CN108588090A - Peach transcription factor PpERF.A16 genes, albumen, its recombinant expression carrier and application - Google Patents

Abstract

The invention discloses peach transcription factor PpERF.A16 and its applications.The gene belongs to ERF family members, and nucleotides sequence is classified as shown in sequence table SEQ ID NO.1, and coding region sequence length is 966bp, encodes 321 amino acid, the amino acid sequence of coding is shown in sequence table SEQ ID NO.2.On the basis of genome and RNA SEQ analyses, Synthesis pathway gene, 1 amino-cyclopropane, 1 carboxyl synthase and oxidizing ferment and AP2/ERF transcription factors are carried out dividing the analysis of variance.Through biological function verification, show that PpERF.A16 genes have the function of promoting ethylene synthase.The discovery of PpERF.A16 genes, to promote the molecular breeding of ethylene synthase to provide new genetic resources, new genetic resources is provided to implement green agriculture, the advantageous commodity value and the market competitiveness for improving Peach fruits of utilization of the resource, the shelf life of extending fruit advantageously reduces agricultural cost and realizes environmental-friendly.

Description

Peach transcription factor PpERF.A16 genes, albumen, its recombinant expression carrier and application

Technical field

The present invention relates to peach transcription factor PpERF.A16 genes, albumen, its recombinant expression carrier and applications, belong to plant Genetic engineering field.

Background technology

Fruit maturation refers to a series of orderly mistake of complexity of the biochemical reactions occurred after fruit development stopping Journey, color and luster, flavor, fragrance, quality etc. are many-sided mostly to change, and fruit maturation directly influences the commodity valence of fruit Be worth, adopt after store and the market competitiveness.(Giovannoni, 2004；Li et al., 2010；Tian Shiping, 2013).According to fruit Whether there is climacteric in maturation, be divided into climacteric type and breathe non-transition type (Leli E Vre J, 1997).The respiratory intensity in ripening of fruits such as tomato, apple, banana, peach rises suddenly, and acetate releasing quantity increases, and is Transition type fruit.Respiratory intensity and the acetate releasing quantity in maturation such as grape, citrus, strawberry lemon do not significantly rise, It is non-transition type fruit.

Ethylene is a kind of important endogenous hormones in plant.The process of fruit development and maturation all has with ethylene close Cut relationship.Ethylene synthase Basic Ways：Methionine (Methionine, Met) → S-adenosylmethionine (S- Adenosylmethionine, SAM) → 1- amino-cyclopropane -1- carboxylic acids (1-amino cyclopropane-1- Carboxylic acid, ACC) → ethylene.Wherein, ACC synzyme (ACS) and ACC oxidizing ferment (ACO) are two key enzymes. (Hoffman et al, 1984；Yin Xueren, 2009；Han Yanchao, 2016).The maturation of climacteric type fruit is with a large amount of second Alkene discharges.After ethylene generates, the road of its signal transduction is opened immediately.Ethylene is combined (ETR) with receptor first, and ERF further swashs The triple response (CTR) of the ethylene in downstream living, EIN2 (Ethylene insensitive 2) and EIN3/EILs (Ethylene Insensitive 3/Ethylene insensitive 3-like) it is located at the downstreams CTR, it is in the dilute signal transduction path of second It is positive to adjust the factor, it can be in conjunction with the transcription factor (ERF TFs) of ethylene responses factor ethylene response factor (ERF) Upstream region (Alexander and Grierson 2002；Guo and Ecker 2003；Solano et al.1998,Gu et al.2017).ERF is regulatory factor last in ethylene signaling approach, can be in conjunction with multiple ethylene responses genes Promoter, to regulate and control ethylene reaction.

ERF families are the distinctive transcription factors of plant, are widely present in plant.It is reported that ERF transcription is in plant Growth and development, fruit maturation, metabolism and it is degeneration-resistant during play an important role.It is mainly characterized by containing nuclear location Signal has the function of ERF/AP2 structural domains, the transcriptional control of DNA binding functions.ERF families are divided into 5 sub- families in arabidopsis Race：ERF, AP2, DREB, RAV and other. (Sakuma et al.,2002).ERF albumen can pass through spy as transcription factor Cis-acting elements GCC-box, DRE/CRT of anisotropic combination promoter carry out expression (the Ohme-Takagi and of controlling gene Shinshi, 1995；Solano et al.,1998；Xiao et al., 2013. Han Yan are super, and 2016).At present in tomato, perfume (or spice) Any of several broadleaf plants, apple, papaya, longan have been reported that ERF as ethylene signaling approach most in the ripening of fruits such as Kiwi berry Regulatory factor afterwards, can be with direct regulation and control downstream gene, such as ACO, ACS, PG, EXP and PSY (Han et al.2016；Lee et al.2012；Liu et al.2014.).In tomato, Tournier et al. isolates 5 ERF bases from tomato earliest Cause, i.e. LeERF1~LeERF4 and LeERF3b (Tournier et al., 2003).Et al. Zhang. LeERF2 is had been verified that It can regulate and control in conjunction with the GCC-box in LeACO3 gene promoters and promote ethylene synthase (Zhang et al., 2009)； In apple, MdERF3 can promote the transcriptional expression of MdACS2, MdERF2 that MdACS2 and MdERF3 can directly be inhibited to express； (Li et al.,2016)；In papaya, found by carrying out q RT-PCR analyses to ERFs, CpERF2 and CpERF3's Expression changes clearly in papaya maturing course, illustrates that they are closely connected with papaya fruit maturation (Li et al.,2013)；In banana, MaERF9 and MaERF11 can be by combining GCC-box cis actings in MaACO promoters Element respectively facilitates and inhibits the expression (Xiao et al., 2013) of MaACO.Chinese patent literature CN107686840A is disclosed The Py ERF3 genes that separation clone obtains from pears, the biosynthesis for promoting the operatic circle skin anthocyanin.Chinese patent text Offer the crucial ethylene responses factor CitERF6 that CN106047890A discloses regulation and control orange peel removing green, controllable chlorophyll drop Solution.

