CN102747091A - Chinese cabbage activating protein 2/ethylene responsive factor (AP2/ERF) transcription factor gene and application thereof - Google Patents
Chinese cabbage activating protein 2/ethylene responsive factor (AP2/ERF) transcription factor gene and application thereof Download PDFInfo
- Publication number
- CN102747091A CN102747091A CN2012102678000A CN201210267800A CN102747091A CN 102747091 A CN102747091 A CN 102747091A CN 2012102678000 A CN2012102678000 A CN 2012102678000A CN 201210267800 A CN201210267800 A CN 201210267800A CN 102747091 A CN102747091 A CN 102747091A
- Authority
- CN
- China
- Prior art keywords
- gene
- chinese cabbage
- tobacco
- transcription factor
- brerf11
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to a Chinese cabbage AP2/ERF transcription factor gene and applications thereof and belongs to the technical field of plant genetic engineering. A complementary deoxyribonucleic acid (cDNA) sequence of the gene is represented as SEQIDNo.1. The Chinese cabbage AP2/ERF transcription factor gene is applied in nightshade tobacco bacterial wilt-resisting genetic engineering. When transgenic tobacco is compared with wild tobacco, the overexpression of a Chinese cabbage brassinosteroid ethylene responsive factor 11 (BrERF11) gene in the tobacco can significantly improve the bacterial wilt-resisting ability of the transgenic tobacco, so that the Chinese cabbage AP2/ERF transcription factor gene has an important application value in the plant bacterial wilt-resisting genetic engineering and can promote the development of the tobacco bacterial wilt-resisting genetic engineering greatly.
Description
Technical field
The present invention relates to a kind of Chinese cabbage AP2/ERF transcription factor gene and application thereof, belong to the plant gene engineering technology field.
Technical background
Chinese cabbage (
Brassica rapaL.
Ssp. pekinensis) be one of most important brassicaceous vegetable in area, Asia.Its process of growth receives the influence of various diseases and abiotic stress easily; The environment that the undue dependence of agricultural chemicals and chemical fertilizer etc. is caused, the hidden danger of healthy aspect impel people to take more continuable, practicable countermeasure from genetic improvement, and this just need do more deep analysis and understanding to the degeneration-resistant molecular mechanism of Chinese cabbage from molecular level.
Plant is under the stimulation of extraneous environment-stress; Through the thickening of transcriptional activation defensive raction genes involved, inducing cell programmed death, cell walls, active oxygen bursts out, induce the series of defence reaction mechanism such as synthetic of anti-microbial type compound to keep self normal g and D (Reymond and Farmer, 1998; Glazebrook, 2001; Xiong et al., 2002; Apel and Hirt, 2004).Transcription factor can respond extraneous adverse circumstance to stimulate; Through with other interactions between protein or act on the cis-acting elements of specific gene and then regulate and control downstream defensive raction genes involved subtly and express timely and appropriately, participate in plant and reply in the physiological and biochemical procedure of adverse circumstance.Research to transcription factor helps disclosing the mechanism (Singh et al., 2002) that plant defense reaction resistance forms.Big quantity research shows, AP2 class transcription factor family member wide participation adverse circumstance signal transduction process (Sakuma et al., 2002 such as growth and development of plants and hormone, defence, low temperature, arid, high salt to pathogenic bacteria; Mine et al., 2003; Wu et al., 2007; Zhu et al., 2010).
