CN108504692A - A kind of construction method of gene knockout Chinese hamster ovary celI strain and its application in therapeutic recombinant proteins expression - Google Patents
A kind of construction method of gene knockout Chinese hamster ovary celI strain and its application in therapeutic recombinant proteins expression Download PDFInfo
- Publication number
- CN108504692A CN108504692A CN201810250082.3A CN201810250082A CN108504692A CN 108504692 A CN108504692 A CN 108504692A CN 201810250082 A CN201810250082 A CN 201810250082A CN 108504692 A CN108504692 A CN 108504692A
- Authority
- CN
- China
- Prior art keywords
- cyld
- cell
- chinese hamster
- hamster ovary
- ovary celi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Application the invention discloses a kind of construction method of gene knockout Chinese hamster ovary celI strain and its in therapeutic recombinant proteins expression.CYLD knocks out the construction method of Chinese hamster ovary celI strain, specially：It is screened after knockout carrier is imported into Chinese hamster ovary celI, obtains the cell strain by the plasmid-mediated CYLD expression deletions of the knockout.Knock out cell nucleotide sequence SEQ ID NO:1 could alternatively be SEQ ID NO:2、NO:3、NO:4、NO:5 or NO:6；The cell being transfected can be CHO K1 cells or stablize the Chinese hamster ovary celI of certain antibody of expression.The present invention has important application value to the expression yield for improving therapeutic recombinant proteins.
Description
Technical field
The invention mainly relates to a kind of structure of CHO engineered cells strain and its during therapeutic recombinant proteins are expressed
Using.
Background technology
In recent years, prevention of the therapeutic antibodies in diseases such as clinical malignant tumour, autoimmunity disease and rapid infectious diseases
On achieve notable curative effect.The overall development of antibody industry is also promoted simultaneously, the global antibody industry gross output value rises year by year,
Nearly 70,000,000,000 dollars of monoclonal antibody global marketing volume in 2016 according to statistics, and increased with 10% or so speed.And China is anti-
Body industry still based on imitated, lacks effectively innovation on antibody species at present.Meanwhile overall throughput wretched insufficiency, document report
Road China antibody industry average product is in 1g/L or so, the substantially less than level of external 4g/L.Therefore, antibody production is effectively improved
Amount becomes the task of top priority.
Chinese hamster ovary (CHO) cell is the most common host cell of antibody industry.Chinese hamster ovary celI has good plastic
Property and growth characteristics, can carry out high density suspension culture in the culture medium of serum-free.However as the increasing of reactor volume
Greatly, long-time high-density growth and the ability of continuous production antibody is kept to become the key factor for further increasing antibody production.
Can be mediated when Metabolic stress, nutrition limitation and shear pressure Chinese hamster ovary celI occur apoptosis, therefore control apoptosis at
To effectively improve a kind of method of yield.Main method has：1, optimization culture process and medium optimization；2, Chinese hamster ovary celI engineering,
It is overexpressed anti-apoptotic genes expression or inhibits to promote apoptogene to realize that CHO apoptosis controls.Individually change anti-apoptotic or promotees apoptosis base
Cause still has drawback, such as the Chinese hamster ovary celI speed of growth slows down, and cell strain screening process is obstructed；Cell mitogenic during production is anti-
Division slows down, and is unable to reach desired cell density.Therefore, screening multi-functional gene and building corresponding cell strain becomes newly
Desirable route.
Tumor suppressor CYLD (Cylindromatosis, scarf neoplastic syndrome albumen) is a kind of deubiquitinating enzymes.
Missing or mutation occur in kinds of tumors, such as cylindroma, T cell leukaemia, colon cancer, liver cancer and lung cancer cancer,
Show that the occurrence and development of the exception and tumour of CYLD are closely related.Meanwhile CYLD or a kind of important immunomodulatory gene, extensively
General participation innate immune response and inflammatory reaction process.Mechanism Study show CYLD mainly by negative regulation NF- κ B, JNK,
The signal paths such as Wnt function.In addition, CYLD can also adjust cell Proliferation with cytoskeletal protein interaction.Suppression
CYLD processed can promote cell Proliferation, inhibit Apoptosis, and influence many A signal pathways extensively to regulate and control different physiological roles.
Therefore, CYLD becomes a kind of multi-functional gene.
