CN108504692B

CN108504692B - Construction method of gene knockout CHO cell strain and application of gene knockout CHO cell strain in expression of therapeutic recombinant protein

Info

Publication number: CN108504692B
Application number: CN201810250082.3A
Authority: CN
Inventors: 张部昌; 韩倩倩; 徐昌志; 鲁亚芳; 周琴; 吴鹏飞; 张兰兰; 邵国建; 喻阳
Original assignee: Anhui University
Current assignee: Anhui University
Priority date: 2018-03-26
Filing date: 2018-03-26
Publication date: 2021-07-23
Anticipated expiration: 2038-03-26
Also published as: CN108504692A

Abstract

The invention discloses a construction method of a gene knockout CHO cell strain and application thereof in expression of therapeutic recombinant protein. The construction method of the CYLD knockout CHO cell strain specifically comprises the following steps: and introducing the knockout vector into CHO cells, and screening to obtain a cell strain with deletion of CYLD expression mediated by the knockout plasmid. The nucleotide sequence SEQ ID NO. 1 in the knockout cell can be replaced by SEQ ID NO. 2, NO. 3, NO. 4, NO. 5 or NO. 6; the transfected cells may be CHO-K1 cells or CHO cells stably expressing a certain antibody. The invention has important application value for improving the expression yield of the therapeutic recombinant protein.

Description

Construction method of gene knockout CHO cell strain and application of gene knockout CHO cell strain in expression of therapeutic recombinant protein

Technical Field

The invention mainly relates to construction of a CHO modified cell strain and application thereof in a therapeutic recombinant protein expression process.

Background

In recent years, therapeutic antibodies have achieved significant therapeutic effects in the prevention and treatment of diseases such as clinical malignant tumors, autoimmune diseases, and rapid infectious diseases. Meanwhile, the whole development of the antibody industry is promoted, the total value of the global antibody industry is increased year by year, and the global sales of monoclonal antibodies in 2016 is counted to be nearly $ 700 billion, and the monoclonal antibodies are increased by about 10%. However, the antibody industry in China still mainly imitates, and effective innovation on antibody varieties is lacked. Meanwhile, the whole productivity is seriously insufficient, and documents report that the average yield of the antibody industry in China is about 1g/L, which is obviously lower than the foreign 4g/L level. Therefore, it is urgent to effectively improve the antibody production.

Chinese Hamster Ovary (CHO) cells are the most commonly used host cells in the antibody industry. The CHO cells have good plasticity and growth characteristics and can be cultured in a serum-free culture medium in a high-density suspension manner. However, as the volume of the reactor increases, the ability to maintain high-density growth for a long period of time and to continue producing antibodies becomes a key factor in further increasing antibody production. Under the conditions of metabolic pressure, nutrient limitation, shearing pressure and the like, CHO cells can be mediated to undergo apoptosis, so that the control of apoptosis becomes a method for effectively improving the yield. The main method comprises the following steps: 1. optimizing the culture process and the culture medium; 2. CHO cell engineering, overexpression of anti-apoptosis genes or inhibition of pro-apoptosis genes to achieve CHO apoptosis control. The defect that the anti-apoptosis or pro-apoptosis gene is changed independently still exists, for example, the growth speed of CHO cells is reduced, and the screening process of cell strains is hindered; during the resistance-producing process, mitosis of cells slows down, and the desired cell density cannot be achieved. Therefore, screening multifunctional genes and constructing corresponding cell strains become a new ideal way.

Tumor suppressor CYLD (Cylindromatosis, Topica tumor syndrome protein) is a deubiquitinase. The deletion or mutation occurs in various tumors, such as cylindroma, T cell leukemia, colon cancer, liver cancer, lung cancer and other cancers, and the abnormality of CYLD is closely related to the occurrence and development of the tumors. Meanwhile, CYLD is an important immunoregulatory gene and is widely involved in the innate immune response and inflammatory reaction processes. Mechanism research shows that CYLD mainly plays a role in negatively regulating NF-kB, JNK, Wnt and other signal pathways. In addition, CYLD can also interact with cytoskeletal proteins to regulate cell proliferation. Inhibition of CYLD can promote cell proliferation, inhibit apoptosis, and widely affect various signaling pathways to regulate various physiological functions. Thus, CYLD becomes a multifunctional gene.