Plant endogenous hormones such as Whitfield's ointment (salicylic acid; SA), jasmonic (jasmonic acid; JA) and ethene (ethylene, play an important role at the plant stress-resistance signal network (Kunkel and Brooks, 2002 of defensive raction coherent signal molecule such as ET); Bostock, 2005; Loake and Grant, 2007).ERF transcription factor family member plays important regulating and controlling effect in various plant hormone Mediated Signal Transduction approach networks.Research shows that the ERF transcription factor can be induced by ET and JA simultaneously, and involved in plant is to resistance of wide spectrum (Berrocal-Lobo et al., 2002 of pathogenic bacteria; Onate-Sanchez and Singh, 2002; Lorenzo et al., 2003).Part ERF transcription factor has also been participated in SA, JA/ET signal pathway simultaneously.As
AtERF1, tomato
ERFGene
Pti4And
Tsi1Receive SA simultaneously, JA, ET induces, and participates in corresponding signal path (Gu et al., 2000 as positive regulon; Park et al., 2001; Onate-Sanchez and Singh, 2002).In addition, the ERF transcription factor has also been participated in the disease-resistant signal transduction pathway an of the unknown.Overexpression
NtERF5Tobacco plant significantly strengthened to tobacco mosaic virus(TMV) (Tobacco mosaic virus, resistance TMV), and this expression of gene level does not receive SA, JA, ET influences (Fischer and Droge-Laser, 2004).But up to now; Function and Its Mechanisms to the ERF transcription factor also mainly concentrate on the minority model plants such as paddy rice, Arabidopis thaliana, tobacco, and the plant disease-resistant process of participating in for ERF transcription factor in the non-model plant Chinese cabbage and the research of regulation mechanism are also quite limited.
Summary of the invention
The purpose of this invention is to provide a kind of Chinese cabbage AP2/ERF transcription factor gene and the application in tobacco resistance to bacterial wilt genetically engineered, the engineered development of tobacco resistance to bacterial wilt of will making greater efforts to promote.
The inventor has cloned the gene of a coding AP2/ERF transcription factor, called after from Chinese cabbage
BrERF11Gene.
Chinese cabbage AP2/ERF transcription factor gene provided by the invention, its cDNA sequence is shown in SEQ ID No.1.
The aminoacid sequence of said genes encoding is shown in SEQ ID No.1.
The application of said gene in plant of Solanaceae tobacco resistance to bacterial wilt genetically engineered.
SEQ ID No.1 is made up of 812 Nucleotide in the sequence table; From the 1st to 78 Nucleotide of 5 ' end is 5 ' end non-coding region (5 '-UTR); The 79th to 594 Nucleotide are encoding sequence; The the 595th to 597 Nucleotide is terminator codon, and the 598th to 812 Nucleotide is 3 ' end non-coding region (3 '-UTR).
SEQ ID No.2 is made up of 172 amino-acid residues in the sequence table, comprises an AP2/ERF structural domain (from N-terminal the 23rd to 80 amino-acid residue of sequence 2) and a CM VIII-1 (EAR) motif (from C-terminal the 162nd to 167 amino-acid residue of sequence 2) and CM VIII-2 motif 139 149 (from C-terminal the 139th to 149 amino-acid residue of sequence 2).
The recombinant expression vector that contains said gene also belongs to content of the present invention.
Chinese cabbage provided by the invention
BrERF11Gene expression dose can be by H
2O
2And comprise SA, and JA, ETH, ABA is at interior plant hormone abduction delivering.
Recombinant expression vector provided by the invention obtains through the Gateway technology.Specifically be with Chinese cabbage
BrERF11Gene changes pDONR over to through the BP reaction
TMObtained through LR reaction importing pMDC32 plasmid again behind the entry vector.
With said overexpression vector Transformed E HA105 Agrobacterium, adopt leaf dish genetic transformation method to infect tobacco and obtain transgene tobacco, can improve the resistance that transgene tobacco infects bacterial wilt.
Remarkable advantage of the present invention:
Compare Chinese cabbage of the present invention with wild-type tobacco
BrERF11The overexpression of gene in tobacco can significantly improve the bacterial wilt resistance of transgene tobacco, in plant resistance to bacterial wilt genetically engineered, has important application.
Description of drawings
Fig. 1 is the evolutionary analysis of Chinese cabbage BrERF11.The amino acid that relates to has: GmERF4 (EU747723), NtERF3 (D38124), NtERF6b (AB573719), SlERF3 (AY192369); AtERF11 (AB055882), AtERF4 (AY140030), AtERF8 (AB036884), OsERF3 (AB036883); SodERF3 (AM493723), AtERF3 (CP002684), AtERF7 (AB032201); AtERF12 (AB055883), AtERF9 (AB047648), AtERF10 (AB047649); ESR1 (AF353577), LEP (AF216581), AtERF088 (CP002684).