In recent years, the development of gene editing technology is swift and violent, and CRISPR-Cas9 nucleic acid enzyme systems have more efficiently, quickly
Technical characterstic has been widely used in the genome editor of eukaryocyte.The technology is guided using the guide RNA of specificity
Cas9 nucleases are cut in specific position, DNA double chain fracture (DSB) are formed, followed by non-homologous end joining
(NHEJ) or with source orientation reparation (HDR) repair mode to target genetic region into edlin.
Invention content
The purpose of the present invention is to provide a kind of construction method of gene knockout Chinese hamster ovary celI strain and its in therapeutic recombination egg
Application during white expression, the method for improving therapeutic recombinant proteins yield.
On the one hand, the present invention provides a kind of construction method of gene knockout Chinese hamster ovary celI strain, specific methods：
It is required according to CRISPR-Cas9 technologies and sequence homology compares analysis, screened and design selectively targeted CYLD
The sgRNA sequences of exon：5’-GCTGTACGGACGGAACTTTC-3’.Carrier of the structure with this sequence, imported into CHO
It is screened after cell, obtains the cell strain by the plasmid-mediated CYLD expression deletions of the knockout.
Wherein, cell nucleotide sequence SEQ ID NO are knocked out:1 could alternatively be SEQ ID NO:2、NO:3、NO:4、
NO:5 or NO:6；The cell being transfected can be CHO-K1 cells or stablize the Chinese hamster ovary celI of certain antibody of expression.
On the other hand, the present invention improves the gene knockout Chinese hamster ovary celI strain of method structure as described above in therapeutic recombination
Application in protein expression；The yield of corresponding recombinant protein can be improved after transient transfection encoding plasmids in the platform cell.
Wherein, the encoding plasmids being transfected can be the plasmid etc. of expression anti-Rituximab antibodies.
In addition, the application the present invention provides CYLD genes in engineering cell strain, is stablizing express therapeutic antibody
Inhibit CYLD that can obtain high yielding cell sarain in cell, can be used for the industrial production of corresponding antibodies.
Wherein, the cell strain for stablizing express therapeutic drug can be CHO-IgG cell strains, the cell strain stable integration
Nucleotide sequence SEQ ID NO:7 and NO:The heavy and light chain-ordering of anti-EGFR humanized antibodies shown in 8.
The present invention has important application value to the expression yield for improving therapeutic antibodies.
Description of the drawings
Fig. 1 is target locations of 4 kinds of sgRNA in the exon of CYLD.
Fig. 2 is that 4 kinds of sgRNA expression plasmids transfect CYLD expressions after CHO-K1 cells.
Fig. 3 is that mispairing enzyme T7E1 detects cutting efficiency result.
Fig. 4 is to knock out cellular identification situation.
Fig. 5 is to knock out cell proliferative conditions.
Fig. 6 is that cell viability level detects after transiently transfecting antibody plasmids.
Fig. 7 is the volume analysis transiently transfected after anti-Rituximab antibodies.
Fig. 8 is the appraisal of CHO-IgG-sgRNA3 cell strains.
Fig. 9 is to inhibit number of viable cells of the CHO-IgG cells in incubation after CYLD.
Figure 10 is the antibody production detection that CHO-IgG cells are expressed after inhibiting CYLD.
Specific implementation mode
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment side in following embodiments
Method is standard biochemical methods unless otherwise specified.Test material as used in the following examples is normal unless otherwise specified
Advise biochemical reagents shop purchase gained.Quantitative experiment in following embodiment is respectively provided with three repeated experiments, and results are averaged.
PSpCas9 (BB) -2A-Puro carriers are purchased from addgene (catalog number (Cat.No.)s：PX459).CHO-K1 cells：ATCC(CCL-
61).CD-CHO medium：Gibco (catalog number (Cat.No.)s：10743-029).OptiMEM I Medium:Gibco (catalog number (Cat.No.)s：
31985-070).Liposome (Fugene HD)：Promega companies (catalog number (Cat.No.)：E2311).Puromycin：Gene
Operation companies (catalog number (Cat.No.)：ISY1130-0025MG).Cetuximab：Merck companies (import drugs card number：
S20050095, product batches number：7667201).PcDNA-3.3 carriers：Invitrogen companies (catalog number (Cat.No.)：K8300-01).
POptiVEC carriers：Invitrogen companies (catalog number (Cat.No.)：12744-017).
