CN108522290A

CN108522290A - A kind of self-luminous tobacco and transgenic method

Info

Publication number: CN108522290A
Application number: CN201710120673.4A
Authority: CN
Inventors: 段康; 张晨; 赵娟; 生承晔; 张业胜; 王文; 董扬
Original assignee: Yunnan Nabo Biotechnology Co Ltd
Current assignee: Yunnan Nabo Biotechnology Co Ltd
Priority date: 2017-03-02
Filing date: 2017-03-02
Publication date: 2018-09-14

Abstract

The invention discloses a kind of self-luminous tobacco and transgenic methods.The self-luminous tobacco is by bioluminescence gene and plamid vector construction bioluminescence gene plasmid vector expression vector, and bioluminescence gene plasmid vector expression vector is by the way that in plastid transgene technological sourcing to tobacco leaf, tobacco leaf is obtained by tissue cultures.The plasmid vector is p DK6 plasmid vectors, and base sequence is as shown in SEQ ID NO.1；The bioluminescence gene is LUX genes.The present invention obtains self-luminous tobacco using plastid transgene technology, this method depends on the homologous recombination of foreign gene and chloroplast gene, has targeted exogenous gene integration and makes it stable heredity, environmental safety is good, the advantages that gene outcome compartmentalization, expression quantity is high and favored by scientist.

Description

A kind of self-luminous tobacco and transgenic method

Technical field

The invention belongs to transgenosis luminous plant technical field more particularly to a kind of self-luminous tobacco and transgenic methods.

Background technology

During biological evolution, the algae of autofluorescence, fungi, bacterium, the species such as insect are formd.But from But rarely has the plant of autofluorescence in right boundary.The whole world is related to every aspect about the research of luminous tobacco, and shine tobacco mostly Patent be all or to be transformed to plant cultivation device so that certain luminophors are coated in plant surface, make plant Object sends out light in the dark.

Genetic engineering flourishes so that scientist has been formed with the light emitting machine of biology the research of molecular level.Science Family is by importing bioluminescence gene in the chromosome of plant cell, to obtain accordingly luminous plant.It is animal, micro- in nature Biology has and can shine, and only plant is during evolution without this phenomenon that shines only, therefore luminous plant is with very greatly Ornamental value, meanwhile, film《A Fanda》In fluorescent plant greatly long for and yearn for the mankind, in the past few years, the mankind couple The curiosity of fluorescent plant never weakens, and the appearance of fluorescent plant also has great commercial value.

Application No. is the Chinese patent applications of CN201310396243.7 to disclose a kind of luminous cactus with globular.The celestial being that shines Ball is obtained using following methods：Luciferase gene group's PCR amplification；The structure of luciferase gene group and pM-18T carriers；Base Because of sequencing；Fusion is transferred to Escherichia coli, sequencing；The connection of target gene and expression vector；Specific promoter is carried with expression The structure of body；Fusion is transferred to Agrobacterium；Extract before the synthesis of gene and fluorescein is transferred to plant together；And turned Generation screening stabilized illumination tobacco body.Bioluminescence gene is integrated into plant chromosome gene using Agrobacterium-mediated Transformation method, copy number It is relatively low, cause conversion ratio very low, plant shines unobvious, and this method, which is applied in tobacco, is hardly obtained luminous tobacco.

In " Autoluminescent Plants (Krichevsky, et al, 2010, Plos one) " text with Nicotiana tabacum (tetraploid tobacco) are acceptor material, and plasmid vector starts aadA by the peculiar promoter Prrn of plastid (screening-gene) and LUX operon genes are used as exogenous gene expression box, simultaneous selection rps12-trnV and trnA-trnI Two kinds of homologous sites as a contrast, the self-luminous tobacco of acquisition.

Invention content

In view of the deficiencies of the prior art, the present invention provides a kind of self-luminous tobacco and transgenic methods.The present invention can determine Point is integrated, and copy number is high, smoothly obtains the self-luminous tobacco of high expression；Its self-luminous tobacco is (additional in no outer force effect Substrate or blue violet light excitation etc.) under, the visible fluorescence of bore hole can be sent out certainly.

First aspect present invention provides a kind of self-luminous tobacco, which is characterized in that the self-luminous tobacco passes through the base that shines Cause and plamid vector construction bioluminescence gene-plasmid vector expression vector, bioluminescence gene-plasmid vector expression vector pass through plastid again Transgenic technology is imported into tobacco leaf, and tobacco leaf is obtained by tissue cultures.

The plasmid vector is p-DK6 plasmid vectors, and base sequence is as shown in SEQ ID NO.1.The p-DK6 plasmids carry The component part of body：Promoter, terminator, screening resistant gene (aadA), multiple cloning sites, Chloroplast gene homologous sequence (ORF131,16SrRNA) etc..Screening-gene aadA and foreign gene LUX in plasmid vector is respectively by plastid specific promoter PpsbA and Prrn starts, and forms two sets of expression casettes, from the point of view of the expression of light quantum, is distinguished using two promoters The effect of startup is higher.

The bioluminescence gene is LUX genes, can find that Yu Haiyang is sent out earliest by artificial synthesized acquisition, bioluminescence gene LUX In photobacteria, Marine Luminous Bacteria is a kind of bacterium that can emit visible fluorescence under normal physiological conditions, this visible Wavelength of fluorescence is between 450-490nm, and naked eyes are visible at dark.

Second aspect of the present invention, provides a kind of transgenic method of self-luminous tobacco, and the transgenic method operation is as follows： Bioluminescence gene LUX sequences are obtained by gene chemical synthesis, and carry out PCR amplification；Then NcoI restriction enzymes and XbaI are used Restriction enzyme digestion p-DK6 plasmid vectors obtain linearisation p-DK6 plasmid vectors, bioluminescence gene LUX are connected to linearisation On p-DK6 plasmid vectors, bioluminescence gene-plasmid vector is obtained, bioluminescence gene-plasmid vector bombardment is imported by warp using particle gun In tobacco leaf after hypertonic culture；

The tobacco leaf of bioluminescence gene-plasmid vector is imported with after recovery media culture, then in screening and culturing Screening and culturing is carried out in base, obtains positive callus, and positive callus continues subculture screening and culturing and obtains homogeneity 100% Callus, and then in root media induce seedling obtain self-luminous tobacco；

The condition of the biolistic bombardment tobacco leaf is as follows：Particle gun helium is depressed into 1050~1150psi, target distance For 6cm or 9cm.

Primer pair when the bioluminescence gene LUX progress PCR amplification is as follows：

Preceding primer primer-F：AGGGAGGGATCCATGGGAATACCAAAGGAGATTAC；

Primer primer-R afterwards：TAATGTCTACTCTAGAAATATCCCTATAAATAGAAC.

The hypertonic condition of culture is as follows：Hypertonic culture medium prescription is MS basal mediums+0.05~0.3mol/ of mannitol L+ sorbierite 0.05~0.2mol/L+ sucrose 25~35g/L+, 6.8~9g/L of agar, pH5.6~6；The high osmotic treatment time be 3~ 5h, room temperature sealing are placed；

The renewal cultivation condition is as follows：Renewal cultivation based formulas is 0.5~1.5mgL of MS basal medium+6-BA^-1 + NAA50~180ugL^-125~35gL of+sucrose^-16.8~9gL of+agar^-1, pH5.6~6；Renewal cultivation is light culture, Temperature is 22~26 DEG C, and incubation time is 5~10 days.

