CN108517322B - Pinellia palmata trypsin inhibitor gene, protein coded by same and insect-resistant application - Google Patents

Abstract

The invention discloses a palmate pinellia ternata trypsin inhibitor gene, and a protein coded by the same and insect-resistant application of the palmate pinellia ternata trypsin inhibitor gene. The nucleotide sequence table of the gene is shown as SEQ ID NO: 1 is shown. When breeding insect-resistant transgenic plants, firstly constructing a transgenic plant containing SEQ ID NO: 1, then constructing a transformant by using the obtained recombinant expression vector, then transforming a target plant by using the obtained transformant, screening a positive plant, and obtaining a homozygous transgenic plant with insect resistance compared with a normal plant by third-generation screening. The inventor proves that the gene has obvious improvement effect on the insect resistance of the plant through a large amount of scientific researches, and proves that the gene has close relation with the insect resistance of the plant, so that the transgenic plant with high insect resistance is obtained by utilizing the existing genetic engineering method, and the gene has great practical significance for reducing pesticide and preventing aphids, and improving the crop planting efficiency and the planting yield.

Description

Pinellia palmata trypsin inhibitor gene, protein coded by same and insect-resistant application

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a preparation method of a pinellia ternata protease inhibitor gene, a coded protein and application thereof in insect resistance.

Background

Aphids are the fastest-breeding insects, harm crops widely on the earth, are difficult to control due to the development of various self-protection defense modes, and some varieties can secrete phytohormones, so that plants form gall nests; is provided withThe secretion of a layer of wax covers the body surface, so that the medicine is difficult to permeate; some released strong mustard oil smell frightened natural enemies. Aphids are also transmission media of a plurality of diseases in agriculture, and cotton aphid secretion is an important allergen of human respiratory tracts and seriously damages the living environment of urban and rural areas. Pinellia Ternata (rhizoma Pinelliae)Pinellia pedatisecta) Is a Chinese herbal medicine with natural insect-resistant property. The chemical components mainly comprise alkaloids, fatty acids, agglutinins, proteins and the like, and the total protein components have lethal activity on sucking mouth insects such as the sitobion avenae, the cotton aphids, the green peach aphids and the like. The resistance of the crops to aphids is improved by using the characteristic and adopting a biotechnology method. The current research situation and development dynamics at home and abroad are summarized as follows.

The method has the advantages that the number of the aphid-resistant genes cloned at present is small. The aphid-resistant resources mostly exist in wild species or near-source species, and only 11 resistant sources are screened from 3500 soybean germplasms; 2 resistance sources were screened from 1200 lettuce germplasm; of the 4 ten thousand wheat sources, only 300 showed resistance. The resistance of plants to insects can generally be divided into 3 types, namely repellency, resistance and tolerance, of which the resistance effects are most pronounced, including polygenic control and monogenic (cryptic) control, e.g. wheat to the aphid mitrella (A), (B), (C) and (C)Diuraphis noxiaResistance of Mordvilko), Soybean to Aphis glycines (A. sojae) ((B. sojae)) (Aphis glycinesMatsumura) is singleplex gene controlled; however, it is also found in wheat and barley for the treatment of pea aphid: (Acythosiphon pisumHarris), corn aphid (Rhopalosiphum maidisFitch), the resistance controlled by quantitative characters is more. Theoretically, only the resistance controlled by a single gene is beneficial to be applied to other species through gene cloning and transformation, and more resources are suitable for distant hybridization or conventional breeding of the crop. With the development of plant genomics and functional genomics, some aphid-resistant genes were cloned, such as: wild tomatoMi-1Gene resistant to Long-tube aphid (Yunyang)Macrosiphum euphorbiae) The other one of the twoVatGene capable of resisting melon aphis gossypii (A)Aphis gossypiiGlover), these aphid-resistant genes are generally associated with plant hypersensitivity reactions, i.e. the corresponding plants recognize the signals invaded by aphids, to synthesize phenolic substances, to deposit on the cell wallAccumulation of callose, lignin, etc. against aphids. Although the aphid-resistant genes are cloned, the aphid types are many, and the aphid types which can be resisted by one gene are too few, so that the requirement of insect resistance of crops can not be met.