The preparation of embodiment 1, CHO-K1-sgRNA3 cells
One, sgRNA is designed
In Chinese hamster ovary celI the open reading frame of CYLD genes include 16 exons, according to CRISPR-Cas9 technologies require and
Sequence homology compares analysis, screens and devise 4 kinds of sgRNA (sgRNA1-4), and sgRNA1 and sgRNA4 target outer aobvious simultaneously
Son 1, sgRNA2 and sgRNA3 targets exon 6 and 7 respectively.The target sequence of four kinds of sgRNA is as shown in table 1 below, outside CYLD
Position on aobvious son is as shown in result figure 1.
14 kinds of sgRNA target sequences of table
| Title | Sequence (5 ' -3 ') |
| sgRNA1 | CCAGGAGTTGTACGCTTCAG |
| sgRNA2 | TATGGGGTTATCCGTTGGAT |
| sgRNA3 | GCTGTACGGACGGAACTTTC |
| sgRNA4 | CCTCTGAAGCGTACAACTCC |
Two, construction of recombinant plasmid
DNA sequence dna and its complementary pairing sequence in table 1, DNA sequences are further respectively synthesized according to the requirement of expression vector
Row are shown in Table 2.The double chain DNA molecule that both ends all have cohesive end is formed after annealing, and carrier is connected to after BbsI digestions
On pSpCas9 (BB) -2A-Puro, 4 kinds of recombinant plasmids (pSpCas9 (BB) -2A-Puro-sgRNA1, pSpCas9 (BB)-is obtained
2A-Puro-sgRNA2, pSpCas9 (BB) -2A-Puro-sgRNA3 and pSpCas9 (BB) -2A-Puro-sgRNA4).
Insert Fragment sequence in 24 kinds of recombinant plasmids of table
Three, cell transfecting and inhibition are screened
By in above-mentioned 4 kinds of Transfected Recombinant Plasmids to CHO-K1 cells, transfection method can be：
1, preceding 1 day kind plate, paving about 1 × 10 are transfected6In a/hole CHO-K1 cells (vigor is more than 95%) to 6 orifice plates, 37
DEG C, 5%CO2It is incubated overnight in incubator.
2, respective transfection is carried out after 24 hours, dilutes above-mentioned 4 kinds of recombinant plasmids respectively with opti-MEM I Medium, obtains
To total volume be 150 microlitres, final concentration of 0.02 microgram/microlitre plasmid solution.Add 10 microlitres of Fugene HD transfection examinations
Agent is gently incubated at room temperature 5 minutes after mixing.The mixed liquor of plasmid and transfection reagent is finally added dropwise to the CHO- in 6 orifice plates
In K1 cells, continue culture 24 hours.
3, it after cultivating, discards culture medium and washs cell 3 times with PBS buffer solution, cracked with RIPA after pancreatin digestion
Liquid carries out protein extraction, the rear expression for carrying out immunoblot experiment detection CYLD and internal reference Protein G APDH.As a result see Fig. 2.
Obvious CYLD suppressions are shown after result it can be seen from the figure that pSpCas9 (BB) -2A-Puro-sgRNA3 plasmid transfections
Effect processed.Further, puromycin is added in the cell after pSpCas9 (BB) -2A-Puro-sgRNA3 transfections to be screened,
PCR amplification includes the CYLD genome sequences of the targeting regions sgRNA3 after extraction cellular genome after 1 week.PCR amplification primer is
F：GTTAGTCAGTCCCTGTTCGTTGG；
R：CCTCCATCTGCCAAGCTGACTGC.
Mispairing enzyme T7E1 detection cutting efficiencies are utilized after obtaining PCR product.As a result see Fig. 3.By result figure it can be seen that
Target area can be cut into 2 small fragments by sgRNA3 after importing, size is consistent with expection.
Four, cell strain screening and identification
On the basis of screening early period, further screens pSpCas9 (BB) -2A-Puro-sgRNA3 and stablize expression cell
Strain is finally obtained 4 kinds of stable cell lines after 3 wheel pressurization screenings and limiting dilution assay screening.Final knockout effect
See Fig. 4, it can be seen that CYLD is not expressed in 4 kinds of cell strains.Corresponding sequence in the 7th exons of CYLD is found by comparison after sequencing
Row are edited as the sequence in sequence 2,3,4,5 and 6.Missing or the increase of base has occurred.