The tobacco leaf for being imported with bioluminescence gene-plasmid vector obtains positive callus by 2~4 wheel screening and culturings； Screening conditions are as follows：Screening and culturing based formulas is 0.5~1.5mgL of MS basal medium+6-BA^-150~180ug of+NAA L^-125~35gL of+sucrose^-16.8~9gL of+agar^-500~2000mg/L of+spectinomycin, pH5.6~6；

Screening and culturing temperature is 22~26 DEG C, and intensity of illumination is 1500~2500lux, and daily light application time is 12~14 small When, the screening and culturing time is 70~85 days；Or screening and culturing temperature be 22~26 DEG C, intensity of illumination be 8000~ 11000lux, daily light application time are 14~16 hours, and the screening and culturing time is 35~45 days.

The positive callus of acquisition continues to cut into pieces, is positioned over 1~3 wheel of screening in subculture screening and culturing medium and obtains together The positive callus of matterization 100%；

Subculture screening conditions are as follows：Subculture screening and culturing based formulas is 0.5~1.5mgL of MS basal medium+6-BA^-1 + NAA50~180ugL^-125~35gL of+sucrose^-1+ agar 6.8~9gL+ spectinomycins 500~2000mg/L, pH5.6 ~6.2；Subculture screening and culturing temperature be 25~28 DEG C, intensity of illumination be 8000~12000lux, daily light application time be 12~ 18 hours, subculture screening time was 30~60 days.

The callus of homogeneity 100% energy naked eye in darkroom cuts callus into pieces placement to fluorescence The self luminous tobacco of energy is obtained in root media, root media composition is as follows：Prescription of rooting medium is MS₀Culture medium + sucrose 25~35g/L+ spectinomycin 500~2000mg/L+, 2~4g/L of plant gel, pH5.6~6.2.

The MS basal medium formulations that the present invention uses for：30~35gL of ammonium nitrate^-1, 36~40gL of potassium nitrate^-1, 3~3.8gL of potassium dihydrogen phosphate^-1, 7~7.5gL of magnesium sulfate^-1, 8~9gL of calcium chloride^-1, 0.1~0.2gL of potassium iodide^-1, 1.1~1.4gL of boric acid^-1, four 4~5gL of water manganese sulfate^-1, 1.5~1.9gL of white vitriol^-1, Sodium Molybdate Dihydrate 0.02 ~0.1gL^-1, 4~6mgL of cupric sulfate pentahydrate^-1, 4.5~5.5mgL of CoCL2 6H2O^-1, 5~6g of ferrous sulfate heptahydrate L^-1, 7~8gL of disodium ethylene diamine tetraacetate^-1, 19.5~21.3mgL of glycine^-1, 95~105mgL of inositol^-1, hydrochloric acid sulphur 18~22mgL of amine element^-1, 99~104mgL of pyridoxine hydrochloride^-1, 197~102mgL of niacin^-1。

In view of bioluminescence gene being integrated into plant nucleus gene using Agrobacterium-mediated Transformation method, copy number is low, conversion ratio compared with Low, for the present invention by bioluminescence gene in the Chloroplast gene of plastid transgene technological sourcing plant cell, foreign gene is whole It closes between chloroplaset ORF131 genes and 16Sr rna genes, Chloroplast gene is mainly by LSC, SSC, IRA, IRB tetra- Be grouped as, IRA, IRB two parts nucleic acid sequences are completely the same, direction on the contrary, ORF131 genes and 16S rna genes are located at IRA, On IRB, theoretically for, external source the two sites carry out homologous recombination integration when, a Chloroplast gene can To integrate upper two foreign genes；Meanwhile a mesophyll cell contains tens chloroplasets, has tens inside a chloroplaset The copy of Chloroplast gene compares one two so a mesophyll cell has the copy close to 10000 Chloroplast genes The mesophyll cell of times body only has the copy of 2 sets of Matrix attachment regions, and the plastid transgene plant of acquisition can be thousands of times higher than consideration convey gene Expression quantity, therefore the present invention can site-directed integration, and copy number is high.Pass through optimum culture condition (such as screening and culturing based component, sieve Select illumination and temperature etc.) positive seedling that the degree of homogenization 100% can be obtained, overcome homogeneous journey in existing chloroplast transformation Low defect is spent, the self-luminous tobacco of high expression is smoothly obtained.

In addition, the screening-gene aadA and foreign gene LUX in the p-DK6 plasmid vectors that the present invention uses are respectively by plastid Specific promoter PpsbA and Prrn start, and two sets of expression casettes are formed, from the point of view of the expression of light quantum, using two The effect that promoter is respectively started is higher.

Compared with prior art, the invention has the advantages that：The present invention is obtained certainly using plastid transgene technology Shine tobacco, and this method depends on the homologous recombination of foreign gene and chloroplast gene, has targeted exogenous gene integration and makes Stabilization heredity, the advantages that environmental safety is good, gene outcome compartmentalization, expression quantity is high and favored by scientist.

Compared with the existing luminous plant in China, comparison is transferred to the plant of fluorescin, does not need blue violet light excitation and wears Tinted glasses are worn, safely and convenient for observation；Comparison is transferred to the plant of luciferase, need not add external application substrate luciferin, pacifies Complete and plant grew well, luminous intensity are kept constant, and will not be weakened at any time.The self-luminous tobacco that the present invention obtains is black Tobacco autofluorescence can be obviously observed under dark condition, is the quality product of new generation of fluorescent plant, and market potential is huge.

Description of the drawings

Fig. 1 is LUX gene Phanta polymerase PCR result figures；

Fig. 2 is p-DK6 skeleton carrier collection of illustrative plates；

Fig. 3 is p-DK6 Vector maps；

Fig. 4 is glue figure after carrier p-DK6 digestions；

Fig. 5 is the genome sequence simulated after successfully recombination；

Fig. 6 is that Left-f/r runs the obtained purpose band of glue, wherein the stripe size of 1,1-1,2,13 is close to 1600bp；

Fig. 7 is the purpose band that Right-f/r runs that glue obtains, and size meets in 2300bp, size；

Fig. 8 is the Ben's tobacco sample callus complete genome DNA glue figure of extraction；

Fig. 9 is the amplification curve of LUX-BS (Ben's) reference gene and target gene；

Figure 10 is the standard curve of LUX-BS (Ben's) reference gene；

Figure 11 is the standard curve of LUX-BS (Ben's) target gene；

Figure 12 is the solubility curve of LUX-BS (Ben's) reference gene and target gene；

Figure 13 is Ben's positive tobacco fluorescence shooting effect figure；

Figure 14 is the PCR glue figure result figures your cigarette receptor obtains positive callus；

Figure 15 is the amplification curve of LUX-G (your cigarette) target gene and reference gene；

Figure 16 is the solubility curve of LUX-G (your cigarette) target gene and reference gene.

Specific implementation mode

Technical scheme of the present invention is described in further details in the following with reference to the drawings and specific embodiments, but the present invention is simultaneously It is not limited to following technical scheme.