And the pinellia ternate has the advantage of aphid resistance. Pinellia palmata is a natural Chinese herbal medicine with high aphid resistance and no special taste, the insect-resistant active substances of pinellia palmata are separated from 90 s, the main effect is considered to be formed by phytohemagglutinin, and the pinellia palmata is cloned from the pinellia palmata in sequencePPA-1、PTA-1And a plurality of genes have certain application value in the aspect of aphid resistance. In addition, 2010 fanhandong et al identified a new aphid-resistant active substance, i.e. plant trypsin inhibitor, (from total protein of tuber of pinellia ternataPinellia peatisectaTrypsin inhibitor, hereinafter called PPTI protein orPPTIGene) type of aphid-resistant protein: when the concentration reaches 0.5%, the corrected death rate of aphids reaches 100% after 5 days. More importantly, the substance is pure protein without sugar measured by SDS-PAGE and reversed phase high performance liquid chromatography, and the mass spectrum analysis shows that the relative molecular weight is 20596.09. Compared with other insect-resistant active proteins, the PPTI protein has the following advantages: firstly, it is the result of the action of pure protein, compared with agglutinin family depending on the combination with sugar, the gene is easier to construct transformation vector, and the application plant range is wide; secondly, protease inhibitors generally have a broader spectrum of resistance to insects, and therefore it is speculated that PPTI will be resistant to a wide range of aphids; third, insects are less likely to develop tolerance to protein inhibitors. We have further studied and found that such proteins can be expressed at high concentrations induced by mechanical damage and invasion by diseases and pests at the leaf site of pinellia ternata.

The insect resistance and the characteristics of the protease inhibitor. The past scholars have studied a lot of things on this, such as: cowpea used in system research of Daketong et al, Du Guo Qiang et alCpTIThe gene transforms the apples, and 2 of 60 transformation strains have the resistance to the cotton bollworms reaching 100 percent; the research of insect pest induction poplar trypsinKTIThe over-expression of the gene defines the poplarKTIThe functional diversity of gene family and its disease-resisting and insect-resisting action. Xuping et al clone from wheatInhibitors of BBI-type proteasesTaUESGenes and proved to be involved in salt and drought stress responses. Three major protease inhibitors, namely serine, thioyl and metalloprotease inhibitors, have been discovered in plants at present, the PPTI protein of the invention belongs to the first class and serine protease inhibitors, the serine protease inhibitors have at least 6 families, but only part of the members have stronger resistance functions, besides the above, the protease inhibitors of arc beans and potatoes also have various differences in stress resistance types and effects, and the expression level of the protease inhibitors of the transgenic plants of the existing toxic protease inhibitor genes matched with constitutive promoters is still lower and generally can not reach the lethal dose of aphids.

In conclusion, the basic research of aphid resistance has problems from the current research situation at home and abroad, including: firstly, the research on resistance genes of crops to aphids is very little, and broad-spectrum monoclonal antibody genes can be used very little; secondly, since broad-spectrum lectins mostly contain sugar chains, it is difficult to express correct sugar chains by genetic engineering methods; thirdly, the existing transgenic plants with protease inhibitor genes matched with constitutive promoters generally cannot reach lethal dose, and the development of effective and pollution-free protease inhibitor genes for preventing and treating aphids has very important significance.

Disclosure of Invention

The technical problem to be solved by the invention is to overcome the defects in the prior art and provide a pinellia ternata trypsin inhibitor gene, a protein coded by the same and insect-resistant application of the gene.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows.

A gene related to plant insect resistance, the nucleotide sequence table of which is shown as SEQ ID NO: 1 is shown.

The invention also comprises a recombinant expression vector containing the gene.

The present invention also includes a nuclear genome transformant containing the above gene.

The invention also comprises an amplification primer pair of the gene.

The invention also includes the protein coded by the gene.

The invention also comprises the application of the gene in cultivating insect-resistant transgenic plants. Firstly, a peptide containing SEQ ID NO: 1, then constructing a transformant by using the obtained recombinant expression vector, then transforming a target plant by using the obtained transformant, screening a positive plant, and obtaining a homozygous transgenic plant with insect resistance compared with a normal plant by third-generation screening. The target plant is tobacco. The insect resistance mainly refers to resistance to homopteran insects.

Adopt the produced beneficial effect of above-mentioned technical scheme to lie in: the inventor proves that the gene has obvious improvement effect on the insect resistance of the plant through a large amount of scientific researches, and proves that the gene has close relation with the insect resistance of the plant. The detailed advantageous effects of the present invention are as follows.

The full-length pinellia ternata trypsin inhibitor PPTI gene sequence is obtained through a 3-terminal RACE technology and a 5-terminal DNA walking technology. The PPTI gene has the full length of 642bp, codes 214 amino acids, has the molecular weight of 23kD and the pI value of 5.13; the signal peptide consists of 19 amino acid residues at the N-terminus, has an STI (Soybean protease inhibitor) domain, and is a trypsin inhibitor. Prediction of protein transmembrane domain: the imide line and the outside line never crossed, and therefore the protein was not considered to have a transmembrane domain. Protein hydrophilicity and hydrophobicity online analysis: the main part of the peptide chain is mostly distributed in the hydrophobic region, only a small part of the peptide chain is distributed in the hydrophilic region, and the protein belongs to fat-soluble protein.

