGGAGUGGUUACAGUGGAUCUUUCAUGGACUAUUGGGCUGAAG GGGACUGCUAUCGAGCGUGUUUUUAUGUGGAGUUGAUACGUGGAAGACCCAA GGAGGAUAAAGUGUGGUGGACCAGCAAUAGUAUAGUAUCGAUGUGUUCCAG UACAGAAUUCCUGGGACAAUGGAACUGGCCUGAUGGGGCUAAAAUAGAGUAC UUCCUCUAAAAAAAACUCCUUGUUUCUACUAAAAACACCCUUGUUUCUACU(S EQ ID NO：45),

3 ' ends of capture probe of the present invention are marked with C6 S-S, and special printing is fixed in the form of covalent bond Circuit board gold electrode surfaces, for capturing PCR product；5 ' ends of the signal probe are marked with Fc i.e. ferrocene molecule, with Captured PCR product specific hybridization, applies alternating voltage on the electrode, and redox reaction then occurs for ferrocene, passes through inspection Current value is surveyed to determine result yin and yang attribute.The Crossing system of this PCR product and double probes, ensure that this Electrochemistry gene chip The good specificity of method.

The present invention establishes common type Flu-A detection kit using PCR- Electrochemistry gene chip law technology PCR reaction solution, wherein further including in addition to primed probe：Triphosphoric acid dezyribonucleoside, (NH4)₂SO₄、MgCl₂、 KCl、C- MMLV reverse transcriptase, RNase inhibitor, and/or hot start Taq polymerase.

The concrete content of each component is as follows in the detection kit：

1 PCR reaction solution formula of table

2 PCR reaction solution formula of table

Remaining is DEPC water, and reaction solution A and B are complemented to 50 μ L respectively.

Common type influenza A virus PCR- Electrochemistry gene chip method detection kit established by the present invention further includes Electrochemical hybridization system, including electrochemical hybridization liquid I, NBS and NaClO containing signal probe₄, a kind of to be preferably formulated such as Shown in lower

Table 3 hybridizes system formulation

Wherein the group of electrochemical hybridization liquid I becomes：Signal probe reacts final concentration of 0.2 μm of ol/L, and MES is 45 μm of ol/ L.MES buffer group becomes：Half sodium salt of morpholino b acid and purified water；NBS buffer group becomes newborn bovine serum.

Common type influenza A virus PCR- Electrochemistry gene chip method detection kit established by the present invention further includes Electrochemical Detection chip (the Electrochemical Detection chip as described in patent document CN201320244116.0), detection chip packet Containing 72 working electrodes, wherein 30 electrodes are fixed with capture probe, composition can detecte common type influenza A virus M base The detection array of cause, 7 H gene types, 5 N genotype, 2 Quality Control sequences.

Common type influenza A virus PCR- Electrochemistry gene chip method detection kit established by the present invention, by following Step carries out：

(1) RNA is extracted from sample to be detected using recommendation RNA extracts kit；

(2) step (1) is extracted obtained RNA to be separately added into the PCR pipe equipped with A and B reaction solution, is carried out

Multiple asymmetric PCR amplification.

The PCR amplification condition is：50 DEG C 30 minutes, 95 DEG C initial denaturation 15 minutes, then press 94 DEG C 30 seconds → 50 DEG C 30 Second → 72 DEG C of amplifications in 30 seconds, 45 circulations, last 72 DEG C extend 7 minutes.

(3) PCR product hybridization check

The crossover operation is：By 2 pipe pcr amplification product of A, B mix again with 70 μ L electrochemical hybridization liquid I, 10 μ L NBS、20μL NaClO₄It is added to after mixing on Electrochemical Detection chip, is detected in Electrochemistry gene chip.

Main advantages of the present invention are：

(1) sense channel is more, can detect simultaneously influenza A virus MP, H1, H3, H5, H6, H7, H9, H10 and N1, N2, N6, N8, N9 almost cover all common types；

(2) high degree of specificity, good sensitivity, accuracy are strong；

(3) easy to operate, high degree of automation；

(4) result is simply readable, and report directly reports result；

(5) the autonomous closure circulatory system prevents the generation of cross contamination；

(6) hybridization detection process is completed in 30 minutes, can meet the needs of quick checkout and diagnosis；

(7) template amplification is carried out using multiple asymmetric PCR method, amplified production is single stranded DNA, after being further simplified Continuous crossover operation.