Five, cell activity identification and antibody expression
It obtains after knocking out cell, carries out cell proliferation rate and viability examination.Inoculation 1 × 105A/hole control cell is struck
Except cell is continuously cultivated in 6 orifice plates, the 1st day, the 3rd day and the 5th day after inoculation is examined using cell counter respectively
Cell number is surveyed, obtains result figure 5, it can be seen that the growth rate for knocking out cell is obviously accelerated；Cell is knocked out to antibody for detection
The influence of expression, we have transiently transfected anti-Rituximab antibodies plasmid, and (its heavy and light chain-ordering is shown in sequence 9 and sequence in sequence table
10) it is verified.Substantial method steps are：Inoculating cell transfects the antibody matter that total amount is 2 micrograms in 6 orifice plates, after 24 hours
Grain.The cells and supernatant of the 1st day, the 3rd day and the 5th day collection transfection anti-Rituximab antibodies plasmid after transfection respectively, and
It collects cell within 3rd day and carries out MTT detections, obtain result figure 6 and Fig. 7, it as can be seen from the results can be apparent after knockout CYLD
Enhance the expression quantity of cell viability and anti-Rituximab antibodies, average product increases about 1 times.
The preparation of embodiment 2, CHO-IgG-sgRNA3 cells
After inhibition CYLD being verified using a kind of CHO-K1 suspension cells of the stable anti-EGFR humanized antibodies L4H3 of expression
Influence to antibody expression.This stable cell construction process for expressing anti-EGFR humanized antibodies is as follows：
1, double chain DNA molecule shown in the sequence of sequence table 7 is recombinated to the HindIII of pcDNA-3.3 carriers and NotI
Between restriction enzyme site, recombinant plasmid pcDNA3.3-L4 is obtained.
2, by HindIII the and NotI restriction enzyme sites of 8 recombinant clone of the complete sequence of sequence table to pOptiVEC carriers it
Between, obtain recombinant plasmid pOptiVEC-H3.
3, recombinant plasmid pcDNA3.3-L4 and recombinant plasmid pOptiVEC-H3 cotransfections are entered in CHO-K1 cells, is screened
The recombinant cell stablized and express the antibody heavy and light chain is obtained, and is tamed into suspended culture cell, it is thin to be named as CHO-IgG
Born of the same parents.
On this basis, further transfection sgRNA3 plasmids, progress puromycin screening and limiting dilution assay sort, most
One plant of CYLD is obtained eventually and strikes low cell strain, is named as CHO-IgG-sgRNA3 cells, and CYLD expression testing results are shown in
Fig. 8.And it carries out batch cultivation and detects the antibody level in supernatant.Batch cultivation condition is：Inoculation 1 × 106A/mL CHO-
IgG or CHO-IgG-sgRNA3 cells are settled to 30ml in 125ml shaking flasks, with CD-CHO culture mediums.It is placed in 37 DEG C, 8%CO2
Incubator in carry out 125rpm rotating and culturing.And respectively on day 1,3,6,9,12 and 15 days collect part supernatant it is thin
Born of the same parents carry out viable count using ELISA method and antibody concentration detect.Finally obtain result figure 9 and Figure 10, it can be seen that suppression
The number of viable cells and antibody production in batch cultivation can be obviously increased after CYLD processed, it is anti-striking low cell strain moderate resistance EGFR
Body output increased about 50%.