Secondly, functional verification of transforming the gene into tobacco is carried out. The insect resistance of different transgenic plants is greatly different, and the population inhibition of 10 transgenic tobaccos to myzus persicae is 7, 1, 3, 5, 9, 8, 2, 6, 4 and 10 from big to small according to results at 15 days after inoculation; the highest inhibition rates of No. 7 and No. 1 on the myzus persicae population reach 100% and 92.02% respectively, the inhibition rate of No. 3 plant is 78.85% and the inhibition rate of No. 5 plant is 58.84% respectively, and the rest transgenic plants do not express resistance, which may be caused by transgene non-expression due to transgene silencing. Particularly, the Aphis persicae of No. 7 transgenic plants die after being inoculated for 7 days, and the lethal effect is shown, which indicates that the gene separated and cloned by the inventor is a gene with good resistance to aphids.

Compared with other insect-resistant active proteins, the plant trypsin inhibitor has the following advantages: first, it is a result of the action of pure proteins, and the cloned gene is easier to construct a transformation vector, i.e., easier to apply, than the clusterin family that relies on binding to sugars; second, protease inhibitors generally have a broader spectrum of insect resistance; thirdly, insects are not easy to generate tolerance to protein inhibitors, and further research shows that the protein can be expressed at high concentration induced by mechanical injury and invasion of diseases and insects at the leaf part of the pinellia ternata.

In conclusion, the Pinellia ternata protease inhibitor (PPTI) is separated and cloned by utilizing the research advantages of the Pinellia ternata protease inhibitor, and the aphid resistance function analysis and the utilization path research are carried out; and combines with the urgency of plant aphid control, creates a new material and a new method, researches the physiological genetic process of the protease inhibitor, and has important theoretical and practical significance for agricultural production and environmental improvement.

Drawings

FIG. 1, determination of clone size of pinellia ternata cDNA library.

FIG. 2, PPTI gene cDNA 3' end amplification.

FIG. 3, first chromosome walking electropherogram: m:1Kb Plus DNA ladder 1B-4B: experimental group 5B: negative control 6B-8B: positive control.

FIG. 4, second chromosome walking electropherogram: m:1Kb Plus DNA ladder 1B-4B: experimental group 5B: negative control 6B-8B: positive control.

FIG. 5, PCR amplification of PPTI gene: from left to right are: marker DM 2000; 2-3: PPTI amplification fragment; 4: negative control water.

FIG. 6, bioinformatics analysis of eukaryotic expression products: encodes 214 amino acids, has a predicted molecular weight of 23kD and a pI value of 5.13 (FIG. 6 a); the signal peptide consists of 19 amino acid residues from the N-terminus (fig. 6b), with an STI (soybean protease inhibitor) domain (fig. 6 c); the prediction result of the protein transmembrane domain is shown in FIG. 6d, and the inside line and the outside line never cross, so that the protein is considered to have no transmembrane domain; the online analysis of protein hydrophilicity and hydrophobicity is shown in fig. 6e, the main part of the peptide chain is mostly distributed in the hydrophobic region, only a small part is distributed in the hydrophilic region, and the protein is presumed to belong to fat-soluble protein.

FIG. 7 shows that the PPTI-transgenic tobacco inoculates aphids: left is transgenic tobacco and right is control.

FIG. 8, inhibitory effect of different transgenic tobacco on aphid population density increase.

Detailed Description

The following examples illustrate the invention in detail. The raw materials and various devices used in the invention are conventional commercially available products, and can be directly obtained by market purchase. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Example 1 sequence information for protease inhibitors was looked up by sequencing of the cDNA library.

The tuber of pinellia ternata is from the center of biotechnology of economic crop institute of academy of agriculture and forestry, Hebei province. Taq DNA polymerase, reverse transcriptase (M-MLV), ligase, primer synthesis, Oligo d (T), chromosome Walking Kit (Genome Walking Kit) and the like are all produced by Takara bioengineering (Dalian) Co., Ltd., and the agarose gel DNA recovery Kit is provided by Tiangen Biochemical technology (Beijing) Co., Ltd.). The full-length cDNA library clone insert of tuber and leaf of pinellia palmata was first constructed by CTAB-Tu-Sa method and mostly has a size of 500-3000 bp (FIG. 1).

Randomly selecting 6000 clones for sequencing, sequencing by taking M13 as a sequencing primer, analyzing sequencing data, analyzing the sequence on line by blast software on an American international gene bank, carrying out homology comparison analysis on the sequence, and searching cDNA sequence information with a protease inhibitor. Gene-specific primers were designed based on the obtained information, and RT-PCR amplification was performed using dT18 as the downstream primer. The Full-length of the end of PPTI gene cDNA 'was amplified using TaKaRa 3' -Full RACE Core Set Ver.2.0 kit (FIG. 2).