Combined with specific embodiments below, the further old present invention in detail.It should be understood that these embodiments are merely to illustrate this hair It is bright rather than limit the scope of the invention.The experimental method of detailed conditions is not specified in the following example, usually according to routine Condition such as U.S. Sambrook.J etc. writes《Molecular Cloning: A Laboratory room guide》(Huang Peitang etc. is translated, Beijing：Science Press, 2002 Year) described in condition, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number press weight Amount calculates.Experimental material used in following embodiment and reagent can obtain unless otherwise instructed from commercially available channel.

Embodiment 1：The development and optimization of common type influenza A virus Electrochemistry gene chip method detection kit

1, the design of primer, capture probe and signal probe

According to MP, H1, H3, H5, H6, H7, H9, H10, N1, N2, N6, N8, the N9 provided in existing influenza database Gene order carry out sequence alignment analysis, find the conservative gene segment of each type HA and NA as amplification target site, select two Level structure is less, the section design primer and probe of high specificity；

The preparation of reference material：The HA gene RNA positive is accredited as with external structure, transcription and sequencing and NA gene masculine is made To detect reference material；

2, the foundation and optimization of reaction system

The optimization of primer concentration：It is detected respectively with the multiple groups primer of above-mentioned design above with reference to product, by repetition test, High sensitivity and reproducible best primer concentration ratio combination are filtered out, the preferable amount of upstream primer is 3pmol, is led to It is 30pmol with the preferable amount of downstream primer.

The optimization of signal probe concentration：In the case that other components are constant in the reaction system, used respectively from 0.1 μM Electrochemical Detection test is carried out to 0.3 μM of concentration and probe concentration, is tested by being repeated several times, it is final to determine the best of signal probe It the use of concentration is 0.2 μM.

The composition of 2 common type influenza A virus Electrochemistry gene chip method detection kit of embodiment and detection

1, preparation includes the kit of following component

Kit is divided into PCR reaction solution and hybridizing reagent, positive control, negative control, Electrochemistry gene chip.

Specifically：

PCR system：Contain 1mol/L Tris-HCl pH8.8,0.5mol/L MgCl₂、0.5mol/L (NH₄)₂SO₄、 2mol/L KCl and 10 μm of ol/L, 50 μm of ol/L upstream and downstream primers, C-MMLV reverse transcriptase, RNase inhibitor, thermal starting Taq Enzyme and triphosphoric acid dezyribonucleoside.Specific dosage is shown in Table 1 and 2.

Hybridizing reagent：Contain electrochemical hybridization liquid I, NBS and 0.8mol/L NaClO₄.Specific dosage is shown in Table 3.

Positive control, that is, H7N9 viral gene standard items：For the viral RNA simultaneously containing H7 and N9 Partial Fragment, concentration It is 1 × 10⁴copies/mL。

Negative control：Aseptic double-distilled water.

2, sample acquisition, transport and preservation

(1) sample acquires, pretreatment

Swab is goed deep into larynx when taking and upper cleft palate is scraped 3-5 times back and forth, takes throat juice, then put by brush,throat Enter to fill in the Eppendoff pipe of 1.0mL PBS.

Internal organ or muscle samples are cut clamping measuring samples 2.0g with sterile tweezer and are fully ground in mortar, add 10mL PBS is mixed, or is placed in tissue homogenizer, and 10mL PBS homogenate is added, tissue suspension is then transferred to sterile Eppendoff 3,000rpm is centrifuged 10min in pipe, and supernatant is taken to be transferred in Eppendoff pipe.

(2) Sample preservation and transport：It can be immediately available for testing after sample collection；It is 6 months in -20 ± 5 DEG C of storage lives； To long-term preservation, -80 ± 5 DEG C need to be stored in；Multigelation should be avoided in sample.Sample transport uses curling stone on the rocks or foam Case sealing transport on the rocks, haulage time are not to be exceeded 4 days.