Fig. 2 is the expression pattern analysis of BrERF11 gene under various chemical substance treatment; Wherein * is that significantly * * is remarkable for extremely;
A. the BrERF11 expression level under Whitfield's ointment is handled over time;
B. the BrERF11 expression level under methyl jasmonate treatment over time;
C. the BrERF11 expression level under ethrel is handled over time;
D. the BrERF11 expression level under dormin is handled over time;
E. the BrERF11 expression level under hydrogen peroxide treatment over time.
Fig. 3 does
35S::BrERF11With of the comparison of wild-type plant to the Ralstonia solanacearum resistance.
A. the wild-type tobacco plant reaches
35S::BrERF11Transfer-gen plant is 10
8The cfu/mL Ralstonia solanacearum soaks the phenotype analytical after root is handled 15 d;
B. the wild-type tobacco plant reaches
35S::BrERF11The transfer-gen plant excised leaf infects the phenotype analytical behind L Ralstonia solanacearum 7 d;
C. the wild-type tobacco plant reaches
35S::BrERF11The transfer-gen plant disease index is analyzed.
Embodiment
Following examples are not limited in the present invention, and purpose is better to understand the present invention.Reagent related among the following embodiment is routine biochemistry reagent like no specified otherwise.
Chinese cabbage (
Brassica rapaL.
Ssp. pekinensis) be the self-mating system of Foochow native breed seed selection.
Amino acid with Arabidopis thaliana AtERF11 (AB055882) is probe; Comparison obtains the Chinese cabbage est sequence from GenBank (www.ncbi.nlm.gov/); Carry out the contig analysis through DNAMAN; Obtain to include the consensus sequence in the conservative territory of ERF albumen respectively, Using P RIMER5 software is according to the consensus sequence design specific primers.The primer that in the Chinese cabbage cDNA library of pyroprocessing (the cDNA library is an original material with the Chinese cabbage blade of 42 ℃ of pyroprocessing 2 h), detects the purpose band is following:
forward, 5′-CGTTACGCCGCCGAGAT-3′
reverse, 5′-TCAGGCTTGGGAGGGAG-3′。
The amplification cycles number is 35 circulations, and the PCR reaction conditions is 94 ℃ of preparatory sex change 5 min, 94 ℃ of sex change 30 s, and 52 ℃ of annealing 30 s, 72 ℃ are extended 40 s, and 72 ℃ are extended 10 min.According to people's such as (Munroe et al., 1995) method, PCR-based techniques make use 96 orifice plates obtain the goal gene positive colony from the library.Positive colony is according to SMART
TMCDNA library construction test kit operation instructions is carried out interior deletion, and λ TriplEx2 phage plasmid is converted into the pTriplEx2 plasmid.Detect the size of the positive colony that is cloned into the pTriplEx2 carrier respectively with gene opposite sex primer and carrier both sides primer, and entrust the order-checking of Shanghai Ying Jun biotech company.Carrier both sides primer is following:
forward, 5′-CTCGGGAAGCGCGCCATTGTG-3′
reverse, 5′-ATACGACTCACTATAGGGCGAATTGGCC-3′。
In the final acquisition sequence table shown in the SEQ ID No.1
BrERF11Nucleotide sequence.
BrERF11Form by 812 Nucleotide; From the 1st to 78 Nucleotide of 5 ' end is 5 ' end non-coding region (5 '-UTR); The 79th to 594 Nucleotide are encoding sequence, and the 595th to 597 Nucleotide is terminator codon, and the 598th to 812 Nucleotide is 3 ' end non-coding region (3 '-UTR).
SEQ ID No.1 in the sequence table is made up of 172 amino-acid residues, comprises an AP2/ERF structural domain (from N-terminal the 23rd to 80 amino-acid residue of sequence 2) and a CM VIII-1 (EAR) motif (from C-terminal the 162nd to 167 amino-acid residue of sequence 2) and CM VIII-2 motif 139 149 (from C-terminal the 139th to 149 amino-acid residue of sequence 2).