Currently, the research for Peach fruits mature trait is also relatively fewer, it is only involved in the PG of regulating peach fruit softening character (polygalacturonase, polygalacturonase) gene and the ethylene upstream for participating in regulating peach fruit maturation character are closed Preliminary confirmation has been obtained at Gene A CS and ACO.And the other structural genes and transcription factor consistent with Peach fruits maturation phenotype are extremely The present there is no report.Therefore, this research by genome to AP2/ERF gene families and transcript profile data and PG, ACS and The analysis of ACO gene families, it is intended to isolate the ERF genes of regulating fruit maturation.In addition, passing through agriculture bacillus mediated instantaneous robin Silence and overexpression have been carried out to the ERF genes in Peach fruits, and the interaction of itself and ripe related gene has been ground Study carefully.

Invention content

It is an object of the present invention to provide a kind of and relevant peach transcription factor PpERF.A16 genes of fruit maturation, belong to ERF house Family member, for nucleotide sequence as shown in SEQ ID NO.1, coding region sequence (CDS) length is 966bp, encodes 321 ammonia Base acid, its amino acid sequence of the albumen of coding is as shown in SEQ ID NO.2, isoelectric point 5.05, molecular weight 79.72KD.

The present invention also provides the recombinant expression carriers containing PpERF.A16 genes of the present invention.

The recombinant expression carrier is preferably the carrier that sets out with pCAMBIA1301, and the PpERF.A16 genes are inserted Access point is between Xbal and HindIII.

The present invention also provides the host strains containing PpERF.A16 genes of the present invention.

And the primer pair of the cDNA sequence of clone's PpERF.A16 genes of the present invention, sense primer PpERF.A16- F1 sequences are as shown in SEQ ID NO.3, and downstream primer PpERF.A16-R1 sequences are as shown in SEQ ID NO.4.

It is a further object of the present invention to provide the applications of the gene.

Include application of the PpERF.A16 genes in promoting peach ethylene synthase.

And application of the recombinant expression carrier in promoting plant ethylene synthase.

QRT-PCR analyses are carried out using software and transcript profile data phylogenetic tree construction and to related gene.

It is analyzed using qRT-PCR technologies, PpACS.A1, PpACO.A1 and PpERF.A16 are related with fruit maturation.

PpERF.A16 overexpression vectors and silent carrier are built, by showing in agriculture bacillus mediated instantaneous conversion Peach fruits The overexpression and silence of pPr.A16 increases separately and reduces PpACS.A1, the ethylene yield and expression of PpACO.A1 genes.

PpERF.A1 and PpACS.A1 are analyzed using dual-luciferase reporter system, PpACO.A1 genes are mutually done Relationship, the results showed that the promoter of PpERF.A1 and PpACS.A1, PpACO.A1 gene interacts.

Using yeast one-hybrid analysis disclose PpERF.A1 by combine they promoter mediate PpACS.A1 and PpACO.A1 is expressed.

Compared with the prior art, the present invention has the following advantages and effects：

The discovery of PpERF.A16 genes, it is green to implement to promote the molecular breeding of ethylene synthase to provide new genetic resources Color agricultural provides new genetic resources, and the utilization of the resource are conducive to improve the commodity value of Peach fruits, extending fruit goods The frame phase advantageously reduces agricultural cost and realizes environmental-friendly.

Description of the drawings

Fig. 1 is the systematic evolution tree of the ACS genes in peach, apple, strawberry, pawpaw, citrus and grape.

Fig. 2 is the systematic evolution tree of the ACS genes in peach, apple, strawberry, pawpaw, citrus and grape.

Fig. 3 be isolated from peach, apple, strawberry, papaya, orange and grape the systems of AP2/ERF transcription factors into Change tree.