3, detecting step

(1) RNA is extracted

RNA is extracted from sample to be detected using recommendation RNA extracts kit.

(2) it expands

It takes sample RNA as template, is separately added into and (uses the second primer pair equipped with A (using the first primer to collection) and B Collection) reaction solution PCR pipe in, wherein 20 each 30 μ L of μ L, A and B reaction solution of sample RNA.50 DEG C 30 minutes, 95 DEG C of initial denaturations 15 Minute, then by 94 DEG C 30 seconds → 50 DEG C 30 seconds → 72 DEG C amplifications in 30 seconds, 45 circulations, compares in PCR pipe and be separately added into the positive Contrast template and negative control template.

(3) hybridization check

By 2 pipe pcr amplification product of A, B mix again with 70 μ L electrochemical hybridization liquid I, 10 μ L NBS, 20 μ L NaClO₄It is mixed After conjunction, current value is detected in Electrochemistry gene chip, determines result yin and yang attribute.

(4) interpretation of result

According to electrochemical signals figure and corresponding report analysis pattern detection as a result, due to chip top electrode different location It is fixed with corresponding capture probe, whether we electrochemical signals can occur and be higher than according to electrode different location Cutoff value can determine whether various other result yin and yang attribute.Such as when the H1N1 positive, there is electricity respectively in MP, H1, N1 corresponding position Chemical signal, and it is higher than cutoff value, report reports that Flu-A (MP), H1 and the equal Positive, that is, H1N1 of N1 are positive, Alloytype shows that Target Not Detected is feminine gender,

The sensitivity technique of 3 common type influenza A virus Electrochemistry gene chip method detection kit of embodiment and spy Opposite sex test

With the detection of kit described in embodiment 2 to the influenza B virus, influenza virus C, respiratory syncystial of inactivation Virus and Flu-A H1N1, H3N2, H5N1, H5N6, H7N9, H9N2, H10N8 viral nucleic acid are detected, and it is special to evaluate it Property and sensitivity.PCR amplification ABI9700 is that American AB I Products, PCR product hybridization and detection are public with peace gene is reached Product DA9100 is taken charge of, the reagents such as dNTPs are conventional commercially available product.

The nucleic acid of H1N1, H3N2, H5N1, H5N6, H6N2, H7N9, H9N2 and H10N8 Strain is subjected to gradient dilution, Until electrochemical chip method can not detect, as the result is shown when nucleic acid concentration is lower than 1 × 10³When copies/ml, then H1N1 Have no that electrochemical signals generate with H5N6, and there is missing inspection in 100 copies/ml in its alloytype.Accordingly, it is determined that this method is clever Sensitivity can be of about 1 × 10³Copies/ml illustrates that this kit still has good spirit on the basis of with considerable flux Sensitivity.

4 common type influenza A virus Electrochemistry gene chip method detection kit of embodiment detects actual sample

200 swin flu positive samples and 50 various clinical samples of negative sample are chosen, are carried out by 2 step of embodiment Detection, and using the correspondence type real-time PCR detection kit of Da'an Gene Company, Zhongshan University's production Control verifying is carried out,

As the result is shown in 200 swin flu positive clinical samples, fluorescence quantitative PCR detection result can be detected accurately, multiple Asymmetric PCR-electrochemical chip method detects 194 positives, wherein 6 missing inspections, positive rate 97%, 50 negative samples This detection is feminine gender, and it is 0.928 (p that kappa, which analyzes result,<0.0001) display two methods consistency is high, as a result has system Meter learns meaning.

Specific to different types, electrochemical method is compared with fluorescent quantitation, H9N2 82 as the result is shown, H5N6 56 Example, H5N1 16, H3N2 6, H10N8 5 do not occur missing inspection situation, H7N9 27 (electrochemistry missing inspection 4), H1N1 8 (electrochemistry missing inspection 2), Ct value is quantified by analysis of fluorescence, it is found that it is true this 6 concentration of specimens are below electrochemical method Fixed minimum detectability, the result is shown in Figure 1.