In recent years, the gene editing technology is rapidly developed, and the CRISPR-Cas9 nuclease system has the technical characteristics of higher efficiency and rapidness, and is widely applied to genome editing of eukaryotic cells. The technology utilizes a specific guide RNA to guide Cas9 nuclease to cut at a specific position to form a DNA double-strand break (DSB), and then utilizes a non-homologous end joining (NHEJ) or Homologous Directed Repair (HDR) repair mode to edit a target gene region.

Disclosure of Invention

The invention aims to provide a construction method of a gene knockout CHO cell strain and application thereof in the expression process of therapeutic recombinant protein, and a method for improving the yield of the therapeutic recombinant protein.

On one hand, the invention provides a construction method of a gene knockout CHO cell strain, which comprises the following steps:

according to the technical requirements of CRISPR-Cas9 and sequence homology alignment analysis, an sgRNA sequence of a specific targeting CYLD exon is screened and designed: 5'-GCTGTACGGACGGAACTTTC-3' are provided. Constructing a vector with the sequence, introducing the vector into CHO cells, and screening to obtain a cell strain with deletion of CYLD expression mediated by the knockout plasmid.

Wherein, the nucleotide sequence SEQ ID NO. 1 in the knockout cell can be replaced by SEQ ID NO. 2, NO. 3, NO. 4, NO. 5 or NO. 6; the transfected cells may be CHO-K1 cells or CHO cells stably expressing a certain antibody.

On the other hand, the invention improves the application of the gene knockout CHO cell strain constructed by the method in the expression of therapeutic recombinant protein; the production of the corresponding recombinant protein can be improved after transient transfection of the coding plasmid in the platform cell.

Wherein, the transfected coding plasmid can be a plasmid for expressing rituximab and the like.

In addition, the invention provides the application of CYLD gene in engineering cell strain, and the CYLD can be inhibited in cells stably expressing therapeutic antibody to obtain high-yield cell strain, which can be used for industrial production of corresponding antibody.

Wherein, the cell strain for stably expressing the therapeutic drug can be a CHO-IgG cell strain, and the cell strain stably integrates heavy and light chain sequences of the anti-EGFR humanized antibody shown by nucleotide sequences SEQ ID NO. 7 and NO. 8.

The invention has important application value for improving the expression yield of the therapeutic antibody.

Drawings

Fig. 1 is the targeting positions of 4 sgrnas in exons of CYLD.

FIG. 2 shows CYLD expression after 4 sgRNA expression plasmids were transfected into CHO-K1 cells.

FIG. 3 shows the result of detecting the cleavage efficiency by the mismatch enzyme T7E 1.

FIG. 4 shows the identification of the knockout cells.

FIG. 5 shows the proliferation of a knockout cell.

FIG. 6 shows the measurement of cell viability after transient transfection of antibody plasmids.

FIG. 7 is a graph showing the yield analysis after transient transfection of rituximab.

FIG. 8 shows the identification of the CHO-IgG-sgRNA3 cell line.

FIG. 9 is the number of viable cells during culture of CHO-IgG cells after CYLD inhibition.

FIG. 10 is a graph showing the antibody production assay expressed by CHO-IgG cells after CYLD inhibition.

Detailed Description

The following examples facilitate a better understanding of the invention, but do not limit it. The experimental procedures in the following examples are conventional biochemical procedures unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative experiments in the following examples were set up in triplicate and the results averaged.

pSpCas9(BB) -2A-Puro vector was purchased from adddge (catalog number: PX 459). CHO-K1 cells: ATCC (CCL-61). CD-CHO medium: gibco (Cat. No.: 10743-029). OptiMEM I Medium: Gibco (Cat. No: 31985-. Liposomes (Fugene HD): promega corporation (catalog number: E2311). Puromycin: gene Operation (catalog number: ISY1130-0025 MG). Cetuximab: merck corporation (import pharmaceutical certificate No. S20050095, product batch No. 7667201). pcDNA-3.3 vector: invitrogen (Cat. No: K8300-01). pOptiVEC vector: invitrogen (Cat. No.: 12744-017).

Example 1 preparation of CHO-K1-sgRNA3 cells

First, sgRNA design

An open reading frame of a CYLD gene in a CHO cell comprises 16 exons, and 4 sgRNAs (sgRNAs 1-4), sgRNAs 1 and sgRNAs 4 which simultaneously target exons 1, sgRNAs 2 and sgRNAs 3 which respectively target exons 6 and 7, are screened and designed according to the technical requirements of CRISPR-Cas9 and sequence homology comparison analysis. The target sequences of the four sgrnas are shown in table 1 below, and the positions on the CYLD exons are shown in the results in fig. 1.