Fig. 4 is the response of ACS gene pairs Peach fruits maturation

(A) expression analysis of peach ACS genes；

(B) qRT-PCR detects the expression of PpPACS.A1 before and after fruit maturation；

Standard error and variance analysis are examined by t to be calculated.There were significant differences in the level of P values ＜ 0.01 for double star representative. NS and ZH is two cultivars of South Mountain sweet tea peach and morning sunlight, and S1, S2, S3 and S4 are fruitlet, Shi Jian, maturation, the stage of ripeness respectively Fruit.

Fig. 5 is the chromosome mapping of ACS genes.

Fig. 6 is the response of ACO gene pairs Peach fruits maturation

(A) expression analysis of peach ACO genes；

(B) qRT-PCR detects the expression of PpACO.A1.1.1 and PpACO.A3 before and after fruit maturation.

Fig. 7 is the chromosome mapping of ACO genes.

Fig. 8 is the identification of ERF genes in Peach fruits maturation

(A) expression analysis for the ERF genes being separated to from peach；

(B) qRT-PCR detects the expression of PpERF.A16, PpERF.A29 and PpERF.A31.1 in fruit before and after maturation It is horizontal.

Fig. 9 is the chromosome mapping of ERF genes.

Figure 10 is that clone gene PpERF.A16 of the present invention overexpressions and silent carrier are invaded by Agrobacterium instantaneous conversion respectively Acetate releasing quantity analyzes schematic diagram after contaminating Peach fruits.

Figure 11 is that clone gene PpERF.A16 of the present invention overexpressions and silent carrier are invaded by Agrobacterium instantaneous conversion respectively The qRT-PCR expression analysis figures of PpERF.A16 and PpACS.A1, PpACO.A1.1 after dye Peach fruits.Lowercase a, b, c generation The significant difference of table P values ＜ 0.05.

Figure 12 is clone gene PpERF.A16 of the present invention and GCC-box phases in PpACS.A1, PpACO.A1.1 promoter In conjunction with schematic diagram.

Figure 13 be dual-luciferase reporter system analyze clone gene PpERF.A16 to PpACS.A1, The adjustment effect of PpACO.A1.1 promoters.Wherein nine bioautographies are used for dual-luciferase assay.Lowercase a and b generation The significant difference of table P values ＜ 0.05.

Interactions of the Figure 14 between the miscellaneous experimental result PpERF.A16 of yeast list and PpACS.A1, PpACO.A1.1.

Specific implementation mode

The present invention is described in detail below in conjunction with specific embodiment.According to being described below and embodiment, this field It, can be right in the case that technical staff can determine the essential characteristic of the present invention, and love is without departing from spirit and scope of the invention The present invention makes various changes and modifications, so that it is applicable in various uses and condition.

1 phylogenetic tree construction of embodiment and related gene qRT-PCR analyses

1, from peach genome database (Rosaceae, http://www-RuxaA.Org) and other fruit trees (including apple, Strawberry, papaya, orange and grape) (http://PosiZoM.jig.doe.gov) download ACS, ACO and ERF family member Nucleotide sequence and amino acid sequence.All genes are in American National biology information technology center (NCBI；HTTPS:// Www.NcB.NLM.NIH.GOV/ it is predicted in), and predicted gene is classified.The amino acid sequence downloaded passes through CulsTAL X alignment uses phylogenetic tree of the structures of software MEGA 6 based on adjacent (NJ).The result shows that：

1.1 detect 6 ACS gene family members from peach genome, can be divided into tri- groups of A, B, C, A and C groups are by two A subgroup forms (Fig. 1).These genes are named as PpACS.A1, PpACS.A2, PpACS.B1, PpACS.B2, PpACS.C1 With PpACS.C2 (table 1).

1.2 are separated to 36 ACO gene family members from peach genome, can be divided into tri- groups of A, B and C, every group of difference Including 7,2,7 subgroups (Fig. 2), and by these unnamed genes (table 2).

1.3 obtain 106 AP2/ERF transcription factors from peach genome, can be divided into two groups of A, B, A groups with by 56 cluster groups At subfamily ERF it is identical, B groups include subfamily AP2, RAV and soloist, form (Fig. 3) by 5,1,5 clusters respectively.

2, according to transcript profile data, using two kinds of South Mountain sweet tea peach and morning sunlight, fruit development period (S1-S3) and at ACS, ACO and AP2/ERF gene are analyzed in ripe (S4) delayed early transcription level.

2.1 in two kind South Mountain sweet tea peaches and morning sunlight PpACS.A1 in the expression quantity of fructescence than fruit give birth to Long budding expression quantity is wanted high (Fig. 4 A).In addition, qRT-PCR detections show that in all 12 Peach cultivars, PpACS.A1 exists Expression in fruit maturation is higher than the expression (Fig. 4 B) of fruit maturation early period.These results indicate that being positioned at No. 2 PpACS.A1 (Fig. 5) on chromosome is related with Peach fruits maturation.