Utilize Blastn (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to carry out sequence homology relatively; DNAMAN software SubLoc 1.0 (http://www.bioinfo.tsinghua.edu.cn/SubLoc/), WoLF PSORT (http://wolfpsort.org/) and Predictprotein (http://www.predict protein.org/) are to gene order and encoded protein matter structure and Subcellular Localization prediction.Utilize ClustalX (version1.8.1); Mega5.01 software carries out Molecular Evolutionary Analysis; (Neighbor-Joining, N-J) constructing system is grown tree, uses the check evaluating system that repeats to bootstrap for 1000 times to grow the tree topology stability of structure to adopt adjacent method.The result shows that the homology between BrERF11 and the Arabidopis thaliana AtERF11 aminoacid sequence is 67.61%; And the homology between the soybean GmERF4 aminoacid sequence is 45.05%, and 44.84% and 42.79% (Fig. 1) that homology is respectively between tomato SlERF3 and the Arabidopis thaliana AtERF4 aminoacid sequence.
Embodiment 2,
BrERF11Expression pattern is analyzed
Experiment material is 2 all Chinese cabbage seedling; Respectively to contain 5 mM Whitfield's ointment (Salicylic acid; SA), 0.1 mM methyl jasmonate (methyl-jasmonic acid; MeJA) 10% ethanolic soln sprays blade, (corresponding contrast is sprayed blade for the Chinese cabbage seedling of identical seedling age with 10% ethanolic soln).Respectively with contain 0.1 mM dormin (Abscisic acid, ABA), 0.1mM H
2O
2Spray blade with the aqueous solution of 10 mM ethrels (Ethephon), corresponding contrast is a water.Handle the blade of plant and gather at different time (0-48h), and liquid nitrogen flash freezer places-70 ℃ for follow-up immediately with corresponding adjoining tree blade
BrERF11The expression of gene pattern analysis.
After extracting processing and adjoining tree blade RNA, select for use high-quality equivalent RNA with reference to the PrimerScript of TaKaRa company
TMRT reagent Kit carries out reverse transcription.Strand cDNA after the reverse transcription gets 1 μ L as template after diluting 10 times.Internal control gene does
GAPDHGene.Adopt the ABI7500 quantitative real time PCR Instrument to carry out the real-time quantitative RT-PCR analysis, each sample carries out three times to be repeated.20 μ L PCR amplification systems are 10 μ L, 2 * SYBR Premix Ex Taq
TM(TaKaRa, Dalian), forward and reverse primer are 0.2 μ M, and template cDNA is 5-10 ng, add ROX Reference Dye II (50 *) and proofread and correct.The PCR reaction conditions is: 95 ℃ of 30 s, 95 ℃ of 5 s, 60 ℃ of 34 s, totally 40 circulations.Relative expression quantity adopts 2
-△ △ Ct(Livak) method is calculated.△ △ Ct=Δ CT (mensuration the sample)-Δ CT (calibration sample) of each time point under the wherein various processing; Δ CT (mensuration sample)=CT (measures sample object gene) – CT (measuring the sample internal control gene), Δ CT (calibration sample)=CT (calibration sample target gene)-CT (calibration sample internal control gene).
As shown in Figure 2, for being used for detecting after the cabbage leaf processing
BrERF11The expression of gene pattern, Chinese cabbage provided by the invention
BrERF11Gene expression dose is at plant hormone SA, JA, ETH, ABA and H
2O
2Compare with each contrast when handling 1 h to be time period and significantly improve and expression level to 48 h almost maintains higher level.And compare with SA, after ETH and MeJA handle
BrERF11It is more remarkable that gene expression dose improves.Chinese cabbage provided by the invention is described
BrERF11Gene has been participated in the defensive raction process of Chinese cabbage probably.
The structure of embodiment 3, plant expression vector pMDC32-BrERF11
The present invention adopts gateway technology (Walhout et al., 2000), makes up the dicotyledons transgenic and uses overexpression vector.