For receptor, LUX is transferred in chloroplaset with Ben Shi cigarette (Nicotiana benthamiana, diploid) for embodiment 1 Data mining self-luminous tobacco

Step (1) is searched on NCBI obtains LUX gene orders, and LUX is synthesized in Shanghai Jierui Biology Engineering Co., Ltd In carrier p-GH-LUX, (skeleton carrier that Shanghai JaRa company synthetic gene uses is p-GH to gene, and the base sequence of P-GH exists Can be found in NCBI) in, IN-fusion connection primers are designed, by PCR amplification, obtain purpose band, PCR primer is as follows：

primer-F：AGGGAGGGATCCATGGGAATACCAAAGGAGATTAC；

primer-R：TAATGTCTACTCTAGAAATATCCCTATAAATAGAAC；

When bioluminescence gene LUX carries out PCR amplification, PCR reaction systems (25ul) are as shown in table 1.

Table 1

PCR reaction conditions are as shown in table 2.

Table 2

Gel electrophoresis is carried out after PCR reaction results, recycles to obtain target fragment using 1.2% glue, as shown in Figure 1.In Fig. 1 M is 1kb maker, and 1~11 indicates the adhesive tape that different annealing temperatures (50~68 DEG C, gradient is 2 DEG C) obtains, and 12 be positive right According to 13 be blank control.

Step (2) utilizes Nco1, Xbal digestion tobacco chloroplast genome homologous recombination vector p-DK6 to be linearized Skeleton carrier and the Vector map difference of p-DK6 plasmid vectors, p-DK6 plasmid vectors are as shown in Figure 2 and Figure 3.

16SrRNA-trnV and ORF13 indicates that homologous site, Prrn and PpsbA indicate that chloroplaset specifically starts in Fig. 2 Son, TrbcL and TpsbA indicate that the special terminator of chloroplaset, B-bar1 indicate the original foreign gene (antiweed of skeleton carrier ), aadA indicate screening-gene (grand element enzyme, anti-spectinomycin).

Nco1, Xbal endonuclease reaction system are as shown in table 3.

Table 3

Endonuclease reaction system is placed in 37 DEG C of water-baths and places 3h, gel electrophoresis is carried out after endonuclease reaction, (1.2%) glue Recycling obtains linearizing p-DK6 plasmid vectors after digestion, restriction enzyme mapping as shown in figure 4, in Fig. 4 from left to right M be 1kb and DL2000maker, 1~4 is double restriction fragments, and 5 be p-DK6 carriers as negative control.

Step (3) utilizes Infusion kits, and the LUX target gene fragments after P-DK6 linear carriers and PCR are carried out Connection obtains p-LUX plasmids；Infusion reaction systems (10ul) are as shown in table 4.

Table 4

Infusion reaction systems are placed in PCR instrument, and reaction temperature is 50 DEG C, reaction time 30min.

Connection product converts Escherichia coli (ammonia benzyl resistance), and picking monoclonal shakes bacterium, and plasmid, matter are extracted using kit Grain send sequencing company to be sequenced, and obtains p-LUX plasmids.

Step (4) (particle gun model PDS-1000) in the way of " biolistic bombardment ", bombards the plant of high osmotic treatment P-LUX plasmids are imported tobacco by object tobacco leaf.

Biolistic bombardment tobacco leaf, concrete operations are as follows：

(a) blade pretreatment and the sterilizing of particle gun accessory prepare：In superclean bench, it is taken out from sterile culture flask It grows fine and Ben's tobacco leaf without curling is several, be cut into the blade of 20cm*20cm sizes, it is paraxial to be laid in height up It oozes in culture medium, places 4h；Meanwhile to 50% glycerine, 2.5M CaCl₂, filter paper, 1.5ml silication centrifuge tube, carrier film (Macrocarries), screen (Stopping Screens), rupture disk locking cap and carrier membrane support are terminated and carries out 120 DEG C The high pressure steam sterilization of 20min is handled, to the superclean bench residing for particle gun with 70% alcohol wipe sterilization, simultaneously 70% alcohol wipe sterilizing is also carried out to the cavity of particle gun PDS-1000；

Hypertonic culture medium prescription：MS basal mediums+0.1molL^-1Mannitol+0.1molL^-1Sorbierite+sucrose 30g·L^-1+ agar 8gL^-1, pH5.8,120 DEG C of high pressure sterilization 20min.

MS basal medium formulations are：Ammonium nitrate 33gL^-1, potassium nitrate 38gL^-1, potassium dihydrogen phosphate 3.4gL^-1, sulphur Sour magnesium 7.4gL^-1, calcium chloride 8.8gL^-1, potassium iodide 0.166gL^-1, boric acid 1.24gL^-1, four water manganese sulfate 4.46g L^-1, white vitriol 1.72gL^-1, Sodium Molybdate Dihydrate 0.05gL^-1, cupric sulfate pentahydrate 5mgL^-1, CoCL2 6H2O 5mg L^-1, ferrous sulfate heptahydrate 5.56gL^-1, disodium ethylene diamine tetraacetate 7.46gL^-1, glycine 20mgL^-1, inositol 100mg·L^-1, thiamine hydrochloride 20mgL^-1, pyridoxine hydrochloride 100mgL^-1, niacin 100mgL^-1；

(b) configuration of microcarrier：By taking 60 bombardment experiments as an example, 0.6 μm of bronze 30mg is weighed, 1.5ml is put it into Silication centrifuge tube in, 70% ethyl alcohol of 1ml is added into centrifuge tube, fully shaking 3~5 minutes on turbine mixer, concussion knot 15 minutes are stood after beam, 1500r/min is centrifuged about 5 seconds, abandons supernatant, and 1ml distilled water is added in obtained microcarrier precipitation Fully shaking 1 minute stands 1 minute after concussion, supernatant is abandoned after the above-mentioned aqueous solution containing microcarrier is substantially centrifuged, then Distillation washing 2 times is repeated, 50% sterilized glycerine of 500 μ l is added in obtained microcarrier precipitation, into silication centrifuge tube The 50 μ l of plasmid of a concentration of 1 μ g/ μ l are added, add 250 μ l 2.5M CaCl₂And 20 μ l 0.1M spermidines, sustained oscillation 2~3 minutes, about 2sec is centrifuged after standing 1 minute, supernatant is abandoned, (HPLC grades of 700 μ l, 70% ethyl alcohol is added in obtained precipitation Or spectrophotometer grade), supernatant is abandoned in centrifugation, and 700 μ l, 100% ethyl alcohol is added, and centrifugation is abandoned supernatant, is added in obtained precipitation 480 μ l, 100% ethyl alcohol, after lightly patting centrifugation tube wall for several times, fully shaking 2~3 minutes on the mixer of low speed, Obtain microcarrier；

(c) particle bombardment bombards blade：The rupture disk of 1100psi is gripped in 70% isopropanol with sterilized tweezers Infiltration disinfection, is positioned in rupture disk locking cap, and the radius that 8 μ l of microcarrier mixing absorption are uniformly applied to carrier film is In the center circle of 0.5cm, the sterile tobacco leaf after the high osmotic treatment 4h that learns from else's experience is positioned over transitional culture medium ware center, closes gene Rifle valve opens particle gun power supply, adjusting helium tank air pressure valve to 1300psi or so, is evacuated to -25in Hg, Hold keys It keeps, presses Fire keys, wait for that particle gun helium is depressed into 1100psi or so, can hear that a sound of " the sound of sth. throbbing or bursting ", end of bombardment open gene Rifle valve waits for that vacuum pressure pointer returns 0, then opens valve, takes out material, sealing is put in 25 DEG C of light culture case renewal cultivations one Week, renewal cultivation are light culture, and temperature is 22~26 DEG C；