2.2 expression analysis show in two kinds of South Mountain sweet tea peach and morning sunlight, two gene PpACO.A1.1.1 and PpACO.A3 is higher than fruit development phase expression quantity in the expression quantity of fructescence, shows that the two genes may participate in fruit Real maturation (Fig. 6 A).However, qRT-PCR detections show to find the expression water of PpACO.A3 in the ripening fruits of 12 kinds Flat higher, the interim PpACO.A1.1.1 expressions of fruit maturation are higher than the expression (Fig. 6 B) before fruit maturation.Therefore, The PpACO.A1.1.1 genes (Fig. 7) being positioned on No. 3 chromosome are related with Peach fruits maturation.

2.3 expression analysis show in two kind South Mountain sweet tea peaches and morning sunlight, three ERF genes PpERF.A16, Expression quantity of the PpERF.31.1 and PpERF.A29 in ripening fruits is above the expression quantity (Fig. 8 A) of fruit development period, shows These three genes may be related with fruit maturation.However, qRT-PCR detections show to find in the ripening fruits of 12 kinds, PpERF.31.1 is similar with the interim expression of fruit maturation in fruit maturation early period with PpERF.A29, and PpERF.A16 is in fruit Real mature period expression quantity is higher than fruit maturation early period (Fig. 8 B).Therefore, it is located at PpERF.A16 (the figures of the 8th end of chromosome 9) it is likely to participate in adjusting fruit maturation.

Embodiment 2PpERF.A16 Gene Isolations are cloned and vector construction

1, TIANGEN companies (are purchased from, according to kit using the plant total RNA extraction reagent box of polyphenol polysaccharose substance Specification operates) extracting RNA from the pulp of peach, the first chain cDNA obtained through reverse transcription is for expanding PpERF.A16 genes Overall length.Amplification gene primer pair is：PpERF.A16-F1：(SEQ ID NO.3)；PpERF.A16-R1：(SEQ ID NO.4). The reaction system of 50ul includes the above-mentioned primers of 2ul, 17ul ddH2O, 25ul 2 × Buffer, 1ul dNTP, 2ul cDNA moulds Plate, 1ul high fidelity enzymes (Phanta Super-Fidelity DNA Polymerase) (are purchased from Vazyme companies).PCR reacts It is completed by following procedure on eppendor pcr amplification instruments：95 DEG C, pre-degeneration 3 minutes, 95 DEG C are denaturalized 30 seconds, 60 DEG C of annealing 30 seconds, 72 DEG C extended 1 minute, 30 thermal cycles, extended 10 minutes for 72 DEG C after the completion of cycle, 20 DEG C 5 minutes.

2, PCR product returns the purpose band of generation according to AxyPrep DNA gels after 1% agarose gel electrophoresis Receive kit specification operation recycling.PCR product after recovery purifying and XbaI and HindIII double digestions is used to complete PCAMBIA1301 is recombinated by recombinase and (is purchased from Vazyme companies), and recombination system is according to one-step cloning recombination kit Specification operates.Recombinant products are used into thermal shock method (reference《Molecular cloning experiment handbook》The third edition, Science Press, 2002) Bacillus coli DH 5 ɑ is converted, is evenly coated on the LB solid plates containing 50mg/L card Na mycins, screening positive clone, picking 6 A positive colony sequencing.Sequencing result shows that the target fragment length that the present invention expands is 966bp, and nucleotides sequence is classified as sequence Shown in list SEQ ID NO.1.By sequence alignment analysis, determine that the sequence is the target gene that the present invention needs.

Embodiment 3PpERF.A16 genes overexpress and the structure of silent carrier

1, according to the digestion on the coding region sequence of the multiple cloning sites of pCAMBIA-1301 carriers and PpERF.A16 genes Locus Analysis in Shoots selects XbaI and HindIII as restriction endonuclease.According to being typically designed 5.0 Software for Design of primer principle Primer Go out to carry the primer of restriction enzyme site, primer pair sequence is as follows：

PpERF.A16-F1：ttggatccAGGAATGTGTGGCGGTGCTAT(SEQ ID NO.3)

PpERF.A16-R1：aatctagaTTACGGAGCAGAAACGCGGTCG(SEQ ID NO.4)

Bacterium solution extraction plasmid is correctly preserved as template to be sequenced, and carries out gram containing restriction endonuclease sites gene It is grand.The annealing temperature of PCR amplification is 60 DEG C, and PCR reaction systems and amplification program are the same as embodiment 1.PCAMBIA-1301 carriers are used Double digestion is carried out with two enzymes (being purchased from NEB companies), digestion total system is 50ul：Vector plasmid 5ul, CutSmart Buffer Buffer solution 5ul and each 1ul, ddH₂O 38ul.It is put in 37 DEG C of digestions 3-4 hours, digestion products AxyPrep cleaning agents boxes It is purified.(operating process carries out to specifications).By PCR product and double digestion product recombination connection after purification, and convert Bacillus coli DH 5 ɑ is evenly coated on the LB solid plates containing 50mg/L card Na mycins, screening positive clone, extracting plasmid into Row digestion and PCR identifications, sequencing result determine no reading frame mutation, obtain the recombinant vector containing Insert Fragment, ordered Entitled overexpression vector pCAMBIA1301-PpERF.A16.Recombinant plasmid is imported in Agrobacterium EHA105 using freeze-thaw method.