Sequence table
<110>University of Anhui
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 166
<212> DNA
<213> Cricetusgriseus
<400> 1
gaagatgaat gtgcaggctg tacggacgga actttcaggg gcactcgcta cttcacctgc 60
gccctgaaga aggcgctgtt cgtaaaactg aagagctgca gacccgactc taggtttgcg 120
tccttgcagc ctgtttctaa tcagattgaa aggtgtaatt ctttag 166
<210> 2
<211> 363
<212> DNA
<213>Artificial sequence ()
<400> 2
gaagatgaat gtgcaggctg tacggacgga actacggtaa actgcccact tggcagtaca 60
tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta aatggcccgc 120
ctggcattgt gcccagtaca tgaccttatg ggactttcct acttggcagt acatctacgt 180
attagtcatc gctattacca tggtcgaggt gagccccacg ttctgcttca ttcaggggca 240
ctcgctactt cacctgcgcc ctgaagaagg cgctgttcgt aaaactgaag agctgcagac 300
ccgactctag gtttgcgtcc ttgcagcctg tttctaatca gattgaaagg tgtaattctt 360
tag 363
<210> 3
<211> 168
<212> DNA
<213>Artificial sequence ()
<400> 3
gaagatgaat gtgcaggctg tacggacgga actttttcag gggcactcgc tacttcacct 60
gcgccctgaa gaaggcgctg ttcgtaaaac tgaagagctg cagacccgac tctaggtttg 120
cgtccttgca gcctgtttct aatcagattg aaaggtgtaa ttctttag 168
<210> 4
<211> 150
<212> DNA
<213>Artificial sequence ()
<400> 4
gaagatgaat gtgcaggctg tacggcactc gctacttcac ctgcgccctg aagaaggcgc 60
tgttcgtaaa actgaagagc tgcagacccg actctaggtt tgcgtccttg cagcctgttt 120
ctaatcagat tgaaaggtgt aattctttag 150
<210> 5
<211> 165
<212> DNA
<213>Artificial sequence ()
<400> 5
gaagatgaat gtgcaggctg tacggacgga acttcagggg cactcgctac ttcacctgcg 60
ccctgaagaa ggcgctgttc gtaaaactga agagctgcag acccgactct aggtttgcgt 120
ccttgcagcc tgtttctaat cagattgaaa ggtgtaattc tttag 165
<210> 6
<211> 164
<212> DNA
<213>Artificial sequence ()
<400> 6
gaagatgaat gtgcaggctg tacggacgga attcaggggc actcgctact tcacctgcgc 60
cctgaagaag gcgctgttcg taaaactgaa gagctgcaga cccgactcta ggtttgcgtc 120
cttgcagcct gtttctaatc agattgaaag gtgtaattct ttag 164
<210> 7
<211> 1356
<212> DNA
<213>Artificial sequence ()
<400> 7
caggtacaac tacagcagcc tggggctgag ctggtgaagc ctggggcctc agtgaagatg 60
tcctgcaagg cttctggcta cacatttacc agttacaata tgcactgggt aaagcagaca 120
cctggtcggg gcctggaatg gattggagct atttatccag gaaatggtga tacttcctac 180
aatcagaagt tcaagggcaa ggccacactg actgcagaca aatcctccag cacagcctac 240
atgcagctca gcagcctgac atctgaagac tctgcggtct attactgtgc aagatcgact 300
tactacggcg gtgactggta cttcaatgtc tggggcgcag ggaccacggt caccgtctct 360
gcagctagca ccaagggccc atcggtcttc cccctggcac cctcctccaa gagcacctct 420
gggggcacag cggccctggg ctgcctggtc aaggactact tccccgaacc ggtgacggtg 480
tcgtggaact caggcgccct gaccagcggc gtgcacacct tcccggctgt cctacagtcc 540
tcaggactct actccctcag cagcgtggtg accgtgccct ccagcagctt gggcacccag 600
acctacatct gcaacgtgaa tcacaagccc agcaacacca aggtggacaa gaaagttgag 660
cccaaatctt gtgacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 720
ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 780
cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 840
tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga agagcagtac 900
aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 960
aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 1020
tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggat 1080
gagctgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 1140
atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 1200
gtgctggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg 1260
tggcagcagg ggaacgtctt ctcatgctcc gtgatgcatg aggctctgca caaccactac 1320
acgcagaaga gcctctccct gtctcccggt aaatga 1356
<210> 8
<211> 639
<212> DNA
<213>Artificial sequence ()
<400> 8
caaattgttc tctcccagtc tccagcaatc ctgtctgcat ctccagggga gaaggtcaca 60
atgacttgca gggccagctc aagtgtaagt tacatccact ggttccagca gaagccagga 120
tcctccccca aaccctggat ttatgccaca tccaacctgg cttctggagt ccctgttcgc 180
ttcagtggca gtgggtctgg gacctcttac tctctcacaa tcagtagagt ggaggctgaa 240
gatgctgcca cttattactg ccagcagtgg actagtaacc cacccacgtt cggtggtggg 300
accaagctgg agatcaaacg aactgtggct gcaccatctg tcttcatctt cccgccatct 360