Table 14 sgRNA target sequences

Name (R)	Sequence (5 '-3')
		sgRNA1	CCAGGAGTTGTACGCTTCAG
sgRNA2	TATGGGGTTATCCGTTGGAT
		sgRNA3	GCTGTACGGACGGAACTTTC
sgRNA4	CCTCTGAAGCGTACAACTCC

Second, recombinant plasmid construction

Further synthesizing the DNA sequences and their complementary mating sequences in Table 1 according to the requirement of the expression vector, the DNA sequences are shown in Table 2. After annealing, a double-stranded DNA molecule with sticky ends at both ends was formed, and the double-stranded DNA molecule was digested with BbsI and ligated to the vector pSpCas9(BB) -2A-Puro to obtain 4 recombinant plasmids (pSpCas9(BB) -2A-Puro-sgRNA1, pSpCas9(BB) -2A-Puro-sgRNA2, pSpCas9(BB) -2A-Puro-sgRNA3 and pSpCas9(BB) -2A-Puro-sgRNA 4).

Insert fragment sequences in Table 24 recombinant plasmids

Thirdly, screening the transfection and inhibition effects of cells

The 4 recombinant plasmids are transfected into CHO-K1 cells, and the transfection method can be as follows:

1. plates were plated 1 day before transfection, and approximately 1X 10 was plated⁶CHO-K1 cells (greater than 95% viability) were plated in 6-well plates at 37 ℃ with 5% CO₂The culture was carried out overnight in an incubator.

2. After 24 hours, the relevant transfection was carried out, and the 4 recombinant plasmids were diluted with opti-MEM I Medium to give plasmid solutions with a total volume of 150. mu.l and a final concentration of 0.02. mu.g/l, respectively. 10 μ l Fugene HD transfection reagent was added, mixed gently and incubated for 5 min at room temperature. Finally, the mixture of plasmid and transfection reagent was added dropwise to CHO-K1 cells in 6-well plates and incubation was continued for 24 hours.

3. After the culture is finished, the culture medium is discarded, the cells are washed for 3 times by using PBS buffer solution, protein extraction is carried out by using RIPA lysate after trypsinization, and then an immunoblotting experiment is carried out to detect the expression levels of CYLD and internal reference protein GAPDH. The results are shown in FIG. 2. From the results, it can be seen that pSpCas9(BB) -2A-Puro-sgRNA3 plasmid shows a relatively significant CYLD inhibition effect after transfection. Further, puromycin was added to cells transfected with pSpCas9(BB) -2A-Puro-sgRNA3 for selection, and 1 week later, the genome of the cells was extracted and then PCR-amplified for CYLD genomic sequence containing the sgRNA3 target region. The PCR amplification primer is

F：GTTAGTCAGTCCCTGTTCGTTGG；

R：CCTCCATCTGCCAAGCTGACTGC。

After obtaining the PCR product, the cleavage efficiency was examined by using the mismatch enzyme T7E 1. The results are shown in FIG. 3. From the results, it can be seen that the sgRNA3 introduced can cut the target region into 2 small fragments, the size of which is consistent with the expectation.

Fourth, screening and identifying cell strain

On the basis of the previous screening, pSpCas9(BB) -2A-Puro-sgRNA3 stable expression cell strains are further screened, and 4 stable cell strains are finally obtained after 3 rounds of pressure screening and limited dilution screening. The final knock-out effect is shown in FIG. 4, where it can be seen that CYLD is not expressed in any of the 4 cell lines. The corresponding sequences in exon 7 of CYLD were found by alignment after sequencing to be edited into sequences in

sequences

2, 3, 4, 5 and 6. Deletion or addition of bases occurs.