2, according to the restriction enzyme site on the coding region sequence of the multiple cloning sites of PSAK-277 carriers and PpERF.A16 genes Analysis, selects KpnI and XbaI as restriction endonuclease.Design primer method and structure PSAK277-RNAi-PpERF.A16 silences carry Body method is same as above.And silent carrier plasmid is transferred to using electrization in Agrobacterium GV3101.

The primer with restriction enzyme site is designed, primer pair sequence is as follows：

PpERF.A16-F2：ccgaattcAGGGGTTGACCTCCATGAATCTTGT(SEQ ID NO.5)

PpERF.A16-R2：tcggtaccAGAGATCACCAACCATGCCTT(SEQ ID NO.6)

The instantaneous conversion of 4 Peach fruits of embodiment

The Agrobacterium single bacterium of picking pCAMBIA1301-PpERF.A16 containing overexpression vector is fallen within containing kanamycins respectively With in the fluid nutrient medium of rifampicin resistance, the Agrobacterium single bacterium of silent carrier PSAK277-RNAi-PpERF.A16 falls within and contains In the fluid nutrient medium for having spectinomycin and rifampicin resistance, while with the agriculture of pCAMBIA1301 containing empty carrier and PSAK277 Bacillus is control.28 DEG C, 220rpm cultivates 24-48h.Then, by each Agrobacterium in the triangular flask of the fluid nutrient medium containing 40ml It is 0.8-1.0 that expansion, which is cultivated to OD600,.Under the conditions of 4 DEG C of centrifuge, 5000g is centrifuged 10 minutes, is abandoned supernatant and is collected bacterium solution, then It is resuspended in and infects in liquid (MES, pH=5.7,200 μM of acetosyringones of 10mM Mgcl2,10mM), 5000g, centrifugation 10 Minute, it abandons supernatant and collects bacterium solution, and be repeated once.Finally the small shaking tables of TY-80B every point of (the general sun in Nanjing) are placed with infecting liquid and suspend Clock 60rpm shakes 3h, stands 1h.

3, above-mentioned each bacterium solution 1ml syringes injection Peach fruits rosy clouds sunshine 6 is taken, Peach fruits are harvested first 7 days in commodity and received Collection.All analyses are all to repeat to obtain by three biology, and each biology repeats to include at least four Peach fruits.

The table of PpERF.A16, PpACS.A1 and PpACO.A1.1 in embodiment 5qRT-PCR analysis instantaneous conversion Peach fruits Up to level

The pulp that bacterium covers is taken to carry out qRT-PCR detections.Examination is extracted using the plant total serum IgE of polyphenol polysaccharose substance Agent box (being purchased from TIANGEN companies, operate according to kit specification) extracting RNA from the peach pulp infected in case 3, warp Reverse transcription obtains cDNA.QRT-PCR is carried out in LigthtCycler 480II/96 thermal cycles.Kit is 96 orifice plate Jun You Roche companies of LightCycler 480SYBR Green I Master and qPCR provide.QPCR reactants System：SYBR Green I Master 10ul, ddH20 4ul, forward primer 2.5ul, reverse primer 2.5ul, cDNA 1ul.Instead The program is answered to be:95 DEG C of denaturation 15s, 60 DEG C of annealing 30s, 45 recycle.All analyses have been repeated by three independent biology At.Peach Ppa008668m genes are as reference gene.All primer sequences are all in table 3.QRT-PCR results are shown in injection The expression quantity of PpACS.A1 and PpACO.A1.1 rises (Figure 10) in the pulp of the overexpression vector containing PpERF.A16, is injecting The expression quantity of PpACS.A1 and PpACO.A1.1 declines (Figure 11) in the pulp of the silent carrier containing PpERF.A16.These result tables Bright, pERF.A16 can mediate Synthesis pathway by stimulating the activity of pPACS.A1 and PpACO.A1.

6 ethylene of embodiment measures

The burst size of the fruit ethylene each infected using ethylene detector measurement (is purchased from Shenzhen Puli's energization scarabaeidae Skill Co., Ltd).It is small to be independently placed into one 3 liters of vapor tight tank 3 at least six Peach fruits infected at room temperature When, then jar is sealed with cork, gas is conveyed with hose.After carrying out zero calibration to ethylene detector, probe It is connect with hose to receive the gas of release.The ethylene yield of release is measured, and concentration is shown on a monitor.As a result it shows Inject peach of the burst size higher than injection silent carrier containing PpERF.A16 of the Peach fruits ethylene of the overexpression vector containing PpERF.A16 The burst size of fruit ethylene.(Figure 12) shows that PpERF.A16 has the function of promoting ethylene synthase.

