CN108531562A - A method of auxiliary identification broad bean seed coat is without tannin character - Google Patents
A method of auxiliary identification broad bean seed coat is without tannin character Download PDFInfo
- Publication number
- CN108531562A CN108531562A CN201810363136.7A CN201810363136A CN108531562A CN 108531562 A CN108531562 A CN 108531562A CN 201810363136 A CN201810363136 A CN 201810363136A CN 108531562 A CN108531562 A CN 108531562A
- Authority
- CN
- China
- Prior art keywords
- broad bean
- tannin
- character
- sequence
- seed coat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of auxiliary to identify method of the broad bean seed coat without tannin character, includes the following steps：Using the genomic DNA of broad bean to be measured as template, PCR amplification is carried out with EST786 primer pairs；If it is the broad bean with no tannin character of candidate that the PCR amplification has product, broad bean to be measured in 800 sections 1000bp；If it is the broad bean without no tannin character of candidate that the PCR amplification has product, broad bean to be measured in 1000 sections 1200bp；Single strand dna forms shown in single strand dna and the sequence of sequence table 2 shown in sequence 1 of the EST786 primer pairs by sequence table；The EST786 primers are in auxiliary identification broad bean seed coat without the application in tannin character：Present invention can apply to the molecular marks and Molecular design breeding of no tannin kind, can greatly reduce the workload of field selection, shorten the breeding time limit.
Description
Technical field
The present invention relates to biotechnology, more particularly to a kind of auxiliary identifies method of the broad bean seed coat without tannin character.
Background technology
Broad bean is that pulse family is vetch annual or more year sward sheet, is grain, vegetables, feed and green manure dual-purpose type crop.
China's Broad Bean Protein feed accounts for 50% of yield of broad bean or more, is main protein feed raw material.Broad bean seed coat is thicker, plants in skin
Contain condensed tannin.Tannin is one of the anti-nutritional factors in feed, and tannin is combined with the intestinal wall protein of animal, promotes egg
White matter precipitates.The permeability of intestines and absorption, digestion and utilization to important nutrients such as protein, amino acid in influence；Suppression
Brake the activity of object intestinal digestion enzyme；Reduce sugar and protein content etc. in hemolymph.Tannin can be combined with sialoprotein, cause to receive
It holds back sense and dry sensation and generates astringent taste.Tannin again can with the combinations such as starch, influence animal to the feeding of the nutriments such as starch and
Digestion, reduces the nutritive value of food.The presence of anti-nutritional factors is increased and is produced into increase the consumption of feed
This.Therefore, the selection and breeding for accelerating utilization and new varieties without tannin germ plasm resource become important grinding in the work of broad bean genetic breeding
Study carefully one of content.
Currently, the method for reducing broad bean tannin mainly has physical method and biological technique method.Physical method includes heating
Method, puffing method, mechanical processing method, water-extraction method；Biological technique method includes enzyme preparation method, fermentation method, method of breeding.The above method
In, breeding method can fundamentally remove anti-nutritional factors tannin.
Conventional breeding is selected indirectly genotype by the phenotype of character, and this selection method is although feasible,
But it since there is homozygous and heterozygosis in target gene site, needs to be selfed discriminating for many years, therefore the breeding time limit is longer.In recent years,
With the development of molecular marking technique, the GENERALIZATION OF MODERN BREEDING TECHNIQUEs such as molecular mark and Molecular design breeding are come into being,
It enables people to directly select genotype, selection result is more objective, accurate, greatly improves efficiency and the shortening of breeding
The time limit of breeding.Therefore, using molecular marking technique to selection traits carry out molecular labeling, be molecular mark and point
The basis of the work such as sub- design and context, while the acquisition of Other Main Agronomic Characters molecular labeling, for controlling grinding for the character gene
Studying carefully also has highly important theoretical and practical significance.
SSR (Simple Sequence Repeat) labels are a kind of molecular labelings easy to operate, belong to dominant marker,
It is accurate that average, polymorphism height, result are distributed in genome, in genetic diversity Journal of Sex Research, molecular labeling, the base of many crops
Because of positioning and molecular mark etc. extensive use.
Therefore, it is necessary to solve the above problems to invent a kind of auxiliary identification method of the broad bean seed coat without tannin character.
Invention content
The purpose of the present invention is to provide a kind of auxiliary to identify method of the broad bean seed coat without tannin character, to solve the above-mentioned back of the body
The problem of being proposed in scape technology.