TABLE 1 PPTI 3RACE and chromosome walking primers

Primer name	Sequence of	Description of the invention
			PPTIF1	5' CTGGTGTCCTGCAGTAGTAA 3'（SEQ ID NO：4）	3' RACE peripheral primer
PPTIF2	5' TCTAGCGTTTGAGTTCACCC 3'（SEQ ID NO：5）	3' RACE inner wall primer
			PPTIGSP1	5' GTTTGTGAAGGTGAAGGAAG 3'（SEQ ID NO：6）	Walking peripheral primer
PPTIGSP2	5' GAGGATGCTGCTTCGTCGTC 3'（SEQ ID NO：7）	Walking inner wall primer
			PPTI- F	5'-TCAACCATGGAGTTTATCCTG- 3'（SEQ ID NO：8）	Full length sequence
PPTI-R	5'-ATC CCT TCC TTC ACC TTC AC-3'（SEQ ID NO：9）	Full length sequence

The desired fragment was purified (following the procedure of the TIANgel MiDi purification Kit) and inserted into the pMD19-T vector, and 3 clones were randomly selected for sequencing (sequencing from the wara gene).

Example 2 extraction of genomic DNA from leaf of pinellia ternata by CTAB method.

(1) Weighing 100mg of leaves, quickly putting into liquid nitrogen, grinding into powder, transferring into a 2mL centrifugal tube, adding 1mL of preheated 65 ℃ extracting solution and 2% (V/V) beta-mercaptoethanol, and carrying out warm bath at 65 ℃ for 30min, wherein the mixture is uniformly mixed for 2-3 times.

(2) Cooling to room temperature, adding equal volume of chloroform and isoamyl alcohol (24:1), mixing, standing for 10min, and centrifuging (room temperature, 10000rpm,10 min). The extraction was repeated once.

(3) The supernatant was aspirated into a fresh 2mL centrifuge tube, and 2/3 volumes of pre-cooled isopropanol were added and mixed well, left to stand at-20 ℃ for 15min, centrifuged (room temperature, 12000rpm,10min), and the supernatant was removed.

(4) Washed twice with 1mL of 70% ethanol, slightly dried at room temperature, and the pellet was dissolved in 100. mu.LTE buffer (pH 8.0).

(5) Adding 10 μ L RNaseA, and warm bathing at 37 deg.C for 30 min.

(6) Adding equal volume of chloroform isoamyl alcohol (24:1), standing for 10min, and centrifuging (room temperature, 12000rpm,10 min). The extraction was repeated once.

(7) 1/10 volumes of 3M NaAc (pH5.2) and 2 volumes of absolute ethanol were added, left to stand at-20 ℃ for 1h, centrifuged (4 ℃,12000rpm,10min) and the supernatant discarded.

(8) Washing twice with 70% ethanol, drying, dissolving the precipitate with 100 μ L sterile water, and storing at-80 deg.C.

(9) mu.L of the suspension was subjected to 1.0% normal agarose gel electrophoresis.

Example 3 DNA cloning using known cDNA sequence design primers.

A gene specific primer PPTIGSP1 is designed according to the known sequence of the PPTI gene cDNA, and a fragment Promoter-1 is obtained by utilizing the TaKaRa genome Walker Universal Kit for amplification. The desired fragment was purified (following the procedure of the TIANgel MiDi purification Kit) and inserted into the pMD19-T vector, and 3 clones were randomly selected for sequencing (sequencing from the wara gene). A gene specific primer PPTIGSP2 is designed according to Promoter-1, and a fragment Promoter-2 is obtained by utilizing TaKaRa genome Walker Universal Kit for amplification. The desired fragment was purified (following the procedure of the TIANgel MiDi purification Kit) and inserted into the pMD19-T vector, and 3 clones were randomly selected for sequencing (sequencing from the wara gene) and the Promoter-1 is shown in FIG. 3 and the Promoter-2 is shown in FIG. 4.

Splicing a complete gene sequence according to the 3-terminal sequence and the upstream sequence of the PPTI gene, and then designing a primer to amplify the full-length PPTI gene sequence. PCR was performed using the first strand of the synthesized cDNA as a template and PPTI gene primers. The fragment of interest was purified (following the procedure of the TIANgen MiDi purification Kit) and inserted into the pMD19-T vector, and 3 clones were randomly selected for sequencing (sequencing by Shanghai bioengineering), as shown in FIG. 5. A partial cDNA sequence with protease inhibitor domain is found by analysis, such as SEQ ID NO: 2, respectively. The gene stop codon downstream 3' end non-coding region sequence is shown as SEQ ID NO: 3, respectively.

Example 4 3' RACE amplification of the terminal sequence of PPTI Gene cDNA

The Full length of the end of the PPTI gene cDNA 'is amplified by utilizing a TaKaRa 3' -Full RACE Core Set Ver.2.0 kit.