5 primer pair of embodiment, probe screening and combined test

The present inventor to existing MP, H1, H3, H5, H6, H7, H9, H10 and N1, N2, N6, N8, N9 gene order, into After row deeply compares analysis, tens of pairs of primers and tens of kinds of probes are devised for each target sequence, due to reaction system injustice Weighing apparatus, primer specific sex differernce, annealing temperature be inconsistent and the reasons such as primer dimer, is difficult to obtain for above-mentioned 13 positions The primer and probe sequence of the multiple asymmetric PCR amplification of point.The present inventor through a large number of experiments, to the primer of design It is in optimized selection and verifies with probe, primer, the probe sequence that can be used for multiple asymmetric PCR amplification has finally been determined And combinations thereof.

Even if in the case where determining the primer pair and probe sequence that are directed to each target nucleic acid substantially, different primers To combination carry out multiplex amplification effect there is also significantly differences.For example, the first primer mixes collection and the second primer pair collection It is bonded to 1 tube body system and tests each type detection limit, the experimental results showed that, M gene can not detect, and other gene sensitivity are aobvious Writing reduces (when nucleic acid concentration is lower than 1 × 10⁵Multiple types can not detect when copies/ml)；And by the first and second primer pair collection Individually amplification, M gene and other genes can be detected normally.Contrast test the result shows that, the first primer to collection and the second primer After collection mixing, M gene primer i.e. the second primer pair collection is suppressed, and leads to not expand M gene order.

All references mentioned in the present invention is incorporated herein by reference, just as each document coverlet It is solely incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art Member can make various changes or modifications the present invention, and such equivalent forms equally fall within the application the appended claims and limited Fixed range.

Sequence table

<110>Da'an Gene Company, Zhongshan University

<120>A kind of kit of Electrochemistry gene chip method detection common type influenza A virus

<130> 000003

<160> 45

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213>Artificial sequence (Artificial)

<400> 1

cagatctyga ggctctcatg g 21

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence (Artificial)

<400> 2

gccatctgyt ccatagcctt 20

<210> 3

<211> 22

<212> DNA

<213>Artificial sequence (Artificial)

<400> 3

taatagcacc atggtatgct tt 22

<210> 4

<211> 24

<212> DNA

<213>Artificial sequence (Artificial)

<400> 4

atgccaaaca atgayaattt tgac 24

<210> 5

<211> 25

<212> DNA

<213>Artificial sequence (Artificial)

<400> 5

atcattgaca aaatgaacac tcart 25

<210> 6

<211> 21

<212> DNA

<213>Artificial sequence (Artificial)

<400> 6

acactggaga yaagtcagtt c 21

<210> 7

<211> 18

<212> DNA

<213>Artificial sequence (Artificial)

<400> 7

taagcagcgg ctacaaag 18

<210> 8

<211> 20

<212> DNA

<213>Artificial sequence (Artificial)

<400> 8

tcaacaaact ccacagaaac 20

<210> 9

<211> 20

<212> DNA

<213>Artificial sequence (Artificial)

<400> 9

atagcaccga gccgagttag 20

<210> 10

<211> 21

<212> DNA

<213>Artificial sequence (Artificial)

<400> 10

agtgctcctg ttatcctgat g 21

<210> 11

<211> 23

<212> DNA

<213>Artificial sequence (Artificial)

<400> 11

aaggacaact caattaggct ytc 23

<210> 12

<211> 19

<212> DNA

<213>Artificial sequence (Artificial)

<400> 12

tgcataggat ggtcaagca 19

<210> 13

<211> 23

<212> DNA

<213>Artificial sequence (Artificial)

<400> 13

caatgaaaca gtaagggttg aga 23

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence (Artificial)

<400> 14

acaaccaaca caagccaaac 20

<210> 15

<211> 36

<212> DNA

<213>Artificial sequence (Artificial)

<400> 15

atatcgtctc gtattaagta gaaacaaggg tgttag 36

<210> 16

<211> 36

<212> DNA

<213>Artificial sequence (Artificial)

<400> 16

atatggtctc gtattagtag aaacaaggag ttttag 36

<210> 17

<211> 14

<212> DNA

<213>Artificial sequence (Artificial)