To achieve the above object, the present invention provides the following technical solutions：A kind of auxiliary identifies broad bean seed coat without tannin character
Method, include the following steps：Using the genomic DNA of broad bean to be measured as template, PCR amplification is carried out with EST786 primer pairs；
If it is candidate with no tannin character that the PCR amplification has product, broad bean to be measured in the sections 800-1000bp
Broad bean；
If it is candidate without no tannin that the PCR amplification has product, broad bean to be measured in the sections 1000-1200bp
The broad bean of character；
It is single shown in single strand dna and the sequence of sequence table 2 shown in sequence 1 of the EST786 primers by sequence table
Ssdna molecule forms；
The EST786 primers are in auxiliary identification broad bean seed coat without the application in tannin character：The Satt408 primer pairs
Single strand dna forms shown in single strand dna and the sequence of sequence table 2 shown in sequence 1 by sequence table；
The EST786 primers are preparing the application in assisting identification kit of the broad bean seed coat without tannin character：It is described
Single strand dna group shown in single strand dna and the sequence of sequence table 2 shown in sequence 1 of the EST786 primers by sequence table
At.
Preferably, the annealing temperature of EST-SSR primer pairs is 50 DEG C in the kit.
Preferably, EST-786 primers are for the specific target sequence with soybean of the broad bean seed coat without tannin character
800bp-1000bp。
The technique effect and advantage of the present invention：The present invention by using in molecular markers for identification plant shoots whether there is nothing
Tannin gene, while genotype of the control without tannin broad bean can be identified, and then infer that plant will generate the broad bean of which kind of tannin,
Whether its offspring can occur the separation of tannin character, have substantial worth to breeding, can be applied to the molecule mark of no tannin kind
Remember assistant breeding and Molecular design breeding, the workload of field selection can be greatly reduced, shortens the breeding time limit, simultaneously because institute
The molecular labeling EST786-800bp without tannin obtained is marked and broad bean only has without the genetic distance between tannin gene
2.9cM further furthers investigate no tannin gene using the label.
Present invention process is simple, and equipment requirement is low, and operability is strong, has good society generalization application.
Specific implementation mode
The technical scheme in the embodiments of the invention will be clearly and completely described below, it is clear that described implementation
Example is only a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, this field is common
The every other embodiment that technical staff is obtained without making creative work belongs to the model that the present invention protects
It encloses.
Embodiment 1
A method of auxiliary identification broad bean seed coat includes the following steps without tannin character：With the genome of broad bean to be measured
DNA is template, and PCR amplification is carried out with EST786 primer pairs；
If it is the silkworm with no tannin character of candidate that the PCR amplification has product, broad bean to be measured in the sections 900bp
Beans；
If it is candidate without no tannin character that the PCR amplification has product, broad bean to be measured in the sections 1100bp
Broad bean；
Shown in single strand dna and the sequence of sequence table 2 shown in sequence 1 of the EST786 primer pairs by sequence table
Single strand dna forms；
The EST786 primer pairs are preparing the application in assisting identification kit of the broad bean seed coat without tannin character：It is described
Single strand dna shown in single strand dna and the sequence of sequence table 2 shown in sequence 1 of the EST786 primer pairs by sequence table
Composition.
The kit includes EST786 primer pairs and one group of EST-SSR primer pair, and the EST-SSR primer pairs are by sequence
Single strand dna shown in single strand dna and the sequence of sequence table 4 shown in the sequence 3 of table forms.
The annealing temperature of EST-SSR primer pairs is 50 DEG C in the kit.
EST-SSR primers are for the specific target sequence with broad bean of the broad bean seed coat without tannin character in the kit
For 800bp-1000bp.
Embodiment 2
A method of auxiliary identification broad bean seed coat includes the following steps without tannin character：With the genome of broad bean to be measured
DNA is template, and PCR amplification is carried out with EST786 primer pairs；
If it is the silkworm with no tannin character of candidate that the PCR amplification has product, broad bean to be measured in the sections 1000bp
Beans；
If it is candidate without no tannin character that the PCR amplification has product, broad bean to be measured in the sections 1200bp
Broad bean；
Shown in single strand dna and the sequence of sequence table 2 shown in sequence 1 of the EST786 primer pairs by sequence table
Single strand dna forms；
The EST786 primer pairs are in auxiliary identification broad bean seed coat without the application in tannin character：
The annealing temperature of EST-SSR primer pairs is 50 DEG C in the kit, in the kit EST-SSR primers for
With broad bean seed coat, the specific target sequence of the broad bean without tannin character is 900bp.