7 protoplast electrofusion of embodiment and Dual-Luciferase measure

1, ACS and ACO promoter codons upstream 2000bp sequences are expanded from No. 6 pulp of peach rosy clouds sunshine, amplified production is inserted Enter into PGRILII0800-LUC carriers, and builds PGRILII0800-LUC-ACS and PGRILII0800-LUC-ACO two Carrier.The method of carrier construction is the same as embodiment 2.

Amplimer sequence is

PpACS.A1-F：tgggtaccTGCAGTATGTCCGTTCCTTGGC(SEQ ID NO.7)

PpACS.A1-R：tcaagcttGGTTCCAAAGAATACTCACACACAAG(SEQ ID NO.8)

PpACO.A1.1-F：tgggtaccAAGAGACATATCAGGTGATGAAAGAACG(SEQ ID NO.9)

PpACO.A1.1-R：tcaagcttGTGAAGTGGAGTTTGGTGTGG(SEQ ID NO.10)

2, the protoplast extracted from the plant of the daily illumination 8 hours of 3 to 5 week old.Recombinant plasmid is transferred to primary Plastid light culture 18 hours.Use Dual-LuciferaseReport analysis system (being purchased from PROMEGA companies) is to being transferred to recombination matter The protoplast of grain is handled and (is carried out according to kit specification concrete operations), is carried out carrying out fluorescence intensity inspection with microplate reader It surveys.It is measured in three independent experiments, each three biology of experiment repeat (n=9).The result shows that PpERF.A1 and The promoter interaction (Figure 13) of PpACS.A1, PpACO.A1.1 gene.

8 yeast one-hybrid of embodiment

From cloning the sequence for having cloned 2 treaty 2000bp in ACS and ACO gene promoters in peach pulp.Predict GCC- Box elements.It will be in the segment connection pAbAi carriers containing GCC-box.Meanwhile by the overall length sequence of the PpERF.A16 genes of separation Row are inserted into pGADT7 carriers.Yeast one-hybrid (Y1H) detection is carried out using yeast one-hybrid library screening system.As a result Show PpERF.A1 by combining the promoter of PpACS.A1 and PpACO.A1 that it is mediated to express (Figure 14).All primers exist It is listed in table 4.

Table 1：The ACS genes detached in peach

Table 2：The ACO genes detached in peach

Table 3：The primer of peach qPCR

Gene	Forward primer(5’→3’)	Reverse primer(5’→3’)
			PpACS.A1	GAGTTCAGAAAGGCTGTGGCTATG	ATCCCAAGTCTCGGTAAAATGCT
PpACO.A1.1	AGGTCAATGATATGGACTGGGAAAG	AGGGTTGGGACAAGGAGGGTAG
			PpERF.A16	GGGGTTCGAGTTTGGCTTGGT	GGAATGTCGTCGTCTTCGTTGG
Internal reference	AAGGCTAAGATCCAAGACAAAGAG	CCACGAAGACGAAGCACTAAG

Table 4：The primer of vector construction

Bibliography

[1]Giovannoni J J.Genetic regulation of fruit development and ripening[J].Plant Cell, 2004,16Suppl(suppl_1):S170.

[2]Xian L,Xu C J,Korban S S,et al.Regulatory mechanisms of textural changes in ripening fruits.[J].Critical Reviews in Plant Sciences,2010,29(4): 222-243.

[3] molecular regulation mechanism [J] Botany Gazettes of Tian Shiping fruit maturations and aging, 2013,48 (5):481- 488.

[4] Fan Zhongqi, Kuang Jianfei, Lu Wangjin wait transcription factor regulating fruit maturations and Progress in Studies of Aging Mechanism [J] Gardening journal, 2015,42 (9):1649-1663.

[5]Leli E Vre J,Latche A,Jones B,et al.Ethylene and fruit ripening.Trends in Genetics,1997,101(4):727-739.

[6]Yang S F,Hoffman N E.Ethylene biosynthesis and its regulation in higher plants[J]. Annual Review of Plant Physiology,1984,35(1):155-189.

[7] Yin Xueren, Zhang Bo, Lee is fresh, waits progress [J] gardening of ethylene signalings and fruit maturation aging Report, 2009,36 (1):133-140.[J].

[8] the super histon deacetylase (HDAC)s of Han Yan participate in the banana maturation Mechanism Study of ERF transcription regulation and control [D] Agricultural University Of South China, 2016.

[9]Alexander L,Grierson D.Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening.[J].Journal of Experimental Botany, 2002,53(377):2039-2055.

[10]Guo H,Ecker J R.Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EIN3transcription factor.[J].Cell, 2003, 115(6):667-77.

[11]Solano R,Stepanova A,Chao Q,et al.Nuclear events in ethylene signaling:a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3and ETHYLENE-RESPONSE-FACTOR1.[J].Genes Dev,1998,12(23):3703-3714.