<400> 17

ccagtgagcg agga 14

<210> 18

<211> 20

<212> DNA

<213>Artificial sequence (Artificial)

<400> 18

atgatagatg ggtggtatgg 20

<210> 19

<211> 17

<212> DNA

<213>Artificial sequence (Artificial)

<400> 19

aaactataca tctgggg 17

<210> 20

<211> 17

<212> DNA

<213>Artificial sequence (Artificial)

<400> 20

acttataayg ctgaact 17

<210> 21

<211> 17

<212> DNA

<213>Artificial sequence (Artificial)

<400> 21

attgattatt tctggtc 17

<210> 22

<211> 17

<212> DNA

<213>Artificial sequence (Artificial)

<400> 22

gttttcttct tctagcc 17

<210> 23

<211> 18

<212> DNA

<213>Artificial sequence (Artificial)

<400> 23

gtgacacatg ccaaagaa 18

<210> 24

<211> 17

<212> DNA

<213>Artificial sequence (Artificial)

<400> 24

aatgtttttg gagaggg 17

<210> 25

<211> 17

<212> DNA

<213>Artificial sequence (Artificial)

<400> 25

caatccacgc cccaatg 17

<210> 26

<211> 16

<212> DNA

<213>Artificial sequence (Artificial)

<400> 26

ggtctagttc aagctg 16

<210> 27

<211> 17

<212> DNA

<213>Artificial sequence (Artificial)

<400> 27

ccgaataaca atgcatc 17

<210> 28

<211> 17

<212> DNA

<213>Artificial sequence (Artificial)

<400> 28

cacccttttc caaagac 17

<210> 29

<211> 19

<212> DNA

<213>Artificial sequence (Artificial)

<400> 29

tgtactataa attcatggc 19

<210> 30

<211> 21

<212> DNA

<213>Artificial sequence (Artificial)

<400> 30

ttgtrttcac gcacaccgtg c 21

<210> 31

<211> 23

<212> DNA

<213>Artificial sequence (Artificial)

<400> 31

tcattgaagg gggatggaca gga 23

<210> 32

<211> 24

<212> DNA

<213>Artificial sequence (Artificial)

<400> 32

atgccaaaca atgayaattt tgac 24

<210> 33

<211> 27

<212> DNA

<213>Artificial sequence (Artificial)

<400> 33

atggargacg gattcctaga tgtctgg 27

<210> 34

<211> 22

<212> DNA

<213>Artificial sequence (Artificial)

<400> 34

tgtgaatggt cagagaggca ga 22

<210> 35

<211> 22

<212> DNA

<213>Artificial sequence (Artificial)

<400> 35

tggtttagct tcggggcatc at 22

<210> 36

<211> 21

<212> DNA

<213>Artificial sequence (Artificial)

<400> 36

ctaacagaaa acaatgtycc t 21

<210> 37

<211> 27

<212> DNA

<213>Artificial sequence (Artificial)

<400> 37

caccaataga caataattgt gagtcca 27

<210> 38

<211> 26

<212> DNA

<213>Artificial sequence (Artificial)

<400> 38

tatatatgca gtggagtttt cggaga 26

<210> 39

<211> 22

<212> DNA

<213>Artificial sequence (Artificial)

<400> 39

accaaacaag tgtgcatagc at 22

<210> 40

<211> 24

<212> DNA

<213>Artificial sequence (Artificial)

<400> 40

aggatgtcaa tatgcatatc agga 24

<210> 41

<211> 23

<212> DNA

<213>Artificial sequence (Artificial)

<400> 41

attgtgtgat gctaagggtt tcg 23

<210> 42

<211> 25

<212> DNA

<213>Artificial sequence (Artificial)

<400> 42

tttcaataac ttaactaaag ggctc 25

<210> 43

<211> 19

<212> DNA

<213>Artificial sequence (Artificial)

<400> 43

gaaaacgctt gtacactca 19

<210> 44

<211> 22

<212> DNA

<213>Artificial sequence (Artificial)