Renewal cultivation based formulas is MS basal mediums+6-BA (6-benzyl aminopurine) 1mgL^-1+ NAA (methyl α-naphthyl acetate) 100ug·L^-1+ sucrose 30gL^-1+ agar 8gL^-1, pH5.8,120 DEG C of high pressure sterilization 20min；

Screening and culturing medium of the blade in the aadA (spectinomycin) containing 500mg/L is enterprising after renewal cultivation for step (5) Row screening：Entire tobacco leaf is cut into 5mm*5mm blades or so respectively, according to 3-4-4-3 (often row arrangement puts 3 respectively, 4,4, 3 vanelets) array is put into screening and culturing ware；

Screening and culturing based formulas is as follows：MS basal medium+6-BA 1mgL^-1+NAA 100ug·L^-1+ sucrose 30g L^-1+ agar 8gL^-1500mg/L, pH5.8,120 DEG C of high pressure sterilization 20min of+spectinomycin.

Screening and culturing condition is divided to two kinds, specific as follows：The first screening temperature is 25 DEG C, intensity of illumination 2000lux, light It is 12 hours/day according to the time, screening and culturing changes screening and culturing medium every 25d in the process, and keeping selection pressure, (aadA is a concentration of 500mg/L), upper screening and culturing begins with tender shoots and grows successively after 70 days；Second of screening temperature is 26 DEG C, and intensity of illumination is 10000lux, light application time are 18 hours/day, change screening and culturing medium every 20d, upper screening and culturing has green successively after 35 days Bud point is grown.

The bud point continuation that step (6) obtains on screening and culturing medium is screened on screening and culturing medium, and bud point can gradually grow up For larger callus, genotype identification is carried out to callus, is determined in callus containing the target fragment integrated, warp Sequencing result compares, and the target location on target fragment success site-directed integration to Chloroplast gene, callus is the positive.

Genotype identification process：

(a) complete genome DNA is extracted from blade：According to plant genes group DNA extraction kit (TIANGEN days Root model：DP320-03) specification is tested.

(b) PCR is verified：25ul reaction systems are configured, high concentration glue (2%-3%), 50bp marker (DL2000 are used Can also use) detection product.It need to ensure that stripe size is correct, no dimer send sequencing further verification.

If bioluminescence gene-plasmid vector p-LUX is successfully recombinated in the Chloroplast gene of Ben's tobacco, it is cured in the positive Gene order in the Chloroplast gene of injured tissue is as shown in Figure 5.

Then left and right homologous sequence primer is designed, PCR amplification is carried out.Right-f/r target stripe sizes are 2300bp, Left-f/r target stripe sizes are 1600bp.

Right-f:CTGGCGATGAGCGAAATGTA；Right-r:CATGGGGACGTAAAAAAGGG；

Left-f:GAATTCATTGGATCCTTTCCG；Left-r:CTGTAGCCCATTTAATTGCAT；

The PCR reaction systems (25ul) of bioluminescence gene-plasmid vector p-LUX are as shown in table 5.

Table 5

PCR reaction conditions are as shown in table 6

Table 6

Gel electrophoresis is carried out after PCR amplification, purpose band is distinguished using 1.2% glue, as shown in Figure 6.

1k, 2k, 750bp indicate the corresponding size of maker bands in Fig. 6,4~18 indicate that screening obtains respectively from left to right Sample number into spectrum, 19 be negative control (seeding-growth), detect whether as the positive.

1k, 2k, 3k indicate the corresponding size of maker bands in Fig. 7, and 1~13 be according to Left-f/r primer detections is sun The sample and sample number into spectrum of property.

Recycle purpose band, be compared with correct sequence after sequencing, it was demonstrated that sequence is completely correct, target gene at Work(site-directed integration obtains positive callus on tobacco chloroplast genome, and sequence alignment result is as follows：

Step (7) genotype identification is the callus of the positive, continues to cultivate on subculture screening and culturing medium, improves purpose The degree of homogenization of the gene in chloroplaset reaches 100%, and the degree of homogenization is detected using RT-PCR.

Subculture screening and culturing based formulas：MS basal medium+6-BA 1mgL^-1+NAA 100ug·L^-1+ sucrose 30g L^-1+ agar 8gL^-11000mg/L, pH5.8,120 DEG C of high pressure sterilization 20min of+spectinomycin；

Subculture screening conditions are as follows：Subculture screening and culturing temperature is 26 DEG C, intensity of illumination 10000lux, when daily illumination Between be 18 hours, subculture screening time be 30~60 days；

It is as follows using fluorescent quantitative PCR experiment detection degree of homogenization method：

a：It obtains laboratory and successfully imports the positive callus in LUX genes to tobacco chloroplast genome, extraction sun Property callus complete genome DNA：The complete genome DNA of acquisition needs to include chloroplast genomic dna as much as possible, to protect The degree of homogenization and the practical degree of homogenization error for demonstrate,proving the chloroplast transformation of detection are smaller, in actual mechanical process, because of sample Product amount is less, and cannot mill (loss is very big) in mortar, and because callus water content is higher, sample carries out liquid nitrogen cooling Afterwards, it can not be smashed on proof press, therefore callus is cut into fritter be put into sterilizing into possible in superclean bench Then 1.5ml centrifuge tubes are ground sample in centrifuge tube using grinding rod, the sample after grinding is according to high-efficiency plant genome The method of DNA extraction kit (DP350, Tiangeng, TIANGEN) extracts full-length genome, and protection DNA's is complete to greatest extent Property, the genomic DNA fragment of extraction is big, and purity is high, and the full-length genome of extraction obtains in 0.8%~1.2% gel electrophoresis Band need to be single band, traction is less, and size in 10k or more, then the complete genome DNA obtained can be used as template DNA, And survey DNA concentration；If the item obtained is illustrated in fig. 8 shown below the sheet for extraction with traction phenomenon it is not recommended that as template DNA Family name's tobacco sample callus complete genome DNA, M is 1kb maker, M1 DL2000maker in Fig. 8, sample 1,3,4,6, 7,10,13,17,20,21 main bands are more visible, and traction is less, is suitable as template DNA；2,8,15,16,19,22 main item of sample Band is not limpid in sight enough, is not suitable as template DNA；Sample 5,9,11,12,14, though 18 main bands are limpid in sight, traction compared with It is more, it is not recommended that as template DNA.

b：Target gene is chosen to be located on skeleton carrier screening-gene aadA genes；Reference gene is chosen in tobacco chloroplast On genome, not on homologous sequence ORF131 genes and 16SrRNA genes.Using 7 Software for Design target gene of oligo and The primer of reference gene, send sequencing company to synthesize, and carries out preliminary experiment to verify the specificity of primer；

PCR preliminary experiments are verified：When purpose band and internal reference band are closely expanded, PCR reaction systems (25 μ L) such as 7 institute of table Show.

Table 7

PCR reaction conditions are as shown in table 8.

Table 8

PCR carries out gel electrophoresis after reaction, recycles to obtain target fragment using 2.5% high concentration glue, need to ensure item Band size is correct, no dimer, then can send sequencing further verification, find the specificity of two pairs of primers preferably.