The method comprises the following steps of:

Total RNA 1μg 5.5μL

3′RACE adaptor 1μL

denaturing at 70 deg.C for 10min, cooling on ice for 3min, adding the following reagents

5 x M-MLVBuffer 2μL

dNTP(10mM each) 1μL

RNase inhibitor 0.25μL

M-MLV(RNase H^-) 0.25μL

The first strand of cDNA was synthesized by extension at 42 ℃ for 60 min.

The method comprises the following steps of:

first strand cDNA 2. mu.L, 94 ℃ for 3min

PPTIF1(10μM) 2μL 94℃ 30s

3′RACE Outer Primer 2μL 54℃ 30s

1×cDNA Dilution Buffer II 8μL 72℃ 3min

10 x Buffer 5μL 72℃ 10min

Taq enzyme 1. mu.L

H₂O to 50. mu.L.

The third step, the Inner PCR reaction system and the Inner PCR reaction conditions are as follows:

Outer PCR 1μL 94℃ 3min

PPTEF 2 (10. mu.M) 2. mu.L 94 ℃ for 30s (30 cycles)

3' RACE Inner Primer 2. mu.L 55 ℃ 30s (30 cycles)

dNTPs (2.5mM each) 4. mu.L 72 ℃ 1min (30 cycles)

10 x Buffer 5μL 72℃ 10min

Taq enzyme 1. mu.L

H₂O to 50 μ L

10 μ L of Inner PCR product was subjected to 1.0% normal agarose gel electrophoresis.

Fourthly, connecting a reaction system:

outer PCR product recovery fragment 4.5. mu.L

pMD19-T vector 0.5. mu.L

Solution I 5μL

Ligation was carried out at 16 ℃ for 12 h.

Examples 5,DraI、EcoRV、StuI、PvuII four restriction enzymes digest genomic DNA.

An enzyme digestion reaction system:

80 μ L of genomic DNA

Restriction enzyme 8. mu.L

10 x Buffer 10μL

H₂O to 100. mu.L.

Carrying out enzyme digestion at 37 ℃ for 12h, taking 5 mu L of each enzyme digestion product, carrying out 1.0% common agarose gel electrophoresis, and detecting the enzyme digestion condition.

Example 6, DNA fragment purification.

(1) Each group of enzyme-cleaved products was transferred into 1.5mL centrifuge tubes, and sterile water was added to 500. mu.L.

(2) Add equal volume of Tris saturated phenol, mix well, centrifuge (room temperature, 12000rpm,10min), absorb the upper aqueous phase into a new 1.5ml centrifuge tube.

(3) Equal volume of chloroform was added, mixed well, centrifuged (room temperature, 12000rpm,10min) and the upper aqueous phase was pipetted into a new 2ml centrifuge tube.

(4) 1/10 volumes of 3M NaAc (pH5.2) and 2 volumes of pre-cooled absolute ethanol were added, left to stand at-20 ℃ for 1h, centrifuged (4 ℃,12000rpm,10min) and the supernatant discarded.

(5) Washing twice with 70% precooled ethanol, drying, dissolving the precipitate with 20 mu L of sterile water, and taking 1 mu L for electrophoresis detection.

Example 7, 5' RACE amplified a PPTI gene fragment.

The purified genome DNA fragments are connected with joints. Connecting reaction system and connecting reaction conditions:

purified genomic DNA fragment 4. mu.L 16 ℃ 12h

GenomeWalker linker 1.9 μ L70 deg.C 5min

T4 ligase 0.5. mu.L

10 x Buffer 1.6μL。

After the reaction was completed, sterile water was added to 80. mu.L and used as a template for Primary PCR.

⑵、Primary PCR：

PCR reaction system and PCR reaction conditions:

template 2 μ L94 ℃ 5min

PPTIGSP1 (25. mu.M) 1. mu.L 94 ℃ for 25s (7 cycles)

AP1 (25. mu.M) 1. mu.L 72 ℃ for 3min (7 cycles)

10 x Buffer 5. mu.L 94 ℃ 25s (32 cycles)

dNTPs (2.5mM each) 4. mu.L 62 ℃ 3min (32 cycles)

Taq enzyme 0.5 μ L62 ℃ 7min

H₂O to 50. mu.L.

Primary PCR reaction products were diluted 20-fold and used as templates for Secondary PCR.

And thirdly, performing Secondary PCR. PCR reaction system and reaction conditions:

template 2 μ L94 ℃ 5min

PPTIGSP2 (25. mu.M) 1. mu.L 94 ℃ for 25s (5 cycles)

AP2 (25. mu.M) 1. mu.L 72 ℃ for 3min (5 cycles)

10 x Buffer 5. mu.L 94 ℃ 25s (35 cycles)

dNTPs (2.5mM each) 4. mu.L 67 ℃ 3min (35 cycles)

Taq enzyme 0.5 μ L67 ℃ for 7min

H2O to 50 μ L.