[12]Gu C,Guo Z H,Hao P P,et al.Multiple regulatory roles of AP2/ERF transcription factor in angiosperm[J].Botanical Studies,2017,58(1):6.

[13]Nakano T,Suzuki K,Fujimura T,et al.Genome-Wide Analysis of the ERF Gene Family in Arabidopsis and Rice[J].Plant Physiology,2006,140(2):411.

[14]Sakuma Y,Liu Q,Dubouzet J G,et al.DNA-Binding Specificity of the ERF/AP2 Domain of Arabidopsis,DREBs,Transcription Factors Involved in Dehydration-and Cold-Inducible Gene Expression[J].Biochemical&Biophysical Research Communications, 2002,290(3):998-1009.

[15]Ohmetakagi M,Shinshi H.Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element.[J].Plant Cell,1995,7(2): 173-182.

[16]Xiao Y,Chen J,Kuang J,et al.Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes[J].Journal of Experimental Botany,2013,64(8):2499.

[17]Han Y C,Fu C C,Kuang J F,et al.Two banana fruit ripening-related C2H2zinc finger proteins are transcriptional repressors of ethylene biosynthetic genes[J].Postharvest Biology&Technology,2016,116:8-15.

[18]Je Min Lee,Je-Gun Joung,Ryan McQuinn,et al.Combined transcriptome,genetic diversity and metabolite profiling in tomato fruit reveals that the ethylene response factor SlERF6 plays an important role in ripening and carotenoid accumulation[J].The Plant Journal, 2012,70(2):191- 204.

[19]Liu M,Diretto G,Pirrello J,et al.The chimeric repressor version of an Ethylene Response Factor(ERF)family member,Sl-ERF.B3,shows contrasting effects on tomato fruit ripening.[J].New Phytologist,2014,203(1):206-218.

[20]Tournier B,Sanchezballesta M T,Jones B,et al.New members of the tomato ERF family show specific expression pattern and diverse DNA-binding capacity to the GCC box element.[J].Febs Letters,2003,550(1-3):149-154.

[21]Zhang Z,Zhang H,Quan R,et al.Transcriptional Regulation of the Ethylene Response Factor LeERF2 in the Expression of Ethylene Biosynthesis Genes Controls Ethylene Production in Tomato and Tobacco[J].Plant Physiology, 2009,150(1):365-377.

[22]Li T,Jiang Z,Zhang L,et al.Apple(Malus domestica)MdERF2 negatively affects ethylene biosynthesis during fruit ripening by suppressing MdACS1 transcription[J].Plant Journal,2016,88(5):735-748.

[23]Xueping L,Xiaoyang Z,Jia M,et al.Isolation and characterization of ethylene response factor family genes during development,ethylene regulation and stress treatments in papaya fruit[J].Plant Physiol Biochem, 2013,70(14):81-92.

[24]Xiao Y,Chen J,Kuang J,et al.Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes[J].Journal of Experimental Botany,2013,64(8):2499。

Sequence table

<110>Jiangsu Province Agriculture Science Institute

<120>Peach transcription factor PpERF A16 genes, albumen, its recombinant expression carrier and application

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 966

<212> DNA

<213>Flowering peach (Prunus persica)

<400> 1

atgtgtggcg gtgctattct ctctaatctc atccctcgca accgtggcct tcgtgtcacc 60

gcctccgaca tatggcccaa ttctcccttc gctaagctca atcccgacaa tttcttcgac 120

tacaatccca gcccactcac tcgtaccgac tcatccccac gcaaaagagc ccaacccact 180

tcaggtaacc ggcaagaaga gaagcccccc aagagggcga ggaagaacct ctaccgaggc 240

atcaggcagc gtccgtgggg caaatgggcc gcggagattc gtgatcccag aaaaggggtt 300

cgagtttggc ttggtacctt caacacccct gaagaggcag ccagagctta cgatagggag 360

gctcgcaaaa tccgcggtaa gaaagccaag gtcaatttcc ccaacgaaga cgacgacatt 420

cccacccaaa cgtatctgag aaaccccaat cctccttctc tgtttcaaac cagtagcgag 480

aatttgagta atagtcatat gccaaaaagc tttgatttgg gatttgggta tgatctaaac 540

cagattgcaa caatttcctc caattccaat tccaaggggt tgagctccat gaatcttgtg 600

aacactgacc caactgttat ttcgggggaa gaaaactccg ggtctggttc agatggcgct 660

tactcttcga cggcggggct actgggttgc aatcagaatg ggagcagctg ttgttatggt 720

gaagctgagg tgaaagagct agaggaaacg aaagaaggga tattgaataa ggatgcgatt 780

gcaatcatgg aagagaacga agtgcaaaag ctttctgagg agctaatggc gtacgagaac 840

atgatgaaat tctatcagat tccctatctg gacgggcagt ccacagctac ccagcatcct 900

ccagctcagg aaggcatggt tggtgatctc tggagcttcg atgacgaccg cgtttctgct 960

ccgtaa 966

<210> 2

<211> 321

<212> PRT

<213>Flowering peach (Prunus persica)