Target gene is selected from the Partial Fragment of the aadA genes on carrier, and reference gene is selected from chloroplast genomic dna Ycf2 genes Partial Fragment, the base sequence of aadA genes and ycf2 genes can find in NCBI.

Target gene primer 1：

RT-aadA-F1：CCTTTTGGAAACTTCGGCTT；

RT-aadA-R1：AAGATAGCCAGATCAATGTCG；

The purpose band sequence 1 (being located on aadA genes) of corresponding target gene 1：

CCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACG ACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGT ATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTT；

Reference gene primer 1：

NC-F1：GTCATTTGATCCAATAGCGTTC；

NC-R1：CTGGTTTATCAAGAATACGCAAG；

1 corresponding purpose band sequence 1 (being located on ycf2 genes) of reference gene primer：

GTCATTTGATCCAATAGCGTTCCGTTAGATAGGAACAGATTTGATAAATACTGATAACTCTCGGATAGAGTATTAGA ACGGAAAGATCCATTAGATAATGAACTGTTGGTTCTAAGCCATCTCTGACGATTAATCAACAATTCGAAGTGCTTTT CTTGCGTATTCTTGATAAACCAG；

c：Single pair primer amplification efficiency and solubility curve are verified, ensures that interior participation target gene amplification efficiency is identical：Step (1) complete genome DNA obtained is according to 1：10、1：100、1：1000、1：10000 serial dilutions are each to dilute as template DNA It than doing 4 repetitions, while doing quantitative PCR and internal reference and target gene is quantified, quantitative PCR system (20 μ L) is as shown in table 9：

Table 9

20 μ L system loadeds centrifuge ice bath, and using a set of liquid-transfering gun, often plus a sample changes pipette tips, and sample is loaded To 96 orifice plates, obtained using Quantstudio 12k Flex fluorescent quantitation pcr instrument (ABI, Applied biosystems) Amplification curve and solubility curve data.If internal reference expands standard curve and the amplification efficiency of target gene amplification standard curve exists Between 98%~102%, and the two slope differences show that internal reference is chosen properly, if solubility curve is to list between 0.001~0.02 Peak shows that data reliability is strong.Fig. 9 is the amplification curve of LUX-BS (Ben's) reference gene and target gene, Figure 10 LUX- The standard curve of BS (Ben's) reference gene, Figure 11 are the standard curve of LUX-BS (Ben's) target gene, and the standard of the two is bent Line slope difference is 0.003, coincidence loss range, and it is suitable that internal reference is chosen, and Figure 12 is LUX-BS (Ben's) reference genes and purpose base The solubility curve of cause is all unimodal, shows that data reliability is strong.

d：Fluorescent quantitative PCR experiment：The complete genome DNA that step (1) has been extracted is according to 1:10、1:100、1:1000、 1:10000 serial dilutions are as template DNA, and each thinner ratio does 4 repetitions, and PCR system is as shown in table 3, and reaction condition is upper It is arranged in machine operation, the use of instrument is Quantstudio 12k Flex fluorescent quantitation pcr instrument (ABI, U.S.A. applied biosystem Company), operate the computer that steps are as follows：(1) it is loaded to 96 orifice plates, using a set of liquid-transfering gun, often plus a sample changes pipette tips, ensures to add The accuracy of sample；(2) each sample is repeated 4 times, and records the corresponding sample in good each hole；(3) it is sealed using sealed membrane, as possible not Touch the position among 96 orifice plates；(4) program is arranged, and " plate setup ", which is mainly used for setting on plate, needs fluoroscopic examination Sample position, " edit " enters setting interface, clicks the hole for being corresponding with sample, PCR is arranged in " protocol setup " Response procedures, setting are as follows：

Step 1:95℃30s 1cycle

Step 2:95℃15s

58℃30s

72℃30s

40cycles

Step 3:Melt curve analysis is set using default setting

The response procedures setting reference of melting point curve：(general only there are one steps, with the progress of cycle, annealing temperature Degree is constantly raising and reducing)

(1) it is inserted into a cycle in the place of melting point curve to be set as.

(2) melting point curve data step is collected in response procedures listed files input initial temperature (annealing temperature 58 ℃)。

(3) it inputs the retention time of the step, when input, such as to input 10 seconds, " 0 can be inputted:10 " or " 0.10 ".

After experiment, access evidence is copied using the USB flash disk of formatting, is analyzed.

It calculates：Calculate the homogeneous percentage of sample according to data, the standard curve of reference gene and target gene Slope of standard curve is respectively 1 and 0.997, and the solubility curve of reference gene and target gene is all unimodal, is suitble to calculating side Method is △ ct methods:Expression=2^-△ct, such as the percentage that the following table 10 is LUX positive callus, sample 75 and 78 homogeneities in table 10 It is more than 100% to change percentage, but in allowable range of error, it is believed that the degree of homogenization has reached 100%.

10 LUX genes of table degree of homogenization result in tobacco chloroplast genome

The positive callus of step (8) homogeneity 100%, which is placed on root media, to be cultivated, and target gene homogeneity is obtained The positive tobacco plant of change degree 100%；

The ingredient of the root media is as follows：Prescription of rooting medium is MS₀Culture medium+sucrose 30g/L+ spectinomycins 3g/L, pH5.8,120 DEG C of high pressure sterilization 20min of 1000mg/L+ plant gels.

MS₀Basal medium formulation is：Ammonium nitrate 33gL^-1, potassium nitrate 38gL^-1, potassium dihydrogen phosphate 3.4gL^-1, Magnesium sulfate 7.4gL^-1, calcium chloride 8.8gL^-1, potassium iodide 0.166gL^-1, boric acid 1.24gL^-1, four water manganese sulfates 4.46g·L^-1, white vitriol 1.72gL^-1, Sodium Molybdate Dihydrate 0.05gL^-1, cupric sulfate pentahydrate 5mgL^-1, six water chlorinations Cobalt 5mgL^-1, ferrous sulfate heptahydrate 5.56gL^-1, disodium ethylene diamine tetraacetate 7.46gL^-1；

Self-luminous tobacco condition of taking root is as follows：Sterile ventilative, cultivation temperature is 26 DEG C, intensity of illumination 10000lux, often Its light application time is 18 hours, and rootage duration is 25~30 days.

Step (9) self-luminous tobacco is in instrument AB-2270Luminescencer Octa (single tube luminometer) 20min, light quantum intensity are 2.2x10⁷Photos/min, can be by after bore hole adapts to dark condition 3~5min in darkroom Gradually see that tobacco sends out fainter fluorescence, Figure 13 is fluorescence shooting effect, the use of instrument is Full-automatic chemiluminescence detection system System (day energy model：5200) two figures indicate positive callus in nature respectively up and down on the left side in, time for exposure 5min, Figure 13 Photo in light and dark, two width figures are photo of the WT lines blade under natural light and dark condition up and down on the right.

For receptor, LUX Data mining self-luminous tobaccos are transferred in gas Chloroplast gene with your cigarette (tetraploid) for embodiment 2

The source of step (1) LUX genes, amplification system are the same as embodiment 1.

The construction method of step (2) p-LUX carriers is the same as embodiment 1.