The present invention in molecular markers for identification plant shoots by using, with the presence or absence of no tannin gene, while can identifying control
The genotype without tannin broad bean is made, and then infers that plant will generate the broad bean of which kind of tannin, whether offspring can occur tannin
The separation of shape there is substantial worth, the molecular mark and MOLECULE DESIGN that can be applied to no tannin kind to educate breeding
Kind, the workload of field selection can be greatly reduced, shorten the breeding time limit, simultaneously because the molecular labeling without tannin obtained
EST786-900bp is marked and broad bean only has 2.9cM without the genetic distance between tannin gene, using the label to no tannin
Gene is further furtherd investigate.
Present invention process is simple, and equipment requirement is low, and operability is strong, has good society generalization application.
The sense primer and downstream primer of EST786 primer pairs are as follows：
Upper primer pair (sequence 1 of sequence table)：GCGGTCCGTGCTGTTAATTCTATA；
Downstream primer (sequence 2 of sequence table)：GCGTGATTTATTCATGATATATTTTTG.
Table 1 is the Vicia Faba of auxiliary identification.
| Serial number | Variety name | Yield |
| 1 | Qinghai 11 | 350 kilograms or so of per mu yield |
| 2 | Qinghai 12 | 360 kilograms or so of per mu yield |
| 3 | Green silkworm No. 14 | 400 kilograms or so of per mu yield |
| 4 | Huangyuan gingival cyst of mucous gland in the newborn | 300 kilograms or so of per mu yield |
| 5 | 3290 | 260 kilograms or so of per mu yield |
| 6 | Lincan No.6 | 350 kilograms or so of per mu yield |
Table 2 is the product result of identification of species broad bean.
Finally it should be noted that：The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention,
Although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still may be used
With technical scheme described in the above embodiments is modified or equivalent replacement of some of the technical features,
All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on should be included in the present invention's
Within protection domain.
Claims (4)
1. a kind of auxiliary identifies method of the broad bean seed coat without tannin character, include the following steps：With the genomic DNA of broad bean to be measured
For template, PCR amplification is carried out with EST786 primers；
If it is the silkworm with no tannin character of candidate that the PCR amplification has product, broad bean to be measured in the sections 800-1000bp
Beans；
If it is candidate without no tannin character that the PCR amplification has product, broad bean to be measured in the sections 1000-1200bp
Broad bean；
The EST786 primers are in auxiliary identification broad bean seed coat without the application in tannin character：Shown in sequence 1 by sequence table
Single strand dna shown in single strand dna and the sequence of sequence table 2 forms；
The EST786 primer pairs are preparing the application in assisting identification kit of the broad bean seed coat without tannin character：It is described
Single strand dna shown in single strand dna and the sequence of sequence table 2 shown in sequence 1 of the EST786 primer pairs by sequence table
Composition.
2. a kind of auxiliary according to claim 1 identifies method of the broad bean seed coat without tannin character, it is characterised in that：It is described
Kit includes EST786 primers, single strand dna and sequence shown in sequence 1 of the EST-SSR primer pairs by sequence table
Single strand dna shown in the sequence 2 of table forms.
3. a kind of auxiliary according to claim 2 identifies method of the broad bean seed coat without tannin character, it is characterised in that：It is described
The annealing temperature of EST-SSR primer pairs is 50 DEG C in kit, and target sequence is located at D1a chromosomal focis.