Fifth, cell activity identification and antibody expression

After obtaining the knockout cell, detecting the proliferation speed and the activity of the cell. Inoculation of 1X 10⁵Continuously culturing the individual/hole control cells or the knockout cells in a 6-hole plate, and detecting the number of the cells by using a cell counter on the 1 st day, the 3 rd day and the 5 th day after inoculation respectively to obtain a result figure 5, wherein the proliferation speed of the knockout cells is obviously accelerated; to examine the effect of knockdown cells on antibody expression, we transiently transfected a rituximab plasmid (see sequence for its heavy and light chains inSequence 9 and sequence 10 in the sequence listing). The general method comprises the following steps: cells were seeded in 6-well plates and 24 hours later total 2 microgram of antibody plasmid was transfected. Cell culture supernatants of the rituximab plasmid were collected on day 1, day 3 and day 5 after transfection, respectively, and the cells were collected on day 3 for MTT assay, to obtain results of fig. 6 and fig. 7, from which it can be seen that cell viability and rituximab expression can be significantly enhanced after knockout of CYLD, and the average yield is increased by about 1-fold.

Example 2 preparation of CHO-IgG-sgRNA3 cells

The effect on antibody expression after inhibition of CYLD was demonstrated using a CHO-K1 suspension cell stably expressing anti-EGFR humanized antibody L4H 3. The process for constructing the cell stably expressing the anti-EGFR humanized antibody is as follows:

1. the double-stranded DNA molecule shown in the sequence 7 of the sequence table is recombined between HindIII and NotI enzyme cutting sites of the pcDNA-3.3 vector to obtain a recombinant plasmid pcDNA3.3-L4.

2. The complete sequence 8 of the sequence table was recombinantly cloned between HindIII and NotI cleavage sites of the pOptiVEC vector to obtain recombinant plasmid pOptiVEC-H3.

3. The recombinant plasmid pcDNA3.3-L4 and the recombinant plasmid pOptiVEC-H3 are co-transfected into CHO-K1 cells, recombinant cells which stably express the heavy and light chains of the antibody are obtained by screening, and are domesticated into suspension culture cells, and the suspension culture cells are named as CHO-IgG cells.

On the basis, sgRNA3 plasmid is further transfected, puromycin screening and limited dilution sorting are carried out, a CYLD-knocked cell strain is finally obtained, the cell strain is named as CHO-IgG-sgRNA3 cell, and the CYLD expression level detection result is shown in figure 8. And the batch culture was performed and the antibody level in the supernatant was examined. The batch culture conditions were: inoculation of 1X 10⁶CHO-IgG or CHO-IgG-sgRNA3 cells were kept in 125mL shake flasks and made up to 30mL with CD-CHO medium. Placing at 37 ℃ and 8% CO₂The cultivation was carried out in an incubator of 125 rpm. And partial supernatants and cells were collected on

days

1, 3, 6, 9, 12 and 15, respectively, and viable cell count and antibody concentration detection were performed using ELISA. The final results are shown in FIG. 9 and FIG. 10, it can be seen that the number of living cells and the antibody yield in batch culture can be obviously increased after CYLD inhibition, and the anti-EGFR antibody yield in knockdown cell strains is improved by about 50%.

Sequence listing

<110> university of Anhui

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 166

<212> DNA

<213> Cricetusgriseus

<400> 1

gaagatgaat gtgcaggctg tacggacgga actttcaggg gcactcgcta cttcacctgc 60

gccctgaaga aggcgctgtt cgtaaaactg aagagctgca gacccgactc taggtttgcg 120

tccttgcagc ctgtttctaa tcagattgaa aggtgtaatt ctttag 166

<210> 2

<211> 363

<212> DNA

<213> Artificial sequence ()

<400> 2

gaagatgaat gtgcaggctg tacggacgga actacggtaa actgcccact tggcagtaca 60

tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta aatggcccgc 120

ctggcattgt gcccagtaca tgaccttatg ggactttcct acttggcagt acatctacgt 180

attagtcatc gctattacca tggtcgaggt gagccccacg ttctgcttca ttcaggggca 240

ctcgctactt cacctgcgcc ctgaagaagg cgctgttcgt aaaactgaag agctgcagac 300

ccgactctag gtttgcgtcc ttgcagcctg tttctaatca gattgaaagg tgtaattctt 360

tag 363

<210> 3

<211> 168

<212> DNA

<213> Artificial sequence ()

<400> 3

gaagatgaat gtgcaggctg tacggacgga actttttcag gggcactcgc tacttcacct 60

gcgccctgaa gaaggcgctg ttcgtaaaac tgaagagctg cagacccgac tctaggtttg 120

cgtccttgca gcctgtttct aatcagattg aaaggtgtaa ttctttag 168

<210> 4

<211> 150

<212> DNA

<213> Artificial sequence ()