Step (3) uses " biolistic bombardment " mode by p-LUX vector introduction tobaccos：Hypertonic culture medium and blade high osmotic treatment Mode is with embodiment 1, and also with embodiment 1, particle bombardment bombards blade for the sterilization treatment of particle gun accessory and the preparation of microcarrier With embodiment 1 only difference is that the target distance of embodiment 2 is only 6cm, renewal cultivation based formulas and renewal cultivation mode With embodiment 1.

Screening and culturing medium of the blade in the aadA (spectinomycin) containing 500mg/L is enterprising after renewal cultivation for step (4) Row screening：Entire tobacco leaf is cut into 5mm*5mm blades or so respectively, according to 3-4-4-3 (often row arrangement puts 3 respectively, 4,4, 3 vanelets) array is put into screening and culturing ware；Screening and culturing based formulas is the same as embodiment 1.

Screening and culturing condition is specific as follows：In illumination box, (Shanghai one is permanent, model：MGC-350BF-2 culture in), sieve It is 26 DEG C, intensity of illumination 8000lux to select temperature, and light application time is 22 hours/day, and screening and culturing medium, upper sieve were changed every 15 days After selecting 25 days, there is green bud point to grow successively.

The bud point continuation that step (5) obtains on screening and culturing medium is screened on screening and culturing medium, and bud point can gradually grow up For larger callus, genotype identification is carried out to callus, is determined in callus containing the target fragment integrated, warp Sequencing result compares, and the target location on target fragment success site-directed integration to Chloroplast gene, callus is the positive.

Genotype identification process：

The method of complete genome DNA is extracted with embodiment 1, PCR reaction systems and condition and the same embodiment of gel strength 1, primer as different from Example 1, because LUX genes are larger (6.7kb), can not complete P go out, choose among LUX genes one section Design primer is lux-jc-f3/r3, and primer sequence is as follows, and Figure 14 is the PCR glue figure knots your cigarette receptor obtains positive callus Fruit, M is DL2000maker in Figure 14, and 16 be negative control, and 17 be positive control, and sample 6 and 14 is the positive, and segment recycling is surveyed Sequence, completely correct through comparing, target gene has succeeded on site-directed integration to your cigarette Chloroplast gene, obtains positive callus Tissue.

Lux-jc-f3:AGTCAGTAAATAATTGCCAT；

Lux-jc-r3:AGTAATTGAACTAAGCTCAT；

Subculture screening and culturing based formulas：MS basal medium+6-BA 1mgL^-1+NAA 100ug·L^-1+ sucrose 30g L^-1+ agar 8gL^-11500mg/L, pH5.8,120 DEG C of high pressure sterilization 20min of+spectinomycin；

Subculture screening conditions are as follows：Subculture screening and culturing temperature is 26 DEG C, is 9000lux, daily illumination in intensity of illumination Time is 20 hours/day, and screening and culturing medium was changed every 15 days, and subculture screening time is 25~50 days；

The degree of homogenization is detected using fluorescent quantitative PCR experiment, experimentation is the same as embodiment 1, reference gene primer and mesh Gene primer with embodiment 1, the amplification curve of LUX-G (your cigarette) target gene and reference gene that are obtained according to experiment is as schemed Shown in 15, the slope differences of standard curve are 0.006 between the two, illustrate that internal reference is chosen properly, Figure 16 is LUX-G (your cigarette) purpose The solubility curve of gene and reference gene is all unimodal, illustrates that data reliability is strong, is suitble to calculate using △ ct methods, calculates knot Fruit is as shown in table 11, and 4 samples are not belonging to same batch of sample in table 11, and sample 17 and 20 degrees of homogenization are more than 100%, are belonged to In error range, it could be theoretically argued that the degree of homogenization reaches 100%.Sample 16 is obtained using screening technique provided by the invention The sample arrived, the degree of homogenization are relatively low.

Table 11

Number	lux-g-1	lux-g-2	lux-g-3	lux-g-4
					Sample	Sample 16	Sample 17	Sample 20	Sample 21
Reference gene ct values	7.01	7.891	7.165	9.204
					Target gene ct values	9.163	7.691	6.908	9.446
△ct	2.153	-0.2	-0.257	0.242
					2^- △ ct (degree of homogenization)	22.48%	115%	119.5%	84.55%

The ingredient of the root media is as follows：Prescription of rooting medium is MS₀Culture medium+sucrose 30g/L+ spectinomycins 8g/L, pH5.8,120 DEG C of high pressure sterilization 20min of 500mg/L+ agar.

Self-luminous tobacco condition of taking root is as follows：Sterile ventilative, cultivation temperature is 26 DEG C, intensity of illumination 9000lux, daily Light application time is 16 hours, and rootage duration is 15~20 days.

Step (9) self-luminous tobacco is in instrument AB-2270 Luminescencer Octa (single tube luminometer) 20min, light quantum intensity are 4.2 x10⁷Photos/min, can be by after bore hole adapts to dark condition 5min in darkroom Gradually see that tobacco sends out faint fluorescence.