<400> 2

Met Cys Gly Gly Ala Ile Leu Ser Ala Leu Ile Pro Ala Ala Ala Gly

1 5 10 15

Leu Ala Val Thr Ala Ser Ala Ile Thr Pro Ala Ser Pro Pro Ala Leu

20 25 30

Leu Ala Pro Ala Ala Pro Pro Ala Thr Ala Pro Ser Pro Leu Thr Ala

35 40 45

Thr Ala Ser Ser Pro Ala Leu Ala Ala Gly Pro Thr Ser Gly Ala Ala

50 55 60

Gly Gly Gly Leu Pro Pro Leu Ala Ala Ala Leu Ala Leu Thr Ala Gly

65 70 75 80

Ile Ala Gly Ala Pro Thr Gly Leu Thr Ala Ala Gly Ile Ala Ala Pro

85 90 95

Ala Leu Gly Val Ala Val Thr Leu Gly Thr Pro Ala Thr Pro Gly Gly

100 105 110

Ala Ala Ala Ala Thr Ala Ala Gly Ala Ala Leu Ile Ala Gly Leu Leu

115 120 125

Ala Leu Val Ala Pro Pro Ala Gly Ala Ala Ala Ile Pro Thr Gly Thr

130 135 140

Thr Leu Ala Ala Pro Ala Pro Pro Ser Leu Pro Gly Thr Ser Ser Gly

145 150 155 160

Ala Leu Ser Ala Ser His Met Pro Leu Ser Pro Ala Leu Gly Pro Gly

165 170 175

Thr Ala Leu Ala Gly Ile Ala Thr Ile Ser Ser Ala Ser Ala Ser Leu

180 185 190

Gly Leu Ser Ser Met Ala Leu Val Ala Thr Ala Pro Thr Val Ile Ser

195 200 205

Gly Gly Gly Ala Ser Gly Ser Gly Ser Ala Gly Ala Thr Ser Ser Thr

210 215 220

Ala Gly Leu Leu Gly Cys Ala Gly Ala Gly Ser Ser Cys Cys Thr Gly

225 230 235 240

Gly Ala Gly Val Leu Gly Leu Gly Gly Thr Leu Gly Gly Ile Leu Ala

245 250 255

Leu Ala Ala Ile Ala Ile Met Gly Gly Ala Gly Val Gly Leu Leu Ser

260 265 270

Gly Gly Leu Met Ala Thr Gly Ala Met Met Leu Pro Thr Gly Ile Pro

275 280 285

Thr Leu Ala Gly Gly Ser Thr Ala Thr Gly His Pro Pro Ala Gly Gly

290 295 300

Gly Met Val Gly Ala Leu Thr Ser Pro Ala Ala Ala Ala Val Ser Ala

305 310 315 320

Pro

<210> 3

<211> 29

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

ttggatccag gaatgtgtgg cggtgctat 29

<210> 4

<211> 30

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

aatctagatt acggagcaga aacgcggtcg 30

<210> 5

<211> 34

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

ccgaattcag gggttgacct ccatgaatct tgtg 34

<210> 6

<211> 29

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

tcggtaccag agatcaccaa ccatgcctt 29

<210> 7

<211> 30

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

tgggtacctg cagtatgtcc gttccttggc 30

<210> 8

<211> 34

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

tcaagcttgg ttccaaagaa tactcacaca caag 34

<210> 9

<211> 36

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

tgggtaccaa gagacatatc aggtgatgaa agaacg 36

<210> 10

<211> 29

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

tcaagcttgt gaagtggagt ttggtgtgg 29

Claims (8)

1. peach transcription factor PpERF.A16 genes, nucleotide sequence is as shown in SEQ ID NO.1.

2. the albumen of peach transcription factor PpERF.A16 gene codes described in claim 1, amino acid sequence such as SEQ ID Shown in NO.2.

3. the recombinant expression carrier containing PpERF.A16 genes described in claim 1.

4. recombinant expression carrier according to claim 3, it is characterised in that：Using pCAMBIA1301 as carrier, claim The insertion point of PpERF.A16 genes described in 1 is between Xbal restriction enzyme sites and HindIII restriction enzyme sites.

5. the host strain containing PpERF.A16 genes described in claim 1.

6. cloning the primer pair of PpERF.A16 gene cDNA sequences described in claim 1, sense primer PpERF.A16-F1 sequences Row are as shown in SEQ ID NO.3, and downstream primer PpERF.A16-R1 sequences are as shown in SEQ ID NO.4.

7. application of the PpERF.A16 genes described in claim 1 in promoting peach ethylene synthase.

8. application of the recombinant expression carrier described in claim 3 in promoting plant ethylene synthase.