Dicotyledons overexpression carrier adopts pDONR207 as entry vector, and the purpose carrier is for having the pMDC32 carrier of 2 * CaMV35S promotor, amplification
BrERF11The primer that ORF adopts in the zone is:
forward, 5′- AAAAAGCAGGCTTCATGGCGCCGACAGCTAAAACGAC-3′;
reverse, 5′- AGAAAGCTGGGTCCTAATTCTCAGGCTTGGGAGGGAG-3′
The lateral joint primer is:
attB1: 5＇- GGGGACAAGTTTGTACAAAAAAGCAGGCT-3＇
attB2: 5＇- GGGGACCACTTTGTACAAGAAAGCTGGGT -3＇
The positive colony plasmid that obtains with embodiment 1 screening is a template, is primer (10 μ M) with forward/reverse, through Primer STAR
TMHS DNA polymerase (Takara) carries out the two-wheeled amplification, adds the attB joint in the goal gene both sides.First round amplification is: 25 μ LPCR system amplification programs are 95 ℃ of preparatory sex change 2 min, 94 ℃ of sex change 15 s, and 55 ℃ of annealing 30 s, 68 ℃ are extended 60 s/90 s, and the amplification cycles number is 10 circulations.The product 10 μ L that get first round amplification are template, carry out the second cover amplification program with attB1/attB2 joint primer, and 50 μ LPCR system amplification programs are 95 ℃ of preparatory sex change 1 min; 94 ℃ of sex change 15 s; 45 ℃ of annealing 30 s, 68 ℃ are extended 60 s/90 s, and the amplification cycles number is 5 circulations; 94 ℃ of sex change 15 s, 55 ℃ of annealing 30 s, 68 ℃ are extended 60 s/90 s, and the amplification cycles number is 20 circulations, and 68 ℃ are extended 5 min.On 1% sepharose, reclaim the attB-PCR product.
Through the BP reaction goal gene is cloned into entry vector pDONR207.8 μ L reaction systems are attB-PCR product 15-150 ng, pDONR207 plasmid 150 ng, BP Clonase
TMEnzyme mix 2 μ L TE mend to 8 μ L.25 ℃ of temperature are bathed and are added 1 μ L Proteinase K after 1 h spends the night, and 37 ℃ of digestion 10 min transform the DH10B competence with reaction product afterwards.The ABC of clone of pDONR207 who has goal gene carries out the LR reaction after the order-checking affirmation is errorless is cloned into purpose carrier pMDC32 with goal gene.10 μ L reaction systems are the clone 50-150 ng that crosses the threshold, and pMDC32 plasmid 150 ng, TE mend to 8 μ L, LR Clonase
TMEnzyme mix 2 μ L.25 ℃ of temperature add 1 μ L Proteinase K after bathing 1 h, and 37 ℃ of digestion 10 min transform the DH10B competence with reaction product afterwards.With the gained plasmid is that template is carried out the PCR checking.
Embodiment 4,
BrERF11Genetic tobacco genetic transformation and resistance analysis
The pMDC32 plasmid that adopts the liquefied ammonia freeze-thaw method will include goal gene ORF zone transforms Agrobacterium EHA105.Adopt leaf dish genetic transformation method to transform and be longer than the dark green CB1 of bimestrial tobacco (1 cm * 1 cm) in the MS substratum.Go up the antagonism seedling in the MS screening culture medium that contains Totomycin (50 mg/mL) (MS, 6-BA1.5 mg/L, IAA0.1 mg/L) and screen, the plant geneome RNA that extracts normal differentiation carries out PCR and detects, and obtains
35S::BrERF11Transgenic line.All strain systems are all with bagging selfing results T
1For transgenic seed.Utilize T
1Carry out transgene tobacco phenotype analytical and Function Identification for transgenic seed.