<400> 4

gaagatgaat gtgcaggctg tacggcactc gctacttcac ctgcgccctg aagaaggcgc 60

tgttcgtaaa actgaagagc tgcagacccg actctaggtt tgcgtccttg cagcctgttt 120

ctaatcagat tgaaaggtgt aattctttag 150

<210> 5

<211> 165

<212> DNA

<213> Artificial sequence ()

<400> 5

gaagatgaat gtgcaggctg tacggacgga acttcagggg cactcgctac ttcacctgcg 60

ccctgaagaa ggcgctgttc gtaaaactga agagctgcag acccgactct aggtttgcgt 120

ccttgcagcc tgtttctaat cagattgaaa ggtgtaattc tttag 165

<210> 6

<211> 164

<212> DNA

<213> Artificial sequence ()

<400> 6

gaagatgaat gtgcaggctg tacggacgga attcaggggc actcgctact tcacctgcgc 60

cctgaagaag gcgctgttcg taaaactgaa gagctgcaga cccgactcta ggtttgcgtc 120

cttgcagcct gtttctaatc agattgaaag gtgtaattct ttag 164

<210> 7

<211> 1356

<212> DNA

<213> Artificial sequence ()

<400> 7

caggtacaac tacagcagcc tggggctgag ctggtgaagc ctggggcctc agtgaagatg 60

tcctgcaagg cttctggcta cacatttacc agttacaata tgcactgggt aaagcagaca 120

cctggtcggg gcctggaatg gattggagct atttatccag gaaatggtga tacttcctac 180

aatcagaagt tcaagggcaa ggccacactg actgcagaca aatcctccag cacagcctac 240

atgcagctca gcagcctgac atctgaagac tctgcggtct attactgtgc aagatcgact 300

tactacggcg gtgactggta cttcaatgtc tggggcgcag ggaccacggt caccgtctct 360

gcagctagca ccaagggccc atcggtcttc cccctggcac cctcctccaa gagcacctct 420

gggggcacag cggccctggg ctgcctggtc aaggactact tccccgaacc ggtgacggtg 480

tcgtggaact caggcgccct gaccagcggc gtgcacacct tcccggctgt cctacagtcc 540

tcaggactct actccctcag cagcgtggtg accgtgccct ccagcagctt gggcacccag 600

acctacatct gcaacgtgaa tcacaagccc agcaacacca aggtggacaa gaaagttgag 660

cccaaatctt gtgacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 720

ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 780

cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 840

tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga agagcagtac 900

aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 960

aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 1020

tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggat 1080

gagctgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 1140

atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 1200

gtgctggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg 1260

tggcagcagg ggaacgtctt ctcatgctcc gtgatgcatg aggctctgca caaccactac 1320

acgcagaaga gcctctccct gtctcccggt aaatga 1356

<210> 8

<211> 639

<212> DNA

<213> Artificial sequence ()

<400> 8

caaattgttc tctcccagtc tccagcaatc ctgtctgcat ctccagggga gaaggtcaca 60

atgacttgca gggccagctc aagtgtaagt tacatccact ggttccagca gaagccagga 120

tcctccccca aaccctggat ttatgccaca tccaacctgg cttctggagt ccctgttcgc 180

ttcagtggca gtgggtctgg gacctcttac tctctcacaa tcagtagagt ggaggctgaa 240

gatgctgcca cttattactg ccagcagtgg actagtaacc cacccacgtt cggtggtggg 300

accaagctgg agatcaaacg aactgtggct gcaccatctg tcttcatctt cccgccatct 360

gatgagcagt tgaaatctgg aactgcctct gttgtgtgcc tgctgaataa cttctatccc 420

agagaggcca aagtacagtg gaaggtggat aacgccctcc aatcgggtaa ctcccaggag 480

agtgtcacag agcaggacag caaggacagc acctacagcc tcagcagcac cctgacgctg 540

agcaaagcag actacgagaa acacaaagtc tacgcctgcg aagtcaccca tcagggcctg 600

agctcgcccg tcacaaagag cttcaacagg ggagagtgt 639

<210> 9

<211> 1353

<212> DNA

<213> Artificial sequence ()