4. a kind of auxiliary according to claim 2 identifies method of the broad bean seed coat without tannin character, it is characterised in that：It is described
EST-SSR primer pairs are 800- for the specific target sequence with broad bean of the broad bean seed coat without tannin character in kit
1000bp。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810363136.7A CN108531562A (en) | 2018-04-20 | 2018-04-20 | A method of auxiliary identification broad bean seed coat is without tannin character |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810363136.7A CN108531562A (en) | 2018-04-20 | 2018-04-20 | A method of auxiliary identification broad bean seed coat is without tannin character |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108531562A true CN108531562A (en) | 2018-09-14 |
Family
ID=63477994
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810363136.7A Pending CN108531562A (en) | 2018-04-20 | 2018-04-20 | A method of auxiliary identification broad bean seed coat is without tannin character |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108531562A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998049887A1 (en) * | 1997-05-02 | 1998-11-12 | The University Of Utah | Soybean having epistatic genes affecting yield |
| CN102851367A (en) * | 2012-09-07 | 2013-01-02 | 北京农学院 | Method for auxiliary identification of soybean having green cotyledon character |
| CN107002144A (en) * | 2014-12-18 | 2017-08-01 | 美国陶氏益农公司 | The identification of the SNP marker of marker assisted selection for these characters of fiber content and the related QTL of kernel seed coat colour the character finely positioning with checking and from yellow seed coat (YSC) Canola system YN01 429 and its pedigree |
-
2018
- 2018-04-20 CN CN201810363136.7A patent/CN108531562A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998049887A1 (en) * | 1997-05-02 | 1998-11-12 | The University Of Utah | Soybean having epistatic genes affecting yield |
| CN102851367A (en) * | 2012-09-07 | 2013-01-02 | 北京农学院 | Method for auxiliary identification of soybean having green cotyledon character |
| CN107002144A (en) * | 2014-12-18 | 2017-08-01 | 美国陶氏益农公司 | The identification of the SNP marker of marker assisted selection for these characters of fiber content and the related QTL of kernel seed coat colour the character finely positioning with checking and from yellow seed coat (YSC) Canola system YN01 429 and its pedigree |
Non-Patent Citations (5)
| Title |
|---|
| A.M.TORRES等: "Marker-assisted selection in faba bean (Vicia faba L.)", 《FIELD CROPS RESEARCH》 * |
| PULSEDB: "Vf-EST786", 《PULSEDB》 * |
| WANWEI HOU等: "Linkage Map of a Gene Controlling Zero Tannins (zt-1) in Faba Bean (Vicia faba L.) with SSR and ISSR Markers", 《AGRONOMY》 * |
| 叶茵: "《中国蚕豆学》", 31 March 2003, 中国农业出版社 * |
| 吕建群等: "我国蚕豆育种进展", 《安徽农业科学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wolko et al. | Lupinus | |
| US7288386B2 (en) | Method of determining soybean sudden death syndrome resistance in a soybean plant | |
| Naz et al. | Assessment of genetic diversity within germplasm accessions in tomato using morphological and molecular markers. | |
| CN105838795A (en) | Molecular marker of related gene SVEP1 of back fat thickness and intramuscular fat traits and application of molecular marker | |
| CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN103866005A (en) | Molecular marker-assisted selection primer and method for wilt resistance and gynoecious line of cucumis melon | |
| CN111647663B (en) | Molecular genetic marker for chicken walking number character and application | |
| Makwana et al. | Morphological characterization and DNA finger printing of pearl millet (Pennisetum Glaucum (L.) germplasms | |
| WO2021047032A1 (en) | Primers for molecularly labeling new strain of flammulina fennae and molecular labeling method | |
| KR101771967B1 (en) | Primers for diagnosis of Cylindrocarpon destructans in Panax ginseng and uses thereof | |
| CN109136400A (en) | The QTLs and its localization method of radish fleshy root correlated traits | |
| Obidiegwu et al. | Development and genotyping potentials of EST-SSRs in finger millet (E. Coracana (L.) Gaertn.) | |
| CN108531562A (en) | A method of auxiliary identification broad bean seed coat is without tannin character | |
| CN111213613A (en) | Molecular breeding method of black-feather green-foot powder-shell meat-egg dual-purpose chicken | |
| WO2021047031A1 (en) | Novel flammulina fennae strain as well as molecular marker primer and molecular marking method thereof | |
| WO2016171344A1 (en) | Saengjang, which is novel aloe variety, and molecular marker for classifying same | |
| CN106591467A (en) | Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon | |
| CN113528700A (en) | KASP molecular marker kit for detecting wheat ear germination resistance, detection method and application | |
| Osae et al. | QTL mapping for significant seed traits of watermelon (CITRULLUS LANATUS SCHRAD.) | |
| CN101633936B (en) | Fish transgenosis breeding method | |
| CN105886647A (en) | Characteristic nucleotide sequence, primer, kit and method for authenticating Flammulina fennae | |
| KR101723087B1 (en) | Primer for detection of Cylindrocarpon destructans using microsatellite, kit comprising them and the method for identifying Cylindrocarpon destructans thereby | |
| Mady et al. | Phylogenetic analysis of Cucurbita pepo using molecular markers | |
| CN109554489A (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN109182532B (en) | Kit containing CA8 gene for screening Kazakh horse lactation traits and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180914 |