The present invention uses bacterial wilt pathogenic bacteria (taking from the local pepper ralstonia solanacearum bacterium in Fuqing) the activated back of thalline with 10 mM MgCl
2Resuspended to 1 * 10
8Cfu/mL carries out the live body inoculation.The wild-type tobacco plant reaches
35S::BrERF11Transfer-gen plant is observed the performance discovery through soaking after root is handled 15 d, with respect to
35S::BrERF11The serious symptom (Fig. 3 A) of here withering takes place in transfer-gen plant, wild-type plant.The wild-type tobacco plant reaches
35S::BrERF11After the transfer-gen plant excised leaf infects Ralstonia solanacearum 7 d, with respect to
35S::BrERF11Transfer-gen plant, wild-type tobacco blade master pulse can obviously be observed the typical illness (Fig. 3 B) of Ralstonia solanacearum.The wild-type tobacco plant is reached
35S::BrERF11The transfer-gen plant disease index carries out statistical study, can explain equally
BrERF11Overexpression can significantly improve the resistance that infect (Fig. 3 C) of transgene tobacco to the pepper ralstonia solanacearum pathogenic bacteria.
< 110>University Of Agriculture and Forestry In Fujian
< 120>a kind of Chinese cabbage AP2/ERF transcription factor gene and application thereof
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 812
<212> DNA
< 213>Chinese cabbage (Brassica rapa L. ssp. pekinensis)
<400> 1
cggccgggga aaacacctca gagtttcctc tcctctttta atttaattta acaaaaaaat 60
agttttaact ttgtcaatat ggcgccgaca gctaaaacga cggcgtttaa aactaacggc 120
gccgacggcg gaaacaaaga aaaccgttac agaggagtga gaaagaggcc gtggggtcgt 180
tacgccgccg agatcagaga tccgaccgag aaaacacgag tctggctcgg tactttcgac 240
actcccgaag cagcggctcg tgcctacgac aaagcagctt ttcagttccg tggggctaaa 300
gccaaaacca acttccctct tcctttcttc gtcgccgaca acgagagccc gagtcagagc 360
agcaccgtgg agtcaccttc ctcgatacct gatctcaacc tcggatccat ctcatccgtt 420
gattcaagat tcccttcccc caagattcag gctaagtctg gaatgatcgt gttcgatgaa 480
gaatcgggga ggagtgagtc ggactcgtcg tctgtggtgg tggatctaag ttcagagaaa 540
cgaccacgag tgttcttgga tttggatctt aatctccctc ccaagcctga gaattagttc 600
ttgaatttaa ctgttatgaa ttaaagtatt tgataaaact tagaagtatt aagttggtgc 660
cttttttttt tggtcagcag aaagttaaaa ataattttta gtgtttgaga acggtttgtt 720
ctcatcacct gttgtttatc agtttaattg taatttttct tttttaattt tctgatcaac 780
aaaaataaaa aaaaaaaaaa aaaaaaaaaa aa 812
<210> 2
<211> 172
<212> PRT
< 213>Chinese cabbage (Brassica rapa L. ssp. pekinensis)
<400> 2
Met Ala Pro Thr Ala Lys Thr Thr Ala Phe Lys Thr Asn Gly Ala Asp
1 5 10 15
Gly Gly Asn Lys Glu Asn Arg Tyr Arg Gly Val Arg Lys Arg Pro Trp
20 25 30
Gly Arg Tyr Ala Ala Glu Ile Arg Asp Pro Thr Glu Lys Thr Arg Val
35 40 45
Trp Leu Gly Thr Phe Asp Thr Pro Glu Ala Ala Ala Arg Ala Tyr Asp
50 55 60
Lys Ala Ala Phe Gln Phe Arg Gly Ala Lys Ala Lys Thr Asn Phe Pro
65 70 75 80
Leu Pro Phe Phe Val Ala Asp Asn Glu Ser Pro Ser Gln Ser Ser Thr
85 90 95
Val Glu Ser Pro Ser Ser Ile Pro Asp Leu Asn Leu Gly Ser Ile Ser
100 105 110
Ser Val Asp Ser Arg Phe Pro Ser Pro Lys Ile Gln Ala Lys Ser Gly
115 120 125
Met Ile Val Phe Asp Glu Glu Ser Gly Arg Ser Glu Ser Asp Ser Ser
130 135 140
Ser Val Val Val Asp Leu Ser Ser Glu Lys Arg Pro Arg Val Phe Leu
145 150 155 160
Asp Leu Asp Leu Asn Leu Pro Pro Lys Pro Glu Asn
165 170
<210> 3
<211> 17
<212> DNA
< 213>artificial sequence
<400> 3
cgttacgccg ccgagat 17
<210> 4
<211> 17
<212> DNA
< 213>artificial sequence
<400> 4
tcaggcttgg gagggag 17
<210> 5
<211> 21
<212> DNA
< 213>artificial sequence
<400> 5
ctcgggaagc gcgccattgt g 21
<210> 6
<211> 28
<212> DNA
< 213>artificial sequence
<400> 6
atacgactca ctatagggcg aattggcc 28
<210> 7
<211> 37
<212> DNA