<400> 9

caggtgaagc tgctggagca gtctggggct gaagtgaaga agcctggggc ctcagtgaag 60

gtttcctgca aggcatctgg attcagcctg actaactacg gcgtccactg ggtgcgacag 120

gcccctggac aaagacttga gtggatggga gtgatctgga gtggtggtaa cactgactac 180

aacaccccct tcactagcag agtcaccatc accagggaca cgtccgctac tacagcctac 240

atgggcctgt ctagcctgag acccgaggac acggccgtat attactgtgc gagagccctg 300

acttattacg actacgagtt cgcctactgg ggccagggaa ccctggtcac cgtctcctca 360

gctagcacca agggcccatc ggtcttcccc ctggcaccct cctccaagag cacctctggg 420

ggcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg 480

tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct acagtcctca 540

ggactctact ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacccagacc 600

tacatctgca acgtgaatca caagcccagc aacaccaagg tggacaagaa agttgagccc 660

aaatcttgtg acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga 720

ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc ccggacccct 780

gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc ctgaggtcaa gttcaactgg 840

tacgtggacg gcgtggaggt gcataatgcc aagacaaagc cgcgggagga gcagtacaac 900

agcacgtacc gtgtggtcag cgtcctcacc gtcctgcacc aggactggct gaatggcaag 960

gagtacaagt gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa aaccatctcc 1020

aaagccaaag ggcagccccg agaaccacag gtgtacaccc tgcctccatc tcgggatgag 1080

ctgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctatcc cagcgacatc 1140

gccgtggagt gggagagcaa tgggcagccg gagaacaact acaagaccac gcctcccgtg 1200

ctggactccg acggctcctt cttcctctat agcaagctca ccgtggacaa gagcaggtgg 1260

cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacacg 1320

cagaagagcc tctccctgtc tccgggtaaa tga 1353

<210> 10

<211> 645

<212> DNA

<213> Artificial sequence ()

<400> 10

gaactcgtca tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcaac 60

attgcctgcc gggcaagtca gagcattggc actaacatcc actggtatca gcagaaacca 120

gggaaagccc ctagactcct gatcaaatat gcctccgaaa gcatcagtgg ggtcccatca 180

agattcagcg gcagtggatc tggcacagat ttcactctca ccatcagcag cctgcagcct 240

gaagattttg caatctatta ctgtcagcaa aataacaatt ggcctactac gttcggcgga 300

gggaccaagg tggaaatcaa acgaactgtg gcggcgccat ctgtcttcat cttcccgcca 360

tctgatgagc agttgaaatc tggtaccgct agcgttgtgt gcctgctgaa taacttctat 420

cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg taactcccag 480

gagagtgtca cagagcagga cagcaaggac agcacctaca gcctcagcag caccctgacg 540

ctgagcaaag cagactacga gaaacacaaa gtctacgcct gcgaagtcac ccatcagggc 600

ctgagctcgc ccgtcacaaa gagcttcaac aggggagagt gttag 645

Claims

1. An application of a gene knockout CHO cell strain in the expression of therapeutic recombinant protein is characterized in that the construction method of the gene knockout CHO cell strain comprises the following steps: transforming CYLD gene in CHO cell by means of gene editing technology and inactivating it to obtain CYLD knocked out recombinant cell strain;

the gene editing method is a CRISPR-Cas9 technology, and the sgRNA sequence of the CYLD is specifically edited in a targeted manner as follows: GCTGTACGGACGGAACTTTC, respectively;

the nucleotide sequence SEQ ID NO. 1 in the cell is replaced by SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6.

2. Use of a knockout CHO cell line for the expression of a therapeutic recombinant protein according to claim 1, wherein the production of the corresponding recombinant protein is increased after transient transfection of the coding plasmid in the cell.

3. The use of the knockout CHO cell line of claim 2 for the expression of a therapeutic recombinant protein, wherein the transfected encoding plasmid is a plasmid expressing rituximab.

The application of CYLD gene in CHO engineering cell strain, which is characterized in that the CYLD is inhibited in CHO cells stably expressing therapeutic antibody to obtain high-yield cell strain, which can be used for industrial production of corresponding antibody.

5. The use of CYLD gene in engineered cell lines according to claim 4, characterized in that the cell line stably expressing the therapeutic drug is a CHO-IgG cell line stably incorporating the heavy and light chain sequences of the anti-EGFR humanized antibody represented by the nucleotide sequences SEQ ID NO. 7 and SEQ ID NO. 8.