<400> 44

tttctcaaat aattcaccaa at 22

<210> 45

<211> 670

<212> RNA

<213>Artificial sequence (Artificial)

<400> 45

aucuggcuga uucagaaaug gacaaacugu acgaacgagu gaaaagacag cugagagaga 60

augcugaaga agauggcacu gguugcuuug aaauauuuca caagugugau gaugacugua 120

uggccaguau uagaaauaac accuaugauc acagcaaaua cagggaagag gcaaugcaaa 180

auagaauaca gauugaccca gucaaacuaa gcagcggcua caaagaugug auacuuuggu 240

uuagcuucgg ggcaucaugu uucauacuuc uagccauugu aaugggccuu gucuucauau 300

guguaaagaa uggaaacaug cggugcacua uuuguauaua gagauguuaa aagugccaaa 360

ugcauugaca gaugauagau caaagcccau ucaaggucag acaauuguau uaaacgcuga 420

cuggaguggu uacaguggau cuuucaugga cuauugggcu gaaggggacu gcuaucgagc 480

guguuuuuau guggaguuga uacguggaag acccaaggag gauaaagugu gguggaccag 540

caauaguaua guaucgaugu guuccaguac agaauuccug ggacaaugga acuggccuga 600

uggggcuaaa auagaguacu uccucuaaaa aaaacuccuu guuucuacua aaaacacccu 660

uguuucuacu 670

Claims

1. a kind of primer pair group for detecting influenza A virus, which is characterized in that the primer pair group includes the first primer to collection, The first primer includes to collection：

First general reverse primer：

5'-ATATCGTCTCGTATTAAGTAGAAACAAGGGTGTTAG-3'(SEQ ID NO：15)；General reversely draw with second Object：

5'-ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTAG-3'(SEQ ID NO：16).

2. primer pair group as shown in claim 1, which is characterized in that the first primer further includes selected from the group below one to collection Kind or a variety of forward primers：

H1 forward primer：5'-TAATAGCACCATGGTATGCTTT-3'(SEQ ID NO：3),

H3 forward primer：5'-ATGCCAAACAATGAYAATTTTGAC-3'(SEQ ID NO：4),

H5 forward primer：5'-ATCATTGACAAAATGAACACTCART-3'(SEQ ID NO：5),

H6 forward primer：5'-ACACTGGAGAYAAGTCAGTTC-3'(SEQ ID NO：6),

H7 forward primer：5'-TAAGCAGCGGCTACAAAG-3'(SEQ ID NO：7),

H9 forward primer：5'-TCAACAAACTCCACAGAAAC-3'(SEQ ID NO：8),

H10 forward primer：5'-ATAGCACCGAGCCGAGTTAG-3'(SEQ ID NO：9),

N1 forward primer：5'-AGTGCTCCTGTTATCCTGATG-3'(SEQ ID NO：10),

N2 forward primer：5'-AAGGACAACTCAATTAGGCTYTC-3'(SEQ ID NO：11),

N6 forward primer：5'-TGCATAGGATGGTCAAGCA-3'(SEQ ID NO：12),

N8 forward primer：5'-CAATGAAACAGTAAGGGTTGAGA-3'(SEQ ID NO：13),

N9 forward primer：5'-ACAACCAACACAAGCCAAAC-3'(SEQ ID NO：14).

3. primer pair group as shown in claim 1, which is characterized in that the primer pair group further includes the second primer pair collection, institute Stating the second primer pair collection includes primer pair：

MP forward primer：5'-CAGATCTYGAGGCTCTCATGG-3'(SEQ ID NO：1), and

MP reverse primer：5'-GCCATCTGYTCCATAGCCTT-3'(SEQ ID NO：2).