PCR reaction system and PCR reaction conditions:

template 2 μ L94 ℃ 5min

2GSP2 (25. mu.M) 1. mu.L 94 ℃ 25s (5 cycles)

AP2 (25. mu.M) 1. mu.L 72 ℃ for 3min (5 cycles)

10 x Buffer 5. mu.L 94 ℃ 25s (35 cycles)

dNTPs (2.5mM each) 4. mu.L 57 ℃ 3min (35 cycles)

Taq enzyme 0.5 μ L57 deg.C for 7min

H2O to 50 μ L.

10. mu.L of the Secondary PCR product was subjected to 1.0% common agarose gel electrophoresis.

Connecting a reaction system:

recovery fragment of Secondary PCR product 4.5. mu.L

pMD19-T vector 0.5. mu.L

Solution I 5μL

Ligation was carried out at 16 ℃ for 12 h.

Example 8,PPTICloning the full length of gene and analyzing the bioinformatics.

According toPPTISplicing the 3-terminal sequence and the upstream sequence of the gene into a complete gene sequence, and then designing primers to amplify the full-lengthPPTIA gene sequence. Using the first strand of the synthesized cDNA as a template andPPTIthe gene primers were used for PCR. The fragment of interest was purified (following the procedure of the TIANgen MiDi purification Kit) and inserted into the pMD19-T vector, and 3 clones were randomly selected for sequencing (sequencing by Shanghai bioengineering).

PCR reaction system and reaction conditions:

first strand cDNA 1. mu.L, 94 ℃ for 5min

PPTEF 1 (25. mu.M) 1. mu.L 94 ℃ for 30s (35 cycles)

PPTIR1 (25. mu.M) 1. mu.L 54 ℃ for 30s (35 cycles)

10 x Buffer 2.5 μ L72 ℃ for 1min (35 cycles)

dNTPs(2.5mM each) 2μL 72℃ 10min

Taq enzyme 0.5. mu.L

H₂O to 25. mu.L.

10 μ of the LPCR product was subjected to 1.0% normal agarose gel electrophoresis.

Connecting a reaction system:

PPTIgene recovery fragment 4.5. mu.L

pMD19-T vector 0.5. mu.L

Solution I 5μL

Ligation was carried out at 16 ℃ for 12 h.

Clone sequence analysis shows that the PPTI gene has a full length of 642bp (SEQ ID NO: 1), codes 214 amino acids (see figure 6a), and has a predicted molecular weight of 23kD and a pI value of 5.13; the signal peptide consists of 19 amino acid residues at the N-terminus (fig. 6b), has an STI (soybean protease inhibitor) domain (fig. 6c), and is a trypsin inhibitor. The predicted results of the protein transmembrane domain are shown in FIG. 6 d: the imide line and the outside line never crossed, and therefore the protein was not considered to have a transmembrane domain. The protein hydrophilicity and hydrophobicity online analysis is shown in fig. 6 e: the major part of the peptide chain is mostly distributed in the hydrophobic region, and only a small part is distributed in the hydrophilic region, and the protein is presumed to belong to fat-soluble protein.

Example 10, gene fragment transformation of E.coli DH 5. alpha. and positive clone detection-colony PCR.

Coli DH 5. alpha. was transformed as follows.

(1) 1 competent cell (100. mu.L) was removed from the freezer at-80 ℃ and thawed on ice.

(2) Add 10. mu.L of ligation product to the freshly thawed competent cells, gently mix, ice-wash for 30 min.

(3) Heat shock at 42 ℃ for 30s and immediately put on ice for 2 min.

(4) 500. mu.L of LB liquid medium was added thereto, and the mixture was cultured at 37 ℃ and 200rpm for 1 hour.

(5) Centrifuging at 4000rpm at room temperature for 2min, removing part of supernatant, and mixing the rest bacteria liquid.

(6) The bacterial liquid is coated on LB + Amp solid culture medium by a coating rod, and is inverted at 37 ℃ for overnight culture.

And (3) selecting partial white single colonies on a solid culture medium cultured overnight, respectively putting the partial white single colonies into a small Ep tube added with 10 mu L of ultrapure water, performing vortex oscillation until the colonies are dissolved in water, taking the colonies as a PCR template, performing amplification under the same amplification condition as the previous step, and performing electrophoresis detection.

Example 11 verification of the function of the PPTI gene in tobacco.