< 213>artificial sequence
<400> 7
aaaaagcagg cttcatggcg ccgacagcta aaacgac 37
<210> 8
<211> 37
<212> DNA
< 213>artificial sequence
<400> 8
agaaagctgg gtcctaattc tcaggcttgg gagggag 37
<210> 9
<211> 29
<212> DNA
< 213>artificial sequence
<400> 9
ggggacaagt ttgtacaaaa aagcaggct 29
<210> 10
<211> 29
<212> DNA
< 213>artificial sequence
<400> 10
ggggaccact ttgtacaaga aagctgggt 29
Claims (3)
1. Chinese cabbage AP2/ERF transcription factor gene, it is characterized in that: the cDNA sequence of said gene is shown in SEQ ID No.1.
2. Chinese cabbage AP2/ERF transcription factor gene according to claim 1 is characterized in that: the aminoacid sequence of said genes encoding is shown in SEQ ID No.1.
3. the application of Chinese cabbage AP2/ERF transcription factor gene as claimed in claim 1 in plant of Solanaceae tobacco resistance to bacterial wilt genetically engineered.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102678000A CN102747091A (en) | 2012-07-31 | 2012-07-31 | Chinese cabbage activating protein 2/ethylene responsive factor (AP2/ERF) transcription factor gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102678000A CN102747091A (en) | 2012-07-31 | 2012-07-31 | Chinese cabbage activating protein 2/ethylene responsive factor (AP2/ERF) transcription factor gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102747091A true CN102747091A (en) | 2012-10-24 |
Family
ID=47027582
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012102678000A Pending CN102747091A (en) | 2012-07-31 | 2012-07-31 | Chinese cabbage activating protein 2/ethylene responsive factor (AP2/ERF) transcription factor gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102747091A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107699576A (en) * | 2017-09-20 | 2018-02-16 | 中国医学科学院药用植物研究所 | A kind of screening, identification and the application of the SmAP2/ERF82 transcription factors of regulation and control tanshinone biosynthesis |
| CN108588090A (en) * | 2018-06-19 | 2018-09-28 | 江苏省农业科学院 | Peach transcription factor PpERF.A16 genes, albumen, its recombinant expression carrier and application |
| CN118085050A (en) * | 2024-04-08 | 2024-05-28 | 四川农业大学 | Rice transcription factor ERF and application of coding gene thereof in regulation and control of plant disease resistance |
-
2012
- 2012-07-31 CN CN2012102678000A patent/CN102747091A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| HE,S., ET AL.: "Accession number：DQ887755.1", 《GENBANK》 * |
| 肖于华: "BpERF1和CabZIP的遗传转化及BpERF1功能的初步分析", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
| 黄木坤: "辣椒疫霉elicitin基因及白菜BpERF1基因的功能分析", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107699576A (en) * | 2017-09-20 | 2018-02-16 | 中国医学科学院药用植物研究所 | A kind of screening, identification and the application of the SmAP2/ERF82 transcription factors of regulation and control tanshinone biosynthesis |
| CN107699576B (en) * | 2017-09-20 | 2021-08-31 | 中国医学科学院药用植物研究所 | Screening, identification and application of SmAP2/ERF82 transcription factor for regulating tanshinone biosynthesis |
| CN108588090A (en) * | 2018-06-19 | 2018-09-28 | 江苏省农业科学院 | Peach transcription factor PpERF.A16 genes, albumen, its recombinant expression carrier and application |
| CN108588090B (en) * | 2018-06-19 | 2020-08-28 | 江苏省农业科学院 | Peach transcription factor PpERF.A16 gene, protein, recombinant expression vector and application thereof |
| CN118085050A (en) * | 2024-04-08 | 2024-05-28 | 四川农业大学 | Rice transcription factor ERF and application of coding gene thereof in regulation and control of plant disease resistance |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ahammed et al. | Tomato WRKY81 acts as a negative regulator for drought tolerance by modulating guard cell H2O2–mediated stomatal closure | |