SEQUENCE LISTING

<110>The Yunnan bio tech ltd Na Bo

<120>A kind of self-luminous tobacco and transgenic method

<130> 2017.1.12

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 8308

<212> DNA

<213>It is artificial synthesized

<400> 1

cttaacgcta tggaactcgc cgcccgactg ggctggcgat gagcgaaatg tagtgcttac 60

gttgtcccgc atttggtaca gcgcagtaac cggcaaaatc gcgccgaagg atgtcgctgc 120

cgactgggca atggagcgcc tgccggccca gtatcagccc gtcatacttg aagctagaca 180

ggcttatctt ggacaagaag aagatcgctt ggcctcgcgc gcagatcagt tggaagaatt 240

tgtccactac gtgaaaggcg agatcaccaa ggtagtcggc aaataatgtc tagctagagc 300

gatcctggcc tagtctatag gaggttttga aaagaaagga gcaataatca ttttcttgtt 360

ctatcaagag ggtgctattg ctcctttctt tttttctttt tatttattta ctagtatttt 420

acttacatag acttttttgt ttacattata gaaaaagaag gagaggttat tttcttgcat 480

ttattcatgg gggatcactt tgacaattga atccgatttt gaccattatt ttcatatccg 540

taatagtgcg aaaagaaggc ccggctccaa gttgttcaag aatagtggcg ttgagtttct 600

cgaccctttg acttaggatt agtcagttct atttctcgat ggggcgggga agggatataa 660

ctcagcggta gagtgtcacc ttgacgtggt ggaagtcatc agttcgagcc tgattatccc 720

taagcccaat gtgagttttt ctagttggat ttcgaggcct cgaaagctcc cccgccgtcg 780

ttcaatgaga atggataaga ggctcgtggg attgacgtga gggggcaggg atggctatat 840

ttctgggagc gaactccggg cgaatatgaa gcgcatggat acaagttatg ccttggaatg 900

aaagacaatt ccgaatccgc tttgtctacg aacaaggaag ctataagtaa tgcaactatg 960

aatctcatgg agagttcgat cctggctcag gatgaacgct ggcggcatgc ttaacacatg 1020

caagtcggac gggaagtggt gtttccagtg gcggacgggt gagtaacgcg taagaacctg 1080

cccttgggag gggaacaaca gctggaaacg gctgctaata ccccgtaggc tgaggagcaa 1140

aaggaggaat ccgcccgagg aggggctcgc gtctgattag ctagttggtg aggcaatagc 1200

ttaccaaggc gatgatcagt agctggtccg agaggatgat cagccacact gggactgaga 1260

cacggcccag actcctacgg gaggcagcag tggggaattt tccgcaatgg gcgaaagcct 1320

gacggagcaa tgccgcgtgg aggtagaagg cccacgggtc gtgaacttct tttcccggag 1380

aagaagcaat gacggtatct ggggaataag catcggctaa ctctgtgcca gcagccgcgg 1440

taatacagag gatgcaagcg ttatccggaa tgattgggcg taaagcgtct gtaggtggct 1500

ttttaagtcc gccgtcaaat cccagggctc aaccctggac aggcggtgga aactaccaag 1560

ctggagtacg gtaggggcag agggaatttc cggtggagcg gtgaaatgcg tagagatcgg 1620

aaagaacacc aacggcgaaa gcactctgct gggccgacac tgacactgag agacgaaagc 1680

taggggagcg aatgggatta gataccccag tagtcctagc cgtaaacgat ggatactagg 1740

cgctgtgcgt atcgacccgt gcagtgctgt agctaacgcg ttaagtatcc cgcctgggga 1800

gtacgttcgc aagaatgaaa ctcaaaggaa ttgacggggg cccgcacaag cggtggagca 1860

tgtggtttaa ttcgatgcaa agcgaagaac cttaccaggg cttgacatgc cgcgaatcct 1920

cttgaaagag aggggtgcct tcgggaacgc ggacacaggt ggtgcatggc tgtcgtcagc 1980

tcgtgccgta aggtgttggg ttaagtcccg caacgagcgc aaccctcgtg tttagttgcc 2040

atcgttgagt ttggaaccct gaacagactg ccggtgataa gccggaggaa ggtgaggatg 2100

ccgtcaagtc atcatgcccc ttatgccctg ggcgacacac gtgctacaat ggccgggaca 2160

aagggtcgcg atcccgcgag ggtgagctaa ccccaaaaac ccgtcctcag ttcggattgc 2220

aggctgcaac tcgcctgcat gaagccggaa tcgctagtaa tcgccggtca gccatacggc 2280

ggtgaattaa ttcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta 2340

cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg 2400

cccgcaccga tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg cgcctgatgc 2460

ggtattttct ccttacgcat ctgtgcggta tttcacaccg catacgtcaa agcaaccata 2520

gtacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac 2580

cgctacactt gccagcgcct tagcgcccgc tcctttcgct ttcttccctt cctttctcgc 2640

cacgttcgcc ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt 2700

tagtgcttta cggcacctcg accccaaaaa acttgatttg ggtgatggtt cacgtagtgg 2760

gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag 2820

tggactcttg ttccaaactg gaacaacact caactctatc tcgggctatt cttttgattt 2880

ataagggatt ttgccgattt cggtctattg gttaaaaaat gagctgattt aacaaaaatt 2940

taacgcgaat tttaacaaaa tattaacgtt tacaatttta tggtgcactc tcagtacaat 3000

ctgctctgat gccgcatagt taagccagcc ccgacacccg ccaacacccg ctgacgcgcc 3060

ctgacgggct tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag 3120

ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc gcgagacgaa agggcctcgt 3180