4. a kind of signal probe group for detecting Influenza A virus sequences, which is characterized in that the signal probe group includes being selected from One or more probes of the following group：

MP signal probe：5'-CCAGTGAGCGAGGA-3'(SEQ ID NO：17),

H1 signal probe：5'-ATGATAGATGGGTGGTATGG-3'(SEQ ID NO：18),

H3 signal probe：5'-AAACTATACATCTGGGG-3'(SEQ ID NO：19),

H5 signal probe：5'-ACTTATAAYGCTGAACT-3'(SEQ ID NO：20),

H6 signal probe：5'-ATTGATTATTTCTGGTC-3'(SEQ ID NO：21),

H7 signal probe：5'-GTTTTCTTCTTCTAGCC-3'(SEQ ID NO：22),

H9 signal probe：5'-GTGACACATGCCAAAGAA-3'(SEQ ID NO：23),

H10 signal probe：5'-AATGTTTTTGGAGAGGG-3'(SEQ ID NO：24),

N1 signal probe：5'-CAATCCACGCCCCAATG-3'(SEQ ID NO：25),

N2 signal probe：5'-GGTCTAGTTCAAGCTG-3'(SEQ ID NO：26),

N6 signal probe：5'-CCGAATAACAATGCATC-3'(SEQ ID NO：27),

N8 signal probe：5'-CACCCTTTTCCAAAGAC-3'(SEQ ID NO：28), and

N9 signal probe：5'-TGTACTATAAATTCATGGC-3'(SEQ ID NO：29).

5. a kind of capture probe group for detecting Influenza A virus sequences, which is characterized in that the capture probe group includes being selected from One or more probes of the following group：

MP capture probe：5'-TTGTRTTCACGCACACCGTGC-3'(SEQ ID NO：30),

H1 capture probe：5'-TCATTGAAGGGGGATGGACAGGA-3'(SEQ ID NO：31),

H3 capture probe：5'-ATGCCAAACAATGAYAATTTTGAC-3'(SEQ ID NO：32),

H5 capture probe：5'-ATGGARGACGGATTCCTAGATGTCTGG-3'(SEQ ID NO：33),

H6 capture probe：5'-TGTGAATGGTCAGAGAGGCAGA-3'(SEQ ID NO：34),

H7 capture probe：5'-TGGTTTAGCTTCGGGGCATCAT-3'(SEQ ID NO：35),

H9 capture probe：5'-CTAACAGAAAACAATGTYCCT-3'(SEQ ID NO：36),

H10 capture probe：5'-CACCAATAGACAATAATTGTGAGTCCA-3'(SEQ ID NO：37),

N1 capture probe：5'-TATATATGCAGTGGAGTTTTCGGAGA-3'(SEQ ID NO：38),

N2 capture probe：5'-ACCAAACAAGTGTGCATAGCAT-3'(SEQ ID NO：39),

N6 capture probe：5'-AGGATGTCAATATGCATATCAGGA-3'(SEQ ID NO：40),

N8 capture probe：5'-ATTGTGTGATGCTAAGGGTTTCG-3'(SEQ ID NO：41),

N9 capture probe：5'-TTTCAATAACTTAACTAAAGGGCTC-3'(SEQ ID NO：42).

6. a kind of kit for detecting influenza A virus, which is characterized in that the kit includes described in claim 1 draws Object is to group.

7. kit as claimed in claim 6, which is characterized in that further include signal probe group as claimed in claim 4；With/ Or, the kit further includes capture probe group described in claim 5.

8. a kind of method for detecting influenza A virus, which is characterized in that the method includes the steps：

(2) step (1) obtained RNA is extracted to be separately added into the PCR pipe equipped with the first reaction solution and the second reaction solution, into Row reverse transcription simultaneously carries out multiple asymmetric PCR amplification, obtains the first pcr amplification product and the second pcr amplification product respectively；

It wherein, include the first primer in first reaction solution to collection；Draw in second reaction solution including described second Object is to collection；

(3) PCR product hybridization check

First pcr amplification product and the second pcr amplification product are mixed, then are added to electrochemistry after mixing with electrochemical hybridization liquid In detection chip, detected in Electrochemistry gene chip.

9. method according to claim 8, which is characterized in that the electrochemical hybridization liquid includes：Electrochemical hybridization liquid I, NBS Buffer and NaClO₄, wherein electrochemical hybridization liquid I includes signal probe group as claimed in claim 4 and MES buffer.

10. method according to claim 8, which is characterized in that the Electrochemistry gene chip includes described in claim 5 Capture probe group.