gatgagcagt tgaaatctgg aactgcctct gttgtgtgcc tgctgaataa cttctatccc 420
agagaggcca aagtacagtg gaaggtggat aacgccctcc aatcgggtaa ctcccaggag 480
agtgtcacag agcaggacag caaggacagc acctacagcc tcagcagcac cctgacgctg 540
agcaaagcag actacgagaa acacaaagtc tacgcctgcg aagtcaccca tcagggcctg 600
agctcgcccg tcacaaagag cttcaacagg ggagagtgt 639
<210> 9
<211> 1353
<212> DNA
<213>Artificial sequence ()
<400> 9
caggtgaagc tgctggagca gtctggggct gaagtgaaga agcctggggc ctcagtgaag 60
gtttcctgca aggcatctgg attcagcctg actaactacg gcgtccactg ggtgcgacag 120
gcccctggac aaagacttga gtggatggga gtgatctgga gtggtggtaa cactgactac 180
aacaccccct tcactagcag agtcaccatc accagggaca cgtccgctac tacagcctac 240
atgggcctgt ctagcctgag acccgaggac acggccgtat attactgtgc gagagccctg 300
acttattacg actacgagtt cgcctactgg ggccagggaa ccctggtcac cgtctcctca 360
gctagcacca agggcccatc ggtcttcccc ctggcaccct cctccaagag cacctctggg 420
ggcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg 480
tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct acagtcctca 540
ggactctact ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacccagacc 600
tacatctgca acgtgaatca caagcccagc aacaccaagg tggacaagaa agttgagccc 660
aaatcttgtg acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga 720
ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc ccggacccct 780
gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc ctgaggtcaa gttcaactgg 840
tacgtggacg gcgtggaggt gcataatgcc aagacaaagc cgcgggagga gcagtacaac 900
agcacgtacc gtgtggtcag cgtcctcacc gtcctgcacc aggactggct gaatggcaag 960
gagtacaagt gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa aaccatctcc 1020
aaagccaaag ggcagccccg agaaccacag gtgtacaccc tgcctccatc tcgggatgag 1080
ctgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctatcc cagcgacatc 1140
gccgtggagt gggagagcaa tgggcagccg gagaacaact acaagaccac gcctcccgtg 1200
ctggactccg acggctcctt cttcctctat agcaagctca ccgtggacaa gagcaggtgg 1260
cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacacg 1320
cagaagagcc tctccctgtc tccgggtaaa tga 1353
<210> 10
<211> 645
<212> DNA
<213>Artificial sequence ()
<400> 10
gaactcgtca tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcaac 60
attgcctgcc gggcaagtca gagcattggc actaacatcc actggtatca gcagaaacca 120
gggaaagccc ctagactcct gatcaaatat gcctccgaaa gcatcagtgg ggtcccatca 180
agattcagcg gcagtggatc tggcacagat ttcactctca ccatcagcag cctgcagcct 240
gaagattttg caatctatta ctgtcagcaa aataacaatt ggcctactac gttcggcgga 300
gggaccaagg tggaaatcaa acgaactgtg gcggcgccat ctgtcttcat cttcccgcca 360
tctgatgagc agttgaaatc tggtaccgct agcgttgtgt gcctgctgaa taacttctat 420
cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg taactcccag 480
gagagtgtca cagagcagga cagcaaggac agcacctaca gcctcagcag caccctgacg 540
ctgagcaaag cagactacga gaaacacaaa gtctacgcct gcgaagtcac ccatcagggc 600
ctgagctcgc ccgtcacaaa gagcttcaac aggggagagt gttag 645
Claims (8)
1. a kind of method knocking out CYLD genes in Chinese hamster ovary celI, which is characterized in that thin in CHO using gene editing technological means
CYLD genes are transformed in born of the same parents and make its inactivation, obtain the recombination platform cell strain that CYLD is knocked out.
2. a kind of method knocking out CYLD genes in Chinese hamster ovary celI according to claim 1, which is characterized in that the base
Because edit methods can be CRISPR-Cas9 technologies, the sgRNA sequences of selectively targeted editor CYLD are：
GCTGTACGGACGGAACTTTC。
3. a kind of method knocking out CYLD genes in Chinese hamster ovary celI according to claim 1, which is characterized in that knock out cell
Nucleotide sequence SEQ ID NO:1 could alternatively be SEQ ID NO:2、NO:3、NO:4、NO:5 or NO:6.
4. a kind of if the gene knockout Chinese hamster ovary celI strain of any the method structures of claim 1-3 is in therapeutic recombinant proteins table
Application in reaching.