Constructing a plant expression vector pCAMBIA1301-PPTI of a target gene, transforming tobacco by a leaf disc method, wherein different strains of tobacco transformed with the PPTI gene show inhibition capability on aphids, the aphids on the transgenic tobacco are gradually reduced along with the increase of days, and the number of the aphids is almost zero on the 15 th day. The aphid inhibition rate is calculated, and the average inhibition rate of the tobacco which is inoculated with the PI gene at the day 15 to aphid is 83.4%. Meanwhile, different plants with the same gene have certain differences in aphid resistance, which may be caused by different PPTI expression levels in different transformed plants, and the relationship between the PPTI protein expression level of transgenic tobacco and aphid resistance level needs to be further researched (FIG. 7). The research preliminarily determines that the PPTI gene has good resistance to aphids, is an aphid-resistant protease inhibitor gene obtained from pinellia palmata for the first time, and provides a basis for further utilizing the gene to carry out insect-resistant research and identification. The procedure of the test was as follows.

Cloning and sequencing are utilized by using a conventional plant binary expression vector, preferably a plant binary expression vector pBI121 (a commonly used expression vector in plant transgenosis, purchased from the researchers of Zhao, the institute of crop, Chinese academy of agricultural sciences in the present invention) and a strain EHA105PPTIGene sequence, which is digested by Xba I and Sma IPPTIThe gene is subcloned to the corresponding site of pBI121 to construct 35S:PPTI+GUSthe plant expression vector pBI121-PPTI with the structure of NOS is transformed into agrobacterium strain EHA 105. The method of Wangchun et al adopts leaf disk method to transform tobacco to obtain kanamycin-resistant product (kanamycine)nptII) marked transformed regenerated plants (Wangguan et al, 2002).

The plasmid pBI121-PPTI was double digested by Xba I and Sma I by 1% agarose electrophoresis, resulting in two fragments, indicatingPPTIThe genes were inserted in pBI121 in the correct reading frame. The kanamycin resistance is obtained by transforming tobacco by a conventional leaf disc methodnptII) a marked transgenic tobacco plant.

PCR detection of transgenic plant A, cutting young leaf of transgenic plant and non-transgenic plant, extracting genome DNA by CTAB method, drying at room temperature, suspending with sterile double distilled water, and storing at-20 deg.C. Adjusting the amount of the extracted DNA template to 50 ng/muL, taking 1 muL as the template to perform PCR amplification, and performing PCR amplification at 94 ℃ for 3 min; 30S at 94 ℃, 30S at 57 ℃, 1min at 72 ℃ and 35 cycles; 10min at 72 ℃. PCR products were run in 1% agarose for electrophoresis and observation. The result shows that a transgenic plant with PPTI gene integrated into the genome of the tobacco plant is obtained.

The semi-quantitative RT-PCR detection of the B transgenic plant takes the young leaf of the tobacco as a test material, extracts total RNA from the positive plant detected by the PCR according to the instruction of a Trizol RNA extraction kit of Promega company, performs semi-quantitative RT-PCR, and verifies whether the exogenous PPTI gene is expressed on the RNA transcription level. The results of randomly selecting 10 transgenic single plants for detection show that PPTI genes are expressed on the level of mRNA, but the expression levels of different transgenic plants in vivo are different.

C, aphid resistance identification of transgenic plants, namely, the Myzus persicae (Myzus persicae) is collected from a naturally occurring population on tobacco in a greenhouse of a plant protection institute of academy of agriculture and forestry, Hebei, and after the Myzus persicae is fed in the greenhouse for a stable period of time, healthy, active and consistent wingless adult aphids in physiological states are selected for testing. Respectively inoculating indoor raised green peach aphids to middle-layer leaves of transgenic tobacco plants and non-transgenic tobacco plants of 810 leaf ages, randomly selecting 10 transgenic plant lines, 3 tobacco seedlings of each plant line, inoculating 20 wingless adult green peach aphids to each plant line, raising the plants under the same condition (23-25 ℃), and surveying and recording the number of the green peach aphids on each treated tobacco seedling every other day until 15 days. According to the method of Yuanzheng and the like, the population inhibition rate of the transgenic tobacco to the aphids is used as an index (Yuanzheng and the like, 2001), so as to evaluate the virulence effect of each transgenic tobacco to the aphids: population inhibition (%) = (number of control living aphids-number of living aphids in treatment area)/number of control living aphids × 100.

The identification result shows that the insect resistance of different transgenic plants is greatly different, and the population inhibition of 10 transgenic tobaccos to myzus persicae is 7, 1, 3, 5, 9, 8, 2, 6, 4 and 10 from big to small from the result of 15 days after inoculation (figure 8); the highest inhibition rates of No. 7 and No. 1 on the myzus persicae population reach 100% and 92.02% respectively, the inhibition rate of No. 3 plant is 78.85% and the inhibition rate of No. 5 plant is 58.84% respectively, and the rest transgenic plants do not express resistance, which may be caused by transgene non-expression due to transgene silencing. Particularly, the Aphis persicae of No. 7 transgenic plants die after being inoculated for 7 days, and the lethal effect is shown, which indicates that the gene separated and cloned by the inventor is a gene with good resistance to aphids.

The description of the embodiments is set forth only as a practical technical solution of the present invention, and is not intended to be a single limitation on the technical solution itself.

Sequence listing

<110> academy of agriculture, forestry, and science of Hebei province

<120> a gene related to plant insect resistance, protein coded by the same and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 642

<212> DNA

<213> tobacco (nicotiana tabacum)

<400> 1

atggagttta tcctgctcct tgtgtcttcc ctcctcctca ccgcccgagc cgccgccgcc 60

gcctccaatc ccatcctcga caacgacggc aacgagctcc gacgtggcca actctactat 120

gcgatgtccg tgaagaggcc cggtggcggc ctgacgctgg cgccccccgc caacgcggcg 180

cggtgccctc tcaacgtggc ccaggcgccc ttcaacgact attccggccg cccgctggcc 240

ttcttcccgg agaacgccga cgacgacacc gtgcgagagg gaagtacact aaacatcatg 300

ttcccggagc cgacggagtg cgcccagtcc accgtgtgga ctctcgacag ggagaccggc 360

ctcgtgacca ccggcggaac cgcgtcgtcg gcggtcggcc cctactacag ccggttcgcc 420

atacgcaagg ccgaggatgc tgcttcgtcg tcccagcgcg atcgctacca gatccaggtt 480

tgcccctgca gctccggcgt gcggcggcct tcctgcagga tgggctgtct cggcagtctg 540

ggtttgagcg agggagagga gaacgtcatg ctcaacatca acaacgagcg ccctcacacc 600

gtcatgtttg tggaggtgaa ggaagggatc gctgccagca ta 642

<210> 2

<211> 560

<212> DNA

<213> tobacco (nicotiana tabacum)

<400> 2

tgcagctggc cattacggcc ggggccgacg acgacaccgt gcgagaggga agtacactaa 60

acatcatgtt cccggagccg acggagtgcg cccagtccac cgtgtggact ctcgacaggg 120

agaccggcct cgtgaccacc ggcggaaccg cgtcgtcggc ggtcggcccc tactacagcc 180

ggttcgccat acgcaaggcc gaggatgctg cttcgtcgtc ccagcgcgat cgctaccaga 240

tccaggtttg cccctgcagc tccggcgtgc ggcggccttc ctgcaggatg ggctgtctcg 300

gcagtctggg tttgagcgag ggagaggaga acgtcatgct caacatcaac aacgagcgcc 360

ctcacaccgt catgtttgtg aaggtgaagg aagggatcgc tgccagcata tagaggagcc 420

gttgatcgat cggccagtac ttgctagtcc catgttagta ctacgtacgt actttgtatc 480

gtccaccaaa taagctaggg ttcctataat agggaacgat cgagctgcca tggacagctc 540

ctctagcgtt tgagttcacc 560

<210> 3

<211> 270

<212> DNA

<213> tobacco (nicotiana tabacum)

<400> 3

tagaggagcc gttgatcgat cggccagtac ttgctagtcc catgttagta ctacgtacgt 60

actttgtatc gtccaccaaa taagctaggg ttcctataat agggaacgat cgagctgcca 120

tggacagctc ctctagcgtt tgagttcacc cagctggtgt cctgcagtag taactacagg 180

acatggtgtg ctgtgtagta gttaagcttg tcttctactt aagtataata agtggcgacg 240

tgcatggttc tctcgcaaaa aaaaaaaaaa 270

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ctggtgtcct gcagtagtaa 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

tctagcgttt gagttcaccc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

gtttgtgaag gtgaaggaag 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

gaggatgctg cttcgtcgtc 20

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

tcaaccatgg agtttatcct g 21

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

atcccttcct tcaccttcac 20

Claims (8)

1. A palmate pinellia tuber trypsin inhibitor gene is characterized in that: the nucleotide sequence table is shown as SEQ ID NO: 1 is shown.

2. A recombinant expression vector comprising the gene of claim 1.

3. A nuclear transformant containing the gene according to claim 1.

4. A primer set for amplifying the gene of claim 1.

5. The protein encoded by the gene of claim 1.

6. Use of the gene of claim 1 for breeding a transgenic plant resistant to insects, said insects being against myzus persicae.

7. Use according to claim 6, characterized in that: firstly, a peptide containing SEQ ID NO: 1, then constructing a transformant by using the obtained recombinant expression vector, then transforming a target plant by using the obtained transformant, screening a positive plant, and obtaining a homozygous transgenic plant with insect resistance compared with a normal plant by third-generation screening.

8. Use according to claim 6 or 7, characterized in that: the target plant is tobacco.

Images