gatacgccta tttttatagg ttaatgtcat gataataatg gtttcttaga cgtcaggtgg 3240

cacttttcgg ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa 3300

tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa 3360

gagtatgagt attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct 3420

tcctgttttt gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg 3480

tgcacgagtg ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg 3540

ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt 3600

atcccgtatt gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga 3660

cttggttgaa tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga 3720

attatgcagt gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac 3780

gatcggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg 3840

ccttgatcgt tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac 3900

gatgcctgta gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct 3960

agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct 4020

gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg 4080

gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat 4140

ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg 4200

tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat 4260

tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct 4320

catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa 4380

gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa 4440

aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc 4500

gaaggtaact ggcttcagca gagcgcagat accaaatact gttcttctag tgtagccgta 4560

gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct 4620

gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg 4680

atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag 4740

cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc 4800

cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg 4860

agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 4920

tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg 4980

gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca 5040

catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg 5100

agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc 5160

ggaagagcgc ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 5220

ctggcacgac aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag 5280

ttagctcact cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg 5340

tggaattgtg agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa 5400

gctctagcta gaggatcttt cttgatcaat ccctttgccc ctcattcttc aagaataagg 5460

aagatccttt tcaagtttga atttgttcat ttggaatctg ggttcttcta cttcatattt 5520

atttaatatg aatattttcc ctctcttttt tttatatcat tccttaagtc ccataggttt 5580

gatcctgtag aatttgaccc attttctcat tgaacgaaag gtacgaaata aatcagattg 5640

ataaaagtac catgtgaaat cttcggtttt tccccttcct cgatccctat cccataggtt 5700

aggtacagtg tttgaatcaa tagagaacct tttcttctgt atgaatcgat attattccat 5760

tccaaatcct tcccgatacc tcccaaggaa aatctcgaat ttggatccca aattgacggg 5820

ttagtgtgag cttatccatg cggttatgca ctctttgaat aggaatccgt tttctgaaag 5880

atcctggctt tcgtactttg gtgggtctcc gagatccttt cgatgaccta tgttgaaggg 5940

atatctatct aatccgatcg attgcgtaaa gcccgcggta gcaacggaac cggggaaagt 6000

atacagaaaa gacagttctt ttctattata ttagtatttt ctattatatt agatatatta 6060

gactattata ttagattagt attagttagt gatcccgact tagtgagtct gatgaattgt 6120

tggcaccagt cctacatttt gtctctgtgg accgaggaga aaaggggctc ggcgggaaga 6180

ggagtgtacc atgagagaag caaggaggtc aacctctttc aaatatacaa cataaattct 6240

ggcaatgtag ttggactctc atgtcgatcc gaatgaatca tcctttccac ggaggtaaat 6300

ctttgcctgc taggcaagag gatagcaagt tccaaattct gtctcggtag gacatgtatt 6360

tctattacta tgaaattcat aaatgaagta gttaatggta gggttaccat tatccttttt 6420

gtagtgacga atcttgtatg tgttcctaag aaaaggaatt tgtccatttt tcggggtctc 6480

aaaggggcgt ggaaacgcat aagaactctt gaatggaaaa gagatgtaac tccagttcct 6540

tcggaatcgg tagtcaatcc tatttccgat aggggcagtt aaagtctcgg aattcgagct 6600

cggtacccaa agctcccccg ccgtcgttca atgagaatgg ataagaggct cgtgggattg 6660

acgtgagggg gcagggatgg ctatatttct gggagcgaac tccgggcgaa tacgaagcgc 6720

ttggatacag ttgtagggag ggatccatgg caccacaaac agagagccca gaacgacgcc 6780

cggccgacat ccgccgtgcc accgaggcgg acatgccggc ggtctgcacc atcgtcaacc 6840

actacatcga gacaagcacg gtcaacttcc gtaccgagcc gcaggaaccg caggagtgga 6900

cggacgacct cgtccgtctg cgggagcgct atccctggct cgtcgccgag gtggacggcg 6960

aggtcgccgg catcgcctac gcgggcccct ggaaggcacg caacgcctac gactggacgg 7020

ccgagtcgac cgtgtacgtc tccccccgcc accagcggac gggactgggc tccacgctct 7080

acacccacct gctgaagtcc ctggaggcac agggcttcaa gagcgtggtc gctgtcatcg 7140

ggctgcccaa cgacccgagc gtgcgcatgc acgaggcgct cggatatgcc ccccgcggca 7200

tgctgcgggc ggccggcttc aagcacggga actggcatga cgtgggtttc tggcagctgg 7260

acttcagcct gccggtaccg ccccgtccgg tcctgcccgt caccgagatc tgatgatcga 7320

attcctgcag cccgggggat ccactagttc tagagtagac attagcagat aaattagcag 7380

gaaataaaga aggataagga gaaagaactc aagtaattat ccttcgttct cttaattgaa 7440

ttgcaattaa actcggccca atcttttact aaaaggattg agccgaatac aacaaagatt 7500

ctattgcata tattttgact aagtatatac ttacctagat atacaagatt tgaaatacaa 7560

aatctagcaa gcttccgatc tacatacacc ttggttgaca cgagtatata agtcatgtta 7620

tactgttgaa taacaatcct tccattttct attttgattt gtagaaaact agtgtgcttg 7680

ggagtccctg atgattaaat aaaccaagat tttaccatga gggaagcggt gatcgccgaa 7740

gtatcgactc aactatcaga ggtagttggc gtcatcgagc gccatctcga accgacgttg 7800

ctggccgtac atttgtacgg ctccgcagtg gatggcggcc tgaagccaca cagtgatatt 7860

gatttgctgg ttacggtgac cgtaaggctt gatgaaacaa cgcggcgagc tttgatcaac 7920

gaccttttgg aaacttcggc ttcccctgga gagagcgaga ttctccgcgc tgtagaagtc 7980

accattgttg tgcacgacga catcattccg tggcgttatc cagctaagcg cgaactgcaa 8040

tttggagaat ggcagcgcaa tgacattctt gcaggtatct tcgagccagc cacgatcgac 8100

attgatctgg ctatcttgct gacaaaagca agagaacata gcgttgcctt ggtaggtcca 8160

gcggcggagg aactctttga tccggttcct gaacaggatc tatttgaggc gctaaatgaa 8220

accttaacgc tatggaactc gccgcccgac tgggctggcg atgagcgaaa tgtagtgctt 8280

acgttgtccc gcatttggta cagcgcag 8308

Claims

1. a kind of self-luminous tobacco, which is characterized in that the self-luminous tobacco is shone by bioluminescence gene and plamid vector construction Gene-plasmid vector expression vector, bioluminescence gene-plasmid vector again by plastid transgene technological sourcing to tobacco leaf, Tobacco leaf is obtained by tissue cultures.

2. self-luminous tobacco as described in claim 1, which is characterized in that the plasmid vector is p-DK6 plasmid vectors, base Sequence is as shown in SEQ ID NO.1.

3. self-luminous tobacco as described in claim 1, which is characterized in that the bioluminescence gene is LUX genes.

4. a kind of transgenic method of self-luminous tobacco, which is characterized in that the transgenic method operation is as follows：It is closed by gene At obtaining bioluminescence gene LUX sequences, and carry out PCR amplification；Then NcoI restriction enzymes and XbaI restriction enzymes are used Digestion p-DK6 plasmid vectors obtain linearisation p-DK6 plasmid vectors, and bioluminescence gene LUX is connected to linearisation p-DK6 plasmids On carrier, bioluminescence gene-plasmid vector is obtained, is imported bioluminescence gene-plasmid vector bombardment through hypertonic culture using particle gun In tobacco leaf afterwards；

The tobacco leaf of bioluminescence gene-plasmid vector is imported with after recovery media culture, then in screening and culturing medium Screening and culturing is carried out, positive callus is obtained, positive callus continues subculture screening and culturing and obtains being cured for homogeneity 100% Injured tissue, and then induce seedling to obtain self-luminous tobacco in root media.

5. the transgenic method of self-luminous tobacco as claimed in claim 4, which is characterized in that the biolistic bombardment Tobacco Leaf The condition of piece is as follows：Particle gun helium is depressed into 1050~1150psi, and target distance is 6cm or 9cm.

6. the transgenic method of self-luminous tobacco as claimed in claim 4, which is characterized in that the bioluminescence gene LUX is carried out Primer pair when PCR amplification is as follows：

Preceding primer primer-F：AGGGAGGGATCCATGGGAATACCAAAGGAGATTAC；

Primer primer-R afterwards：TAATGTCTACTCTAGAAATATCCCTATAAATAGAAC.

7. the transgenic method of self-luminous tobacco as claimed in claim 4, which is characterized in that the hypertonic condition of culture is such as Under：Hypertonic culture medium prescription is MS basal mediums+mannitol 0.05~0.3mol/L+ sorbierite 0.05~0.2mol/L+ sugarcanes Sugar 25~35g/L+, 6.8~9g/L of agar, pH5.6~6；The high osmotic treatment time is 3~5h, and room temperature sealing is placed；

The renewal cultivation condition is as follows：Renewal cultivation based formulas is 0.5~1.5mgL of MS basal medium+6-BA^-1+NAA 50~180ugL^-125~35gL of+sucrose^-16.8~9gL of+agar^-1, pH5.6~6；Renewal cultivation is light culture, temperature It it is 22~26 DEG C, incubation time is 5~10 days.

8. the transgenic method of self-luminous tobacco as claimed in claim 4, which is characterized in that be imported with bioluminescence gene-plastid The tobacco leaf of carrier obtains positive callus by 2~4 wheel screening and culturings；Screening conditions are as follows：Screening and culturing based formulas For 0.5~1.5mgL of MS basal medium+6-BA^-150~180ugL of+NAA^-125~35gL of+sucrose^-1+ agar 6.8 ~9gL^-500~2000mg/L of+spectinomycin, pH5.6~6；

Screening and culturing temperature is 22~26 DEG C, and intensity of illumination is 1500~2500lux, and daily light application time is 12~14 hours, The screening and culturing time is 70~85 days；Or screening and culturing temperature is 22~26 DEG C, intensity of illumination is 8000~11000lux, often Its light application time is 14~16 hours, and the screening and culturing time is 35~45 days.

9. the transgenic method of self-luminous tobacco as claimed in claim 4, which is characterized in that the positive callus of acquisition after It is continuous to cut into pieces, it is positioned over 1~3 wheel of screening in subculture screening and culturing medium and obtains the positive callus of the degree of homogenization 100%；

Subculture screening conditions are as follows：Subculture screening and culturing based formulas is 0.5~1.5mgL of MS basal medium+6-BA^-1+NAA 50~180ugL^-125~35gL of+sucrose^-1+ agar 6.8~9gL+ spectinomycins 500~2000mg/L, pH5.6~ 6.2；Subculture screening and culturing temperature is 25~28 DEG C, and intensity of illumination is 8000~12000lux, and daily light application time is 12~18 Hour, subculture screening time is 30~60 days.

10. the transgenic method of self-luminous tobacco as claimed in claim 4, which is characterized in that the callus group of homogeneity 100% Be woven in darkroom can naked eye to fluorescence, callus is cut into pieces and is positioned in root media that obtain energy self luminous Tobacco, root media composition are as follows：

Prescription of rooting medium：MS₀Culture medium+sucrose 25~35g/L+, 500~2000mg/L+ of spectinomycin plant gels 2~ 4g/L, pH5.6~6.2.