5. application of the gene knockout Chinese hamster ovary celI strain according to claim 4 in therapeutic recombinant proteins expression, feature
It is, the yield of corresponding recombinant protein can be improved after transient transfection encoding plasmids in the platform cell.
6. application of the gene knockout Chinese hamster ovary celI strain according to claim 5 in therapeutic recombinant proteins expression, feature
It is, the encoding plasmids being transfected can be the plasmid etc. of expression anti-Rituximab antibodies.
Application of the 7.CYLD genes in engineering cell strain, which is characterized in that press down in the cell for stablizing express therapeutic antibody
CYLD processed can obtain high yielding cell sarain, can be used for the industrial production of corresponding antibodies.
8. application of the CYLD genes according to claim 7 in engineering cell strain, which is characterized in that stablize expression treatment
Property drug cell strain can be CHO-IgG cell strains, cell strain stable integration nucleotide sequence SEQ ID NO:7 Hes
NO:The heavy and light chain-ordering of anti-EGFR humanized antibodies shown in 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810250082.3A CN108504692B (en) | 2018-03-26 | 2018-03-26 | Construction method of gene knockout CHO cell strain and application of gene knockout CHO cell strain in expression of therapeutic recombinant protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810250082.3A CN108504692B (en) | 2018-03-26 | 2018-03-26 | Construction method of gene knockout CHO cell strain and application of gene knockout CHO cell strain in expression of therapeutic recombinant protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108504692A true CN108504692A (en) | 2018-09-07 |
| CN108504692B CN108504692B (en) | 2021-07-23 |
Family
ID=63378390
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810250082.3A Active CN108504692B (en) | 2018-03-26 | 2018-03-26 | Construction method of gene knockout CHO cell strain and application of gene knockout CHO cell strain in expression of therapeutic recombinant protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108504692B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804625A (en) * | 2019-11-21 | 2020-02-18 | 安徽大学 | Method for increasing production of therapeutic antibody by over-expressing PTEN C124S in CHO (Chinese hamster ovary) cells |
| CN113881703A (en) * | 2021-10-11 | 2022-01-04 | 中国人民解放军军事科学院军事医学研究院 | Method for improving CHO cell homologous recombination efficiency and related product and application thereof |
| CN114657181A (en) * | 2022-04-01 | 2022-06-24 | 安徽大学 | H1.4-targeted sgRNA and H1.4 gene editing method |
| CN115850517A (en) * | 2022-11-14 | 2023-03-28 | 沈阳药科大学 | Method for improving yield of GLP-1Fc fusion protein |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007134325A2 (en) * | 2006-05-15 | 2007-11-22 | Introgen Therapeutics, Inc. | Methods and compositions for protein production using adenoviral vectors |
| WO2012127240A2 (en) * | 2011-03-24 | 2012-09-27 | The University Of Birmingham | Immune assay |
| CN104379180A (en) * | 2012-04-10 | 2015-02-25 | 佐治亚州立大学研究基金会公司 | Compositions and methods for treating otitis media and other conditions with inhibitors of CYLD |
| CN105073995A (en) * | 2013-02-01 | 2015-11-18 | 瑟莱克斯公司 | Enhanced transgene expression and processing |
| CN105327350A (en) * | 2014-07-23 | 2016-02-17 | 中国科学院上海巴斯德研究所 | Application of ubiquitin pathway related factor in regulating function of helper T cells |
-
2018
- 2018-03-26 CN CN201810250082.3A patent/CN108504692B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007134325A2 (en) * | 2006-05-15 | 2007-11-22 | Introgen Therapeutics, Inc. | Methods and compositions for protein production using adenoviral vectors |
| WO2012127240A2 (en) * | 2011-03-24 | 2012-09-27 | The University Of Birmingham | Immune assay |
| CN104379180A (en) * | 2012-04-10 | 2015-02-25 | 佐治亚州立大学研究基金会公司 | Compositions and methods for treating otitis media and other conditions with inhibitors of CYLD |
| CN105073995A (en) * | 2013-02-01 | 2015-11-18 | 瑟莱克斯公司 | Enhanced transgene expression and processing |