| Zhang et al. | Identification and characterization of CBL and CIPK gene families in canola (Brassica napus L.) | |
| Arraes et al. | Implications of ethylene biosynthesis and signaling in soybean drought stress tolerance | |
| Jiang et al. | A maize calcium-dependent protein kinase gene, ZmCPK4, positively regulated abscisic acid signaling and enhanced drought stress tolerance in transgenic Arabidopsis | |
| Han et al. | Isolation and characterization of two persimmon xyloglucan endotransglycosylase/hydrolase (XTH) genes that have divergent functions in cell wall modification and fruit postharvest softening | |
| Lai et al. | Overexpression of a Chinese cabbage BrERF11 transcription factor enhances disease resistance to Ralstonia solanacearum in tobacco | |
| Wang et al. | Isolation and characterization of a novel drought responsive gene encoding a glycine-rich RNA-binding protein in Malus prunifolia (Willd.) Borkh. | |
| CN110066773B (en) | Application of corn ZmMPK11 protein or coding gene thereof in regulating plant stress tolerance | |
| Sun et al. | Overexpression of the Lotus corniculatus soloist gene LcAP2/ERF107 enhances tolerance to salt stress | |
| Zhuang et al. | Phosphate starvation responsive GmSPX5 mediates nodule growth through interaction with GmNF‐YC4 in soybean (Glycine max) | |
| Wang et al. | Identification and characterization of novel homeodomain leucine zipper (HD-Zip) transcription factors associated with heat tolerance in perennial ryegrass | |
| Praveen et al. | Abiotic stress tolerance in plants: a fascinating action of defense mechanisms | |
| He et al. | GhHB12 negatively regulates abiotic stress tolerance in Arabidopsis and cotton | |
| Yang et al. | Molecular characterization and function analysis of SlNAC2 in Suaeda liaotungensis K. | |
| Sadhukhan et al. | The cowpea RING ubiquitin ligase VuDRIP interacts with transcription factor VuDREB2A for regulating abiotic stress responses | |
| Jia et al. | The Salix psammophila SpRLCK1 involved in drought and salt tolerance | |
| Zhang et al. | Molecular cloning and differential expression of sHSP gene family members from the resurrection plant Boea hygrometrica in response to abiotic stresses | |
| Kuluev et al. | The role of expansin genes PtrEXPA3 and PnEXPA3 in the regulation of leaf growth in poplar | |
| Ren et al. | Molecular cloning of a PR-5 like protein gene from cherry tomato and analysis of the response of this gene to abiotic stresses | |
| Paul et al. | An A20/AN1-zinc-finger domain containing protein gene in tea is differentially expressed during winter dormancy and in response to abiotic stress and plant growth regulators | |
| CN102747091A (en) | Chinese cabbage activating protein 2/ethylene responsive factor (AP2/ERF) transcription factor gene and application thereof | |
| Zhang et al. | Overexpression of the Malus hupehensis MhTGA2 gene, a novel bZIP transcription factor for increased tolerance to salt and osmotic stress in transgenic tobacco | |
| Saidi et al. | Overexpression of durum wheat NAC transcription factor TtNTL3A promotes early flowering and increases multiple stress tolerance in transgenic Arabidopsis | |
| Soyano et al. | Systemic regulation of root nodule formation | |
| Liu et al. | Identification of the genes involved in heterotrimeric G-protein signaling in mulberry and their regulation by abiotic stresses and signal molecules |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20121024 |