| CN105327350A (en) * | 2014-07-23 | 2016-02-17 | 中国科学院上海巴斯德研究所 | Application of ubiquitin pathway related factor in regulating function of helper T cells |
Non-Patent Citations (5)
| Title |
|---|
| JIAN-GUO LI ET AL.: ""Agonist-promoted Lys 63-linked polyubiquitination of the human kappa opioid receptor is involved in receptor down-regulation"", 《MOL PHARMACOL.》 * |
| SIMON FISCHER ET AL.: ""Enhanced protein production by microRNA-30 family in CHO cells is mediated by the modulation of the ubiquitin pathway"", 《JOURNAL OF BIOTECHNOLOGY》 * |
| XING LIN ET AL.: ""CYLD Promotes TNF-α-Induced Cell Necrosis Mediated by RIP-1 in Human Lung Cancer Cells"", 《MEDIATORS OF INFLAMMATION》 * |
| YAFANG LU ET AL.: ""Inactivation of deubiquitinase CYLD enhances therapeutic antibody production in Chinese hamster ovary cells"", 《APPLIED MICROBIOLOGY AND BIOTECHNOLOGY》 * |
| 孙涛等: ""Crispr/Cas9 技术在CHO细胞中基因敲除的应用"", 《中国医药工业杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804625A (en) * | 2019-11-21 | 2020-02-18 | 安徽大学 | Method for increasing production of therapeutic antibody by over-expressing PTEN C124S in CHO (Chinese hamster ovary) cells |
| CN113881703A (en) * | 2021-10-11 | 2022-01-04 | 中国人民解放军军事科学院军事医学研究院 | Method for improving CHO cell homologous recombination efficiency and related product and application thereof |
| CN114657181A (en) * | 2022-04-01 | 2022-06-24 | 安徽大学 | H1.4-targeted sgRNA and H1.4 gene editing method |
| CN114657181B (en) * | 2022-04-01 | 2023-08-25 | 安徽大学 | H1.4-targeted sgRNA and H1.4 gene editing method |
| CN115850517A (en) * | 2022-11-14 | 2023-03-28 | 沈阳药科大学 | Method for improving yield of GLP-1Fc fusion protein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108504692B (en) | 2021-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504692B (en) | Construction method of gene knockout CHO cell strain and application of gene knockout CHO cell strain in expression of therapeutic recombinant protein | |
| KR102641640B1 (en) | Anti-ICOS agonist antibodies and uses thereof | |
| CN110862454B (en) | anti-Claudin 18_2 antibody and application thereof | |
| CN107827982B (en) | Use of anti-CGRP antibodies and antibody fragments to prevent or inhibit photophobia or aversion to light in a subject in need thereof | |
| CN101646457B (en) | Anti-sclerostin antibodies | |
| RU2701797C2 (en) | Antibodies to pd-1 and methods of their application | |
| KR102007055B1 (en) | CD27L Antigen Binding Proteins | |
| US8187601B2 (en) | Fibroblast growth factor receptor 3 (FGFR3) binding proteins | |
| CN107586338B (en) | anti-CGRP compositions and uses thereof | |
| CN108359008B (en) | Use of anti-CGRP or anti-CGRP-R antibodies or antibody fragments for the treatment or prevention of chronic and acute forms of diarrhea | |
| CN113939536B (en) | TIGIT and PD-1/TIGIT-binding molecules | |
| CN110831973B (en) | Multispecific antibodies and methods of making and using the same | |
| CN106659801A (en) | Anti-PTK7 antibody-drug conjugates | |
| CN108623686A (en) | Anti- OX40 antibody and application thereof | |
| CN102482349A (en) | Anti-vegf antibodies and their uses | |
| CN107531773A (en) | For the composition and method of the effect for strengthening treatment of cancer | |
| CN106519036A (en) | Anti-CD47 and anti-EGFR bifunctional protein as well as preparation method and application thereof | |
| KR20220004985A (en) | Recombinant protein with CD40 activation properties | |
| CN110804625A (en) | Method for increasing production of therapeutic antibody by over-expressing PTEN C124S in CHO (Chinese hamster ovary) cells | |
| CN102050877A (en) | Anti-human CD20 humanized antibody, preparation method and application thereof | |
| CN102050878B (en) | Anti-human CD20 humanized antibody and preparation method and application thereof | |
| CN104610453A (en) | Anti-HER2 dual-targeting antibodies, and preparation method and application thereof | |
| CN113698487A (en) | Anti-human ACE2 monoclonal antibody and application thereof | |
| KR20230121759A (en) | ANTI-MARCO ANTIBODIES AND USES THEREOF | |
| CN102050879B (en) | Anti-human CD20 humanized antibody and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |