CN102050879B - Anti-human CD20 humanized antibody and preparation method and application thereof - Google Patents

Abstract

The invention belongs to the biotechnology field and in particular discloses an anti-human CD20 humanized antibody hu8F6 and a preparation method and application thereof. The amino acid sequences of the hypervariable region of the heavy chain of the anti-human CD20 humanized antibody hu8F6 are CDR1:NYWMQ, CDR2:AIYPGDGDTRYTQKFKG and CDR3:EGAYGYDDGMDY. The amino acid sequences of the hypervariable region of the light chain of the anti-human CD20 humanized antibody hu8F6 are CDR1:RASQSIRNNLH, CDR2:YASQSIS and CDR3:QQSNTWPLT. The anti-human CD20 humanized antibody hu8E4 disclosed by the invention retains the affinity and specificity of the original mouse antibody, has certain biological functions and can be used for preparing the drugs for treating lymphoma in a high CD20 expression state.

Description

Anti-humen CD 20 humanized antibody, Preparation Method And The Use

Technical field

The present invention relates to biological technical field, relate in particular to a kind of antibody, Preparation Method And The Use.

Background technology

Non-Hodgkin′s lymphomas (NHL) is modal lymphsystem malignant tumour, is apt to occur in person between twenty and fifty, and wherein the overwhelming majority is B cell derived, accounts for 85%.Under therapeutic state not, the low and pernicious NHL of part moderate is often inert process as the growth forms of small lymphocytic lymphoma and follicular lymphoma, and median survival interval is 5～9 years.They are to chemosensitivity first, but are easy to recurrence or resistance, and when chemotherapy again or radiotherapy, curative effect obviously reduces, thereby are considered to be difficult to the malignant tumour of curing.The NHL of some high malignancies mortality ratio is high.

In recent years, for the antigen magnetic target therapy of cell surface molecule, obtained huge progress and become a kind of very rising methods for the treatment of, be wherein widely used and fruitful be monoclonal antibody preparation [the Maloney DG.Immunotherapy for non-Hodgkin ' s lymphoma:monoclonal antibody and vaccines.J Clin Oncol.2005 Sep 10 of anti-CD20; 23 (26): 6421-6428].

CD20 antigen is a desirable target spot of non-associativity monoclonal antibody therapy, because this antigen has clone-specific, is only expressed in all pre B cells and mature B cell, and is not expressed in hemopoietic stem cell, plasmocyte and other hematopoietic cells system; Meanwhile, CD20 molecule increases extremely at the expression amount on B lymphoma cell surface, and phosphorylation increases, closely related with the generation of B cell lymphoma.CD20 molecule all has expression in surpassing 95% B cellularity NHL, and antigen molecule relatively exposes on film, easily approach, be combined rear without remarkable internalization with come off with monoclonal antibody, can, because with the combination of antibody, antigenic modulation occurring, therefore not become the desirable target spot for the treatment of B cell lymphoma yet.

CD20 monoclonal antibody therapy has obtained gratifying effect in treatment B cell lymphoma, at present anti-CD20 antibodies mainly contains following severally, according to the difference in functionality of its performance antitumor action, is divided into two large classes: (1) is mainly by CDC, ADCC (CDCC) effect performance function: C2B8,1F5,2H7,2F2 (2) mainly pass through apoptosis, ADCC (CDCC) and act on performance function: B1,11B8.The chimeric anti-CD-20 monoclonal antibody Rituximab-C2B8 of people mouse that American I DEC phamaceutical company produces for B cell lymphoma is that first is used for the treatment of lymphadenomatous antibody through U.S. FDA approval.Approval listing in 1997.Mabthera is a kind of mosaic type IgG1 immunoglobulin (Ig), and it is to the gene product of expressing after hamster ovum by transfection genes involved structure.Mabthera is containing 1328 amino acid, and the about 144KD of molecular weight consists of variable region Fab and human IgG1's antibody stable region Fc fragment of mouse anti-CD-20 monoclonal antibody.

After entering human body, the mouse resource monoclonal antibody that hybridoma technology is produced may cause human antimouse antibody immunne response human antimouse antibody response (HAMA) [Winter G, Harris WJ.Humanized antibodies.Immunol Today.1993 Jun; 14 (6): 243-6].Therefore, how by genetic engineering technique, to build the anti-immunogenic antibody that reduces mouse source antibody, the incidence that effectively reduces HAMA reaction is the problem that those skilled in the art is eager solution.

Humanized antibody [Ishida T, Tmai K.The expression technology of chimeric andhumanized antibody.Nippon Rinsho, 2002,60 (3): 439-444 Ishida T, Tmai K.Theexpression technology of chimeric and humanized antibody.Nippon Rinsho, 2002,60 (3): 439-444] be the novel gene engineered antibody in order to overcome the defect of mouse source monoclonal antibody in clinical application and to grow up.First-generation humanized antibody is that the constant region of the variable region of mouse monoclonal antibody and people's antibody is formed to chimeric antibody, because the antigen avidity of antibody is determined by its variable region, therefore the avidity of chimeric antibody keeps finely, and immunogenicity has also obtained reduction to a certain degree simultaneously.The variable region of antibody is comprised of hypervariable region (CDR) district and framework region (FR) district, and CDR is the region of alterable height, directly the combination of mediate antibody and antigen.FR district is relatively conservative, maintains in the ，Ta Shi variable region, locus in ZheCDR district produce immunogenic main region as support.Owing to also retaining mouse variable region on chimeric antibody, during clinical application, still usually have strong HAMA reaction.Therefore,, in order to reduce as far as possible the immunogenicity of chimeric antibody, people consider that Jiang Shu CDR district is grafted directly in Zhong FR district, human antibody variable region, obtains CDR grafted antibody, namely humanized antibody.But, simple CDR transplants and often reduces the avidity of even losing original antibody, this is because FR district not only provides the space conformation environment of CDR, sometimes also participate in mutually combining of antigen-antibody directly, only have and become mouse source residue could recover the activity of antibody some important residue reverse mutation in FR.(C，Queen，W，P，Schneider，H，E，Selick，P，W，Payne，N，F，Landolfi，J，F，Duncan，N，M，Avdalovic，M，Levitt，R，P，Junghans，T，A，Waldmann，Ahumanized?antibody?that?binds?to?the?interleukin?2?receptor，Proc.Natl.Acad.Sci.USA?86(1989)10029-10033.V.L.Pulito，V.A.Roberts，J.R.Adair，A.L.Rothermel，A.M.Collins，S.S.Varga，C.Martocello，M.Bodmer，L.K.Jolliffe，R.A.Zivin，Humanization?and?molecular?modeling?of?the?anti-CD4?monoclonal?antibody，OKT4A，J.Immunol.156(1996)2840-2850.K.Nakamura，Y.Tanaka，K.Shitara，N.Hanai，Construction?of?humanized?anti-ganglioside?monoclonal?antibodies?withpotent?immune?effector?functions，Cancer?Immunol.Immunother.50(2001)275-284.)

In sum, obtain active high mouse source monoclonal antibody and utilize be further the restored humanized antibody of antibody activity of its CDR is that those skilled in the art puts forth effort the problem solving always.

Summary of the invention

One object of the present invention is to provide anti-humen CD 20 humanized antibody, by Jiang Shu CDR district, is transplanted to human antibody hypervariable region, and the amino acid of human antibody framework region is retrofited simultaneously and obtain avidity and keep good antibody.

Therefore, the invention provides a kind of anti-humen CD 20 humanized antibody, its heavy chain hypervariable region aminoacid sequence is CDR1:NYWMQ, CDR2:AIYPGDGDTRYTQKFKG and CDR3:EGAYGYDDGMDY, and light chain hypervariable region aminoacid sequence is CDR1:RASQSIRNNLH; CDR2:YASQSIS and CDR3:QQSNTWPLT.

Further, anti-humen CD 20 humanized antibody of the present invention, its weight chain variable region amino acid sequence is SEQ ID NO:10, light chain variable region amino acid sequence is SEQ ID NO:12, more specifically, Humanized anti-CD 20 antibody provided by the invention, its heavy chain amino acid sequence is SEQ ID NO:6, light-chain amino acid sequence is SEQ ID NO:8.

Further, anti-humen CD 20 humanized antibody of the present invention, is comprised of heavy chain and light chain, and wherein heavy chain comprises variable region of heavy chain and human immunoglobulin heavy chain's constant region or its fragment; Albumen light chain comprises variable region of light chain and human normal immunoglobulin constant region of light chain or its fragment.

Human normal immunoglobulin constant region can be selected from various types of immunoglobulin (Ig)s, and preferred human immunoglobulin heavy chain's constant region or its fragment are γ type (IgG3), and aminoacid sequence is as shown in SED ID NO.2; Human normal immunoglobulin constant region of light chain or its fragment are κ type or λ type, and the aminoacid sequence of preferred human normal immunoglobulin constant region of light chain is as shown in SED ID NO.4.

Another object of the present invention is to provide the nucleic acid molecule of the above-mentioned anti-humen CD 20 humanized antibody of coding, wherein the nucleotides sequence of encoding heavy chain variable region is classified SEQ ID NO:9 as, the nucleotides sequence of encoded light chain variable region is classified SEQ ID NO:11 as, the nucleotides sequence of above-mentioned anti-humen CD 20 humanized antibody heavy chain of encoding is classified SEQ IDNO:5 as, the nucleotides sequence of coding light chain is classified SEQ ID NO:7 as, and the host who is transformed by this nucleic acid molecule is also contained in the present invention.

The present invention further provides the preparation method of the humanized antibody of above-mentioned anti-humen CD 20, comprise the aminoacid sequence that goes out humanized antibody hu8F6 by computer aided design (CAD), the heavy chain of the synthetic hu8F6 of full gene and chain variable region gene and through gene recombination respectively with human normal immunoglobulin weight, constant region of light chain gene splicing, be cloned in carrier for expression of eukaryon, build respectively the light of humanized antibody, heavy chain expression carrier, then will be light, liposome method cotransfection Chinese hamster ovary celI for heavy chain expression carrier, then screen, culture purified obtains the humanized antibody of anti-humen CD 20: hu8F6.

The antibody that utilization of the present invention obtains has carried out series of experiments, and exo-antigen shows that in conjunction with determination of activity result hu8F6 can be well and the Burkitt lymphoma cell line Raji specific binding of high expression level CD20.Competition suppresses experimental result and shows that hu8F6 has retained avidity and the specificity of former mouse source antibody, extracorporeal biology Function detection its have must biological function, the survival time that survival rate test shows to inject the mouse of hu8F6 group obtains significant prolongation, hu8F6 can be used for treating the lymphoma of high expression level CD20, preferred, hu8F6 can be used for the treatment of non-Hodgkin′s lymphomas.

Accompanying drawing explanation

Fig. 1: the molecular model of 8F6 antibody variable region: 8F6 antibody variable region shows with ribbon pattern, grey (light color) WeiFR district, black (dark color) WeiCDR district; CDR is the region of alterable height, directly the combination of mediate antibody and antigen; FR district is relatively conservative, maintains in the ，Ta Shi variable region, locus in ZheCDR district produce immunogenic main region as support; What mallet pattern showed is that distance C DR district is less than 5

11Ge FR district residue L3, L4, L36, L49 and H30, H48, H49H67, H71, H73, H78, they may affect the space conformation in CDR district.

Fig. 2: the comparison chart of the heavy chain of humanized antibody hu8F6 (Fig. 2-1) and light chain (Fig. 2-2) aminoacid sequence and correlated series, wherein 8F6VH and 8F6VL represent respectively the heavy chain of mouse resource monoclonal antibody 8F6 and the variable region of light chain; Select the variable region of heavy chain of human immunoglobulin heavy chain III subgroup and the variable region of light chain of people's antibody I g κ chain I subgroup respectively as the framework region of humanized antibody hu8F6 heavy chain and light chain; Hu8F6VHa and hu8F6VHb represent different humanized antibody variable region of heavy chain, and hu8F6VLa and hu8F6VLb represent respectively different humanized antibody variable region of light chain; Dash represents the amino acid identical with human immunoglobulin heavy chain III subgroup or the corresponding residue of Ig κ chain I subgroup, represents Shi CDR district in parantheses; The amino acid whose numbering according to Kabat is numbered [E.A.Kabat, T.T.Wu, H.M.Perry, K.S.Gottesman, C.Foeller, Sequences of Proteins of Immunological Interest, Fifth ed., United States Department of Health and Human Services, Bethesda, MD, 1991.];

The antigen-binding activity experimental result of the humanized antibody of Fig. 3: 8F6;

Fig. 4: competition suppresses experimental result;

Fig. 5: CDC experimental result, Fig. 5-1 pair Dauli cell, Fig. 5-2 pair Raji cell;

Fig. 6: the ADCC exercising result of antibody to Dauli and Raji cell, Fig. 6-1 pair Dauli cell, Fig. 6-2 pair Raji cell;

Fig. 7: antibody induction Dauli and Raji cell apoptosis assay result, Fig. 7-1 pair Dauli cell, Fig. 7-2 pair Raji cell;

Fig. 8: the survival rate curve of female BALB/C mice.

Embodiment

Following examples are only further described the present invention, should not be construed as limitation of the present invention

Raji (Human B lymphoma cell, ATCC, CCL-86)

PGEM-T carrier, U.S. Promega company product

PcDNA3.1 (+), American I nvitrogen company product

T4DNA ligase enzyme, American I nvitrogen company product

PcDNA3.1/ZEO (+) carrier, American I nvitrogen company product

COS-1 cell (ATCC CRL 1650)

CHO-K1 cell (ATCC CRL-9618)

PGEM-T easy carrier, U.S. Promega company product

Human myeloma IgG1 ，κ， Sigma company product

HRP-goat-anti people kappa, Southern Biotechnology Associates company product

Human IgG is the humanized antibody trastuzumab of anti-human her2, Roche company product

Rituximab, Roche company product

Daudi (Human B lymphoma cell, ATCC, CCL-213)

People's antibody is light, the clone of weight chain constant area gene

With lymphocyte separation medium (Ding Guo biotech development company product) separating health human lymphocyte, with Trizol reagent (Invitrogen company product), extract total RNA, according to document (Cell, 1980,22:197-207) and document (Nucleic Acids Research, 1982,10:4071-4079) sequence of report designs respectively primer and adopts RT-PCR reaction amplification heavy chain of antibody and constant region of light chain gene.PCR product reclaims and is cloned in pGEM-T carrier through agarose gel electrophoresis purifying, confirms to have obtained correct clone after sequence verification.SEQ ID NO:1 and SEQ ID NO:2 have shown respectively nucleotide sequence and the aminoacid sequence of CH (CH).SEQ ID NO:3 and SEQ ID NO:4 have shown respectively nucleotide sequence and the aminoacid sequence of constant region of light chain (CL).Correct clone in this example is denoted as pGEM-T/CH and pGEM-T/CL.

Preparation-cell fusion and hybridization knurl of embodiment 1 anti-humen CD 20 monoclone antibody 8F6 is prepared monoclonal antibody

Raji cellular immunization BALB/c mouse (purchased from purchased from Shanghai Experimental Animal Center) with high expression level CD20, make bone-marrow-derived lymphocyte in its spleen can produce the antibody of anti-humen CD 20, the splenocyte and the NS-1 (BALB/c mouse myeloma cell) that get the rear mouse of immunity merge, through HAT selectivity, cultivate, through cultivating, filter out anti-humen CD 20 positive colony, after cloning, filter out again subclone, to guarantee that antibody is to be produced by single clone cell, then collect single clone cell culture supernatant after Protein G column purification, just obtain the monoclonal antibody 8F6 of anti-humen CD 20.

The structure of embodiment 2 chimeric antibody c8F6

The clone of anti-humen CD 20 monoclonal antibody 8F6 variable region gene

By " Trizol Reagent " test kit (U.S. Gibco BRL company product) specification sheets, extract 2 * 10 ⁶total RNA of the hybridoma 8F6 of secretion anti-humen CD 20 monoclonal antibody.Select antibody (IgG3, κ) 3 gene-specific primer GSP1, GSP2, GSP3 are designed respectively in the appropriate location of heavy chain and constant region of light chain, wherein GSP1 distance variable district gene farthest, for reverse transcription reaction, GSP2 is for first run pcr amplification, and GSP3 is for nido amplification.Primer is synthetic by Shanghai Sheng Gong bio-engineering corporation, and sequence is as follows: GSP1-H, 5 '-GTA GAG GTC AGACTG CAG GAC-3 '; GSP2-H, 5 '-CTC AGG GAA ATA GCC CTT GAC-3 '; GSP3-H, 5 '-AGA TCC AGG GGC CAG TGG ATA GAC-3 ' .GSP1-L, 5 '-TTG CTGTCC TGA TCA GTC CAA CT-3 '; GSP2-L, 5 '-TGT CGT TCA CTG CCA TCAATC TT-3 '; GSP3-L, 5 '-TTG TTC AAG AAG CAC ACG ACT GA-3 '.

According to 5 ' RACE test kit (U.S. Gibco BRL company product) specification sheets, take GSP1 and total RNA reverse transcription is become to cDNA as primer, add poly (C) tail then to the 3 ' end of the first chain cDNA, after tailing, with GSP2 and AAP, be that primer carries out pcr amplification, 100 times of amplified production dilutions take to AUAP and GSP3 again and carry out nest-type PRC amplification as primer.Twice PCR reaction all adopts warm start, reaction conditions: 94 ℃ 5 minutes; 94 ℃ 45 seconds, 60 ℃ 45 seconds, 72 ℃ 1 minute 10 seconds, 30 circulations; 72 ℃ 7 minutes.Nest-type PRC product reclaims purifying object segment and is cloned in pGEM-T easy carrier after 1% agarose gel electrophoresis separation, and screening positive clone order-checking, analyzes sequencing result.Then with the correct pGEM-T/V that checks order _hfor template, design primer justice AAG CTT GCC GCC ACC ATG GAATGT AAC TGG ATA C and H antisense GCT AGC TGA GGA GAC GGT GAC TG, adopt Onestep RT-PCR reaction amplification VH chain variable region gene and make its 5 ' end contain restriction enzyme sites HindIII, 3 ' end contain restriction enzyme sites Nhe I, reaction conditions is: 50 ℃ 30 minutes; 95 ℃ 15 minutes; 94 ℃ 50 seconds, 58 ℃ 50 seconds, 72 ℃ 50 seconds, 30 circulations; 72 ℃ 10 minutes.Through agarose gel electrophoresis purifying, reclaim PCR product and be cloned in pGEM-T carrier (Promega company product), screening positive clone sequence verification, result proves that the sequence of this sequence and 5 ' RACE is in full accord.Correct clone in this example is denoted as pGEM-T/VH.

With the correct pGEM-T/V that checks order _lfor template, design primer L justice AAG CTT GCC GCCACC ATG GTT TTC ACA CCT CAG and L antisense TGG TGC AGC CAC AGT CCGTTT CAG GTC CAG adopt Onestep RT-PCR reaction amplification VL gene and make its 5 ' end contain restriction enzyme sites HindIII, 3 ' end contain human antibody light chain constant region 5 ' end complementary sequence, reaction conditions is: 94 ℃ 5 minutes; 94 ℃ 50 seconds, 58 ℃ 50 seconds, 72 ℃ 1 minute, 30 circulations; 72 ℃ 10 minutes.Through agarose gel electrophoresis purifying, reclaim PCR product and be cloned in pGEM-T carrier, screening positive clone sequence verification, result proves that the sequence of this sequence and 5 ' RACE is in full accord.Correct clone in this example is denoted as pGEM-T/VL.

Build chimeric antibody c8F6

By above-mentioned Onestep RT-PCR HindIII and the Nhe I double digestion for correct plasmid pGEM-T/VH that check order, the enzyme section of reclaiming the about 440bp of acquisition through agarose gel electrophoresis purifying is disconnected, plasmid pGEM-the T/CH cutting with same enzyme is connected, after selecting correct clone, with HindIII and EcoR I enzyme, cut, through agarose gel electrophoresis purifying, reclaim object fragment, the plasmid pcDNA3.1 (+) cutting with same enzyme is connected with T4DNA ligase enzyme, is built into carrier for expression of eukaryon pcDNA3.1 (+) (VHCH).

Adopt clone pGEM-T/VL that Overlapping PCR checks order correct by above-mentioned Onestep RT-PCR directly with the correct clone pGEM-T/CL fusion of constant region of light chain, reaction conditions is: 50 ℃ 30 minutes; 95 ℃ 15 minutes; 94 ℃ 50 seconds, 58 ℃ 50 seconds, 72 ℃ 50 seconds, 30 circulations; 72 ℃ 10 minutes, obtain PCR product VLCL, its 5 ' end contains restriction enzyme sites HindIII, 3 ' end contains restriction enzyme sites EcoR I.Through agarose gel electrophoresis purifying, reclaim PCR product and be cloned in pGEM-T carrier, screening positive clone order-checking.The VLCL gene that order-checking is correct cuts from pGEM-T carrier with HindIII and the two enzymic digestions of EcoR I, is cloned in pcDNA3.1/ZEO (+) carrier, is built into carrier for expression of eukaryon pcDNA3.1/ZEO (+) (VLCL).

In 3.5cm tissue culture ware, inoculate 3 * 10 ⁵cHO-K1 cell, cell cultures is carried out transfection when 90%-95% merges: (plasmid pcDNA3.1 (+) is 4 μ g (VHCH) to get plasmid 10 μ g, plasmid pcDNA3.1/ZEO (+) is 6 μ g (VLCL)) and 2 μ l Lipofectamine2000 Reagent (Invitrogen company product) be dissolved in respectively 500 μ l serum-free DMEM substratum, standing 5 minutes of room temperature, by above 2 kinds of liquid mixing, incubated at room 20 minutes is so that the formation of DNA-liposome complex, with the DMEM substratum of 3ml serum-free, replace the blood serum medium that contains in culture dish therebetween, then the DNA-liposome complex of formation is joined in plate, CO ₂incubator is cultivated after 4 hours and is added 2ml containing the DMEM perfect medium of 10% serum, is placed in CO ₂in incubator, continue to cultivate.After 24h is carried out in transfection, cell changes the selection Screening of Media resistance clone containing 600 μ g/ml G418 and 250 μ g/ml Zeocin.Get cells and supernatant and detect screening high-expression clone with ELISA: goat anti-human igg (Fc) is coated in elisa plate, 4 ℃ are spent the night, with 2%BSA-PBS, in 37 ℃ of sealing 2h, add resistance clone culture supernatant to be measured or standard substance (Human myeloma IgG1, κ, sigma), do 37 ℃ of incubation 2h, add HRP-goat anti-human igg (κ) source? carry out association reaction, 37 ℃ of incubation 1h, add TMB in 37 ℃ of effect 5min, finally use H ₂sO ₄termination reaction, surveys A ₄₅₀value.The high-expression clone that screening is obtained serum free medium enlarged culturing, with Protein A affinity column (GE company product) separation and purification chimeric antibody c8F6.Antibody purification is dialysed with PBS, finally with uv-absorbing standard measure.

The structure of embodiment 3 8F6 humanized antibodies

The homology mould of 8F6 monoclonal antibody variable region, mouse source (Fv) three-dimensional structure is built

Utilize the Insight II routine package of Accelrys company to simulate the three-dimensional structure of monoclonal antibody variable region, 8F6 mouse source.First, with blast program, in protein structure database (Protein Data Bank, PDB), search for respectively the template albumen of 8F6 heavy chain and variable region of light chain albumen.Choose the antibody that homology is the highest (PDBNO.2E27) and (PDB NO.1FH5) respectively as the mould modeling plate of 8F6 heavy chain and light chain, homology is respectively 84% and 94%, the three-dimensional structure of utilizing Insight II program mould to build out 8F6, as shown in Figure 1.

The design & formulation of 8F6 humanized antibody

Select respectively human immunoglobulin heavy chain III subgroup (heavy chain subgroupIII (humIII)) and Ig κ chain I subgroup (light chain k subgroup I (humkI)) respectively as 8F6 antibody weight, the humanization template of light chain. first we be grafted directly to the heavy chain of 8F6 and light chain CDR people from district respectively in From Template human immunoglobulin heavy chain III subgroup and Ig κ chain I subgroup, form CDR grafted antibody, heavy chain is hu8F6Ha, and light chain is hu8F6La.The variable region amino acid sequence of hu8F6Ha and hu8F6La as shown in Figure 2.The synthetic humanized antibody of full gene is heavy, chain variable region gene (hu8F6VHa and hu8F6VLa), then take hu8F6VHa gene and pGEM-T/CH carrier passes through the synthetic humanized antibody heavy chain gene of overlapping PCR as template, and reaction conditions is: 95 ℃ 15 minutes; 94 ℃ 50 seconds, 58 ℃ 50 seconds, 72 ℃ 50 seconds, 30 circulations; 72 ℃ 10 minutes.And making 5 of this humanization heavy chain gene ' end contain restriction enzyme sites HindIII and signal peptide gene sequence, 3 ' end contains translation stop codon TAA and restriction enzyme sites EcoR I.Signal peptide gene sequence:

ATGGAATGTAACTGGATACTTCCTTTTATTCTGTCAGTAACTTCAGGTGTCTACTCA。The separated pcr amplification product of last agarose gel electrophoresis, reclaims object band and is cloned in pGEMT carrier, screening positive clone order-checking.Selecting the correct clone of order-checking cuts with HindIII and EcoR I enzyme, through agarose gel electrophoresis purifying, reclaim humanized antibody heavy chain fragment hu8F6VHaCH, with with the plasmid pcDNA3.1 (+) that HindIII cuts with EcoR I enzyme, be connected, be built into humanization heavy chain carrier for expression of eukaryon pcDNA3.1 (+) (hu8F6VHaCH).

Take hu8F6VLa gene and pGEM-T/CL carrier passes through the synthetic humanized antibody light chain gene of overlapping PCR as template, and reaction conditions is: 95 ℃ 15 minutes; 94 ℃ 50 seconds, 58 ℃ 50 seconds, 72 ℃ 50 seconds, 30 circulations; 72 ℃ 10 minutes, obtain PCR product hu8F6VLaCL, its 5 ' end contains restriction enzyme sites HindIII and signal peptide gene sequence,, 3 ' end contains translation stop codon TAA and restriction enzyme sites EcoR I.Signal peptide gene sequence:

ATGGTTTTCACACCTCAGATACTTGGACTTATGCTTTTTTGGATTTCAGTCTCCAGAGGT。Selecting the correct clone of order-checking cuts with HindIII and EcoR I enzyme, through agarose gel electrophoresis purifying, reclaim humanized antibody light chain segments hu8F6VLaCL, with with plasmid pcDNA3.1/ZEO (+) carrier that HindIII cuts with EcoR I enzyme, be connected, be built into humanization light chain carrier for expression of eukaryon pcDNA3.1/ZEO (+) (hu8F6VLaCL).

In the tissue culturing plate of Yu24 hole, inoculate 0.8 * 10 ⁵the COS-1 cell in/hole, carries out transfection while being cultured to 90-95% degrees of fusion with the RPMI1640/DMEM mixed culture medium (16/DM substratum) of 10%FCS: get plasmid 1 μ g (light chain expression vector 0.6 μ g, heavy chain expression carrier 0.4 μ g) and 2 μ lLipofectamine2000 Reagent be dissolved in respectively 50 μ l serum-free 16/DM substratum, standing 5 minutes of room temperature, by above 2 kinds of liquid mixing, incubated at room 20 minutes is so that the formation of DNA-liposome complex, with the 16/DM substratum of 0.5ml serum-free, replace the blood serum medium that contains in 24 orifice plates therebetween, then the DNA-liposome complex of formation is joined in hole to CO ₂incubator is cultivated after 4 hours and is added 0.5ml containing the 16/DM substratum of 20%FCS, is placed in CO ₂in incubator, continue to cultivate, after 72 hours, get culture supernatant analysis, adopt ELISA to determine the content of antibody in culture supernatant: Goat anti-human IgG (Fc) is coated in elisa plate, 4 ℃ are spent the night, with 2%BSA-PBS, in 37 ℃, seal 2 hours, add culture supernatant to be measured and standard substance (Human myeloma IgG1, κ, sigma), hatch 2 hours for 37 ℃, add HRP-goatanti-human kappa, Southern Biotechnology Associates company product) carry out association reaction, hatch 1 hour for 37 ℃, add TMB in 37 ℃ of effects 5 minutes, finally use H ₂sO ₄termination reaction, surveys OD ₄₅₀value.

By the resuspended one-tenth 1 * 10 of 2%FCS-PBS for people Raji cell ⁶cells/ml, the COS-1 cells and supernatant that adds respectively different dilution transfection humanized antibodies, expression is placed on 4 ℃ and hatches 60min, with 2%FCS-PBS, wash cell 2 times, add again FITC-goat anti-human IgG (H+L) to hatch 60min in 4 ℃, wash the fluorescence intensity of analyzing and calculate cell after cell with FCM.Found that with c8F6 chimeric antibody and compare, the activity of the humanized antibody (hu8F6Ha/hu8F6La) that hu8F6Ha and hu8F6La form is almost completely lost (Fig. 3).Therefore,, in order to obtain the humanized antibody of high-affinity, we also need to analyze and reverse mutation affecting 8F6 antibody binding activity FR district mouse source residue.

By analyzing the three-dimensional structure (Fig. 1) of the 8F6 monoclonal antibody variable region that mould builds, we find CDR district 5 around

spatial dimension in may affect original antibody CDR conformation and from the different FR in corresponding position district residue You11Ge FR district residue L3 in people's From Template, L4, L36, L49 and H30, H48, H49H67, H71, H73, H78.These mouse source amino-acid residues are retained in the CDR grafted antibody of structure and can obtain humanized antibody (hu8F6Hb/hu8F6Lb).As shown in Figure 2, SEQ ID NO:9 and SEQ ID NO:10 have shown respectively nucleotide sequence and the aminoacid sequence of hu8F6Hb variable region of heavy chain to the variable region amino acid sequence of hu8F6Hb and hu8F6Lb.SEQ ID NO:11 and SEQ ID NO:12 have shown respectively nucleotide sequence and the aminoacid sequence of hu8F6Lb variable region of light chain.SEQ ID NO:5 and SEQ ID NO:6 have shown respectively nucleotide sequence and the aminoacid sequence of hu8F6Hb.SEQ ID NO:7 and SEQ ID NO:8 have shown respectively nucleotide sequence and the aminoacid sequence of hu8F6Lb.Three CDR region amino acid sequences of hu8F6Hb are respectively (can referring to the HU8F6VHb of Fig. 2-1): HCDR1 (NYWMQ), HCDR2 (AIYPGDGDTRYTQKFKG), HCDR3 (EGAYGYDDGMDY); Three CDR region amino acid sequences of hu8F6Lb are respectively (can referring to the HU8F6VLb of Fig. 2-2): LCDR1 (RASQSIRNNLH), LCDR2 (YASQSIS), LCDR3 (QQSNTWPLT).The method that adopts overlapping PCR is heavy, the chain variable region gene (hu8F6VHb/hu8F6VLb) of synthetic humanized antibody respectively, and by the method identical with humanized antibody (hu8F6Ha/hu8F6La) build light chain expression vector pcDNA3.1/ZEO (+) (hu8F6VLbCL) and heavy chain expression carrier pcDNA3.1 (+) (hu8F6VHbCH).Then by light, heavy expression vector cotransfection COS-1 cell, antigen-binding activity with Flow Cytometry Assay antibody, find that it is active similar to 8F6 chimeric antibody to the combination of Raji, by this humanized antibody (hu8F6Hb/hu8F6Lb) called after hu8F6.

Stably express and the purifying of embodiment 4 humanized antibodies

In 3.5cm tissue culture ware, inoculate 3 * 10 ⁵cHO-K1 cell, cell cultures is carried out transfection when 90%-95% merges: (plasmid pcDNA3.1 (+) is 4 μ g (hu8F6VHbCH) to get plasmid 10 μ g, plasmid pcDNA3.1/ZEO (+) is 6 μ g (hu8F6VLbCL)) and 2 μ lLipofectamine2000 Reagent (Invitrogen company product) be dissolved in respectively 500 μ l serum-free DMEM substratum, standing 5 minutes of room temperature, by above 2 kinds of liquid mixing, incubated at room 20 minutes is so that the formation of DNA-liposome complex, with the DMEM substratum of 3ml serum-free, replace the blood serum medium that contains in culture dish therebetween, then the DNA-liposome complex of formation is joined in plate, CO ₂incubator is cultivated after 4 hours and is added 2ml containing the DMEM perfect medium of 10% serum, is placed in CO ₂in incubator, continue to cultivate.After 24h is carried out in transfection, cell changes the selection Screening of Media resistance clone containing 600 μ g/ml G418 and 250 μ g/ml Zeocin.Get cells and supernatant and detect screening high-expression clone with ELISA: goat anti-human igg (Fc) is coated in elisa plate, 4 ℃ are spent the night, with 2%BSA-PBS, in 37 ℃, seal 2h, add resistance clone culture supernatant to be measured or standard substance (Human myeloma IgG1, κ), 37 ℃ of incubation 2h, add HRP-goat-anti people kappa to carry out association reaction, 37 ℃ of incubation 1h, add TMB in 37 ℃ of effect 5min, finally use H ₂sO ₄termination reaction, surveys A450 value.The high-expression clone that screening is obtained serum free medium enlarged culturing, with Protein A affinity column (GE company product) separation and purification humanized antibody hu8F6.Antibody purification is dialysed with PBS, finally with uv-absorbing standard measure.

Embodiment 5 competitions suppress experiment

With dialysis labelling method traget antibody: with the carbonate buffer solution of 0.025M pH9.5, the antibody 8F6 of preliminary making is diluted to 1% concentration, packs in dialysis tubing.With the solution that same damping fluid is made into 0.1mg/ml by FITC, be contained in small beaker, dialysis tubing is immersed in FITC solution, 4 ℃ of lucifuges, stir 24h.Take out marking fluid in dialysis tubing, with Sephadex G-50, cross post, remove free fluorescein, collect fluorescence antibody FITC-8F6 standby.After being mixed respectively, the unmarked antibody purification of the fluorescent-labeled antibody FITC-8F6 of fixing sub-saturated concentration and serial dilution joins target cell Raja (1 * 10 ⁶/ ml) in, hatch 60min for 4 ℃, 1%FCS-PBS washes cell 2 times, and flow cytometer detects and use Cellquest software analysis.Human IgG in contrast.Each concentration of competition antibody is established 3 multiple pipes, calculation of half inhibitory concentration IC ₅₀value, maximum fluorescence intensity is illustrated in the average fluorescent strength obtaining while not competing antibody.

Experimental result is shown in Fig. 4, and result shows that antibody hu8F6 can block the combination of fluorescent-labeled antibody FITC-8F6 and Raja cell, their IC completely ₅₀value approaches, and shows that humanized antibody has specificity and the avidity similar to former mouse source antibody.

Cell killing (CDC) experiment of embodiment 6 complement-mediated

After collecting cell, with washing twice without phenol red RPMI RPMI-1640, be resuspended in without phenol red RPMI RPMI-1640, adjust cell density to 1 * 10 ⁶/ ml, adds 96 porocyte culture plates by 100 μ l/ holes by cell suspension.With without phenol red RPMI1640 nutrient solution by rituximab and c8F6, hu8F6 is diluted to respectively 100 μ g/ml, 20 μ g/ml, 4 μ g/ml, 0.8 μ g/ml and 0.16 μ g/ml, 1%Triton-X 100 is as positive control, human IgG is as irrelevant antibody control, PBS is as negative control, and blank nutrient solution is as blank.Then the antibody sample having diluted and contrast are added to above-mentioned 96 porocyte culture plates, 20 μ l/ holes add Freshman serum in the ratio of 50 μ l/ml cell suspensions simultaneously, supplement without phenol red RPMI1640 nutrient solution to cumulative volume 200 μ l/ holes.Establish 3 multiple holes, CO2 incubator effect 4 hours for every group above.After 4 hours, by centrifugal 5 minutes of 96 porocyte culture plate 200g, 50 μ l supernatants were drawn to another 96 orifice plate respective aperture in every hole.According to the CytoTox of Promega company

method in heterotope method cell killing detection kit adds in nitrite ion 50 μ l//hole to 96 orifice plates that mix, room temperature, lucifuge effect 30 minutes.Microplate reader is read the absorbance value of 490nm.

Experimental result is shown in Fig. 5, test-results shows: in the cell strain Daudi of CD20 high expression level (ATCC) and Raji, it is active that c8F6 and hu8F6 have had very strong CDC, kills and wounds intensity the strongest when the concentration of 10 μ g/ml, and the CDC effect of c8F6 and hu8F6 is all better than Rituximab; And control antibodies human IgG can not induce the CDC effect of Dauli cell.

Cytotoxicity (ADCC) experiment of embodiment 7 antibody-dependant cell mediations

The separation of peripheral blood mononuclear cell (PBMC)

Aseptic collection venous blood, injects the centrifuge tube that contains heparin 20U/ml, mixes gently.In Biohazard Safety Equipment, with aseptic straw, add equal-volume PBS solution, make hemodilution to improve separating effect.Get 15ml centrifuge tube, every pipe adds the lymphocyte separation medium of 6ml room temperature, and inclination centrifuge tube slowly adds the anticoagulation cirumferential blood 6ml/ pipe after dilution along tube wall.Action is soft, with tamper-proof interface.20 ℃, the centrifugal 30min of 800g.Brake is closed to natural reduction of speed.In pipe, be divided into three layers, be followed successively by from top to bottom plasma layer, cellular segregation liquid, red corpuscle and GCL.The white layer of plasma layer and cellular segregation liquid intersection ground-glass-like is lymphocyte and mononuclear cell layer.With suction pipe, insert gently ground-glass-like layer, slowly sucking-off peripheral blood mononuclear cell, puts into another 15ml centrifuge tube.In the cell of sucking-off, add PBS dilution rear centrifugal, 200g, centrifugal 5min, washes 2 times altogether.With adjusting cell density without phenol red RPMI-1640 nutrient solution, be 6 * 106/ml, be suspended from 15ml centrifuge tube, add the IL-2 preactivate of 160U/ml, be placed in 37 ℃, 5%CO2 cell culture incubator is standby.

The preparation of target cell suspension

The cell suspension of logarithmic phase is drawn in 15ml centrifuge tube, 200g, and centrifugal 5min, supernatant discarded, washes 2 times with PBS, without phenol red RPMI-1640 re-suspended cell, counting, adjusting cell density is 3 * 10 ⁵/ ml is standby.

The effect of cell and antibody

Set substratum background hole, the spontaneous releasing value of effector cell+target cell hole, the maximum releasing value hole of effector cell+target cell and experimental port, every kind of situation is all established 3 parallel holes, with without phenol red RPMI-1640 substratum by c8F6, hu8F6 is diluted to concentration and is respectively 100 μ g/ml, 20 μ g/ml, 4 μ g/ml, 0.8 μ g/ml and 0.16 μ g/ml, every pipe adds the target cell of adjusting cell density, after 4 ℃ of effect 30min, the centrifugal 5min of 200g, PBS washes 2 times, be suspended from 300 μ l without phenol red RPMI1640 nutrient solution, cell suspension after above-mentioned and antibody effect is added in 96 orifice plates, 100 μ l/ holes, add effector cell 100 μ l/ holes, effect with 40: 1, target ratio adds in 96 orifice plates, 37 ℃, after 5%CO2 cell culture incubator 12h～24h, develop the color.

Colour developing, reading

By after the centrifugal 5min of 96 orifice plate 200g, 50 μ l supernatants are drawn to another 96 orifice plate respective aperture, according to the CytoTox of Promega company in every hole

method in heterotope method cell killing detection kit adds in nitrite ion 50 μ l//hole to 96 orifice plates that mix, room temperature, and lucifuge effect 30min, microplate reader is read the absorbance value of 490nm.

Experimental result is shown in Fig. 6, and test-results shows, c8F6 and hu8F6 when lower concentration to do the used time not obvious, when the concentration of 10 μ g/ml, can cause obvious ADCC effect. and control antibodies human IgG can not induce the ADCC effect of Raji.The ADCC effect of c8F6 and hu8F6 is compared without significant difference with Rituximab.

Embodiment 8 cell apoptosis assays

In 96 well culture plates, add the cell that number is equal, 5 * 10 ⁵/ hole, antibody is added in respective fine hilum with the final concentration of 10 μ g/ml, 2 μ g/ml, 0.4 μ g/ml and 0.08 μ g/ml respectively, after 37 ℃ of effect 18～24h, add 5 μ l Annexin V-FITC, mix gently room temperature, lucifuge reaction 15min, the resuspended rear upper machine of PBS, flow cytometer detects the dyeing situation of analyzing.Negative control is PBS, and irrelevant antibody control is HumanIgG.

Experimental result is shown in Fig. 7, and test-results shows, c8F6 and hu8F6 when lower concentration to do the used time not obvious, when the concentration of 10 μ g/ml, can cause a certain amount of apoptosis. and control antibodies human IgG can not induce Dauli apoptosis.The apoptotic effect of c8F6 and hu8F6 is compared without significant difference with Rituximab.

Embodiment 9 survival rate experiments

With 3.5 * 10 ⁶raji cell tail vein injection immunity female BALB/C mice in 8-10 age in week, inoculated tumour cell, after five days, is injected 100 μ g associated antibodies (hu8F6, Rituximab, human IgG), observes the existing state of mouse every day.

Experimental result is shown in Fig. 8, and test-results shows: under Isodose, compare with the mouse of injection rituximab, the survival time of injection of antibodies c8F6 and hu8F6 group mouse has obtained significant prolongation (P < 0.05).

Sequence table

<110> Antibodies National Engineering Research Center

<120> anti-humen CD 20 humanized antibody, Preparation Method And The Use

<130>human?antimouse?antibody?response(HAMA)[Winter?G，Harris?WJ.

Humanized?antibodies.Immunol?Today.1993?Jun；14(6)：243-6]

<160>12

<170>PatentIn?version?3.2

<210>1

<211>990

<212>DNA

The nucleotide sequence of <213> human antibody heavy chain constant region (CH)

<400>1

gctagcacca?agggcccatc?ggtcttcccc?ctggcaccct?cctccaagag?cacctctggg 60

ggcacagcgg?ccctgggctg?cctggtcaag?gactacttcc?ccgaaccggt?gacggtgtcg 120

tggaactcag?gcgccctgac?cagcggcgtg?cacaccttcc?cggctgtcct?acagtcctca 180

ggactctact?ccctcagcag?cgtggtgacc?gtgccctcca?gcagcttggg?cacccagacc 240

tacatctgca?acgtgaatca?caagcccagc?aacaccaagg?tggacaagaa?agttgagccc 300

aaatcttgtg?acaaaactca?cacatgccca?ccgtgcccag?cacctgaact?cctgggggga 360

ccgtcagtct?tcctcttccc?cccaaaaccc?aaggacaccc?tcatgatctc?ccggacccct 420

gaggtcacat?gcgtggtggt?ggacgtgagc?cacgaagacc?ctgaggtcaa?gttcaactgg 480

tacgtggacg?gcgtggaggt?gcataatgcc?aagacaaagc?cgcgggaaga?gcagtacaac 540

agcacgtacc?gtgtggtcag?cgtcctcacc?gtcctgcacc?aggactggct?gaatggcaag 600

gagtacaagt?gcaaggtctc?caacaaagcc?ctcccagccc?ccatcgagaa?aaccatctcc 660

aaagccaaag?ggcagccccg?agaaccacag?gtgtacaccc?tgcccccatc?ccgggatgag 720

ctgaccaaga?accaggtcag?cctgacctgc?ctggtcaaag?gcttctatcc?cagcgacatc 780

gccgtggagt?gggagagcaa?tgggcagccg?gagaacaact?acaagaccac?gcctcccgtg 840

ctggactccg?acggctcctt?cttcctctac?agcaagctca?ccgtggacaa?gagcaggtgg 900

cagcagggga?acgtcttctc?atgctccgtg?atgcatgagg?ctctgcacaa?ccactacacg 960

cagaagagcc?tctccctgtc?tcccggtaaa 990

<210>2

<211>330

<212>PRT

The aminoacid sequence of <213> human antibody heavy chain constant region (CH)

<400>2

Ala?Ser?Thr?Lys?Gly?Pro?Ser?Val?Phe?Pro?Leu?Ala?Pro?Ser?Ser?Lys

1 5 10 15

Ser?Thr?Ser?Gly?Gly?Thr?Ala?Ala?Leu?Gly?Cys?Leu?Val?Lys?Asp?Tyr

20 25 30

Phe?Pro?Glu?Pro?Val?Thr?Val?Ser?Trp?Asn?Ser?Gly?Ala?Leu?Thr?Ser

35 40 45

Gly?Val?His?Thr?Phe?Pro?Ala?Val?Leu?Gln?Ser?Ser?Gly?Leu?Tyr?Ser

50 55 60

Leu?Ser?Ser?Val?Val?Thr?Val?Pro?Ser?Ser?Ser?Leu?Gly?Thr?Gln?Thr

65 70 75 80

Tyr?Ile?Cys?Asn?Val?Asn?His?Lys?Pro?Ser?Asn?Thr?Lys?Val?Asp?Lys

85 90 95

Lys?Val?Glu?Pro?Lys?Ser?Cys?Asp?Lys?Thr?His?Thr?Cys?Pro?Pro?Cys

100 105 110

Pro?Ala?Pro?Glu?Leu?Leu?Gly?Gly?Pro?Ser?Val?Phe?Leu?Phe?Pro?Pro

115 120 125

Lys?Pro?Lys?Asp?Thr?Leu?Met?Ile?Ser?Arg?Thr?Pro?Glu?Val?Thr?Cys

130 135 140

Val?Val?Val?Asp?Val?Ser?His?Glu?Asp?Pro?Glu?Val?Lys?Phe?Asn?Trp

145 150 155 160

Tyr?Val?Asp?Gly?Val?Glu?Val?His?Asn?Ala?Lys?Thr?Lys?Pro?Arg?Glu

165 170 175

Glu?Gln?Tyr?Asn?Ser?Thr?Tyr?Arg?Val?Val?Ser?Val?Leu?Thr?Val?Leu

180 185 190

His?Gln?Asp?Trp?Leu?Asn?Gly?Lys?Glu?Tyr?Lys?Cys?Lys?Val?Ser?Asn

195 200 205

Lys?Ala?Leu?Pro?Ala?Pro?Ile?Glu?Lys?Thr?Ile?Ser?Lys?Ala?Lys?Gly

210 215 220

Gln?Pro?Arg?Glu?Pro?Gln?Val?Tyr?Thr?Leu?Pro?Pro?Ser?Arg?Asp?Glu

225 230 235 240

Leu?Thr?Lys?Asn?Gln?Val?Ser?Leu?Thr?Cys?Leu?Val?Lys?Gly?Phe?Tyr

245 250 255

Pro?Ser?Asp?Ile?Ala?Val?Glu?Trp?Glu?Ser?Asn?Gly?Gln?Pro?Glu?Asn

260 265 270

Asn?Tyr?Lys?Thr?Thr?Pro?Pro?Val?Leu?Asp?Ser?Asp?Gly?Ser?Phe?Phe

275 280 285

Leu?Tyr?Ser?Lys?Leu?Thr?Val?Asp?Lys?Ser?Arg?Trp?Gln?Gln?Gly?Asn

290 295 300

Val?Phe?Ser?Cys?Ser?Val?Met?His?Glu?Ala?Leu?His?Asn?His?Tyr?Thr

305 310 315 320

Gln?Lys?Ser?Leu?Ser?Leu?Ser?Pro?Gly?Lys

325 330

<210>3

<211>318

<212>DNA

The nucleotide sequence of <213> human antibody light chain constant region (CL)

<400>3

actgtggctg?caccatctgt?cttcatcttc?ccgccatctg?atgagcagtt?gaaatctgga 60

actgcctctg?ttgtgtgcct?gctgaataac?ttctatccca?gagaggccaa?agtacagtgg 120

aaggtggata?acgccctcca?atcgggtaac?tcccaggaga?gtgtcacaga?gcaggacagc 180

aaggacagca?cctacagcct?cagcagcacc?ctgacgctga?gcaaagcaga?ctacgagaaa 240

cacaaagtct?acgcctgcga?agtcacccat?cagggcctga?gctcgcccgt?cacaaagagc 300

ttcaacaggg?gagagtgt 318

<210>4

<211>106

<212>PRT

The aminoacid sequence of <213> human antibody light chain constant region (CL)

<400>4

Thr?Val?Ala?Ala?Pro?Ser?Val?Phe?Ile?Phe?Pro?Pro?Ser?Asp?Glu?Gln

1 5 10 15

Leu?Lys?Ser?Gly?Thr?Ala?Ser?Val?Val?Cys?Leu?Leu?Asn?Asn?Phe?Tyr

20 25 30

Pro?Arg?Glu?Ala?Lys?Val?Gln?Trp?Lys?Val?Asp?Asn?Ala?Leu?Gln?Ser

35 40 45

Gly?Asn?Ser?Gln?Glu?Ser?Val?Thr?Glu?Gln?Asp?Ser?Lys?Asp?Ser?Thr

50 55 60

Tyr?Ser?Leu?Ser?Ser?Thr?Leu?Thr?Leu?Ser?Lys?Ala?Asp?Tyr?Glu?Lys

65 70 75 80

His?Lys?Val?Tyr?Ala?Cys?Glu?Val?Thr?His?Gln?Gly?Leu?Ser?Ser?Pro

85 90 95

Val?Thr?Lys?Ser?Phe?Asn?Arg?Gly?Glu?Cys

100 105

<210>5

<211>1353

<212>DNA

<213> humanized antibody h8F6 heavy chain nucleotide sequence

<400>5

gaggtgcagc?tcgttgagag?tggcggcggc?ctcgttcaac?ctggcggcag?tctccgcctg 60

agttgcgctg?cttctggatt?tacttttacc?aattattgga?tgcaatgggt?tcgccaggct 120

cctggaaaag?gattagaatg?gattggagct?atttatcccg?gggatgggga?tacccgatac 180

acacagaagt?tcaaggggcg?ggccacaatc?tctgccgaca?agtccaagaa?cacggcctac 240

ttgcagatga?actcattgcg?ggcagaagac?acggcagtct?actactgtgc?gcgcgaaggg 300

gcgtacggtt?acgatgatgg?tatggactat?tggggtcaag?gtactcttgt?cactgtctcg 360

tcggctagca?ccaagggccc?atcggtcttc?cccctggcac?cctcctccaa?gagcacctct 420

gggggcacag?cggccctggg?ctgcctggtc?aaggactact?tccccgaacc?ggtgacggtg 480

tcgtggaact?caggcgccct?gaccagcggc?gtgcacacct?tcccggctgt?cctacagtcc 540

tcaggactct?actccctcag?cagcgtggtg?accgtgccct?ccagcagctt?gggcacccag 600

acctacatct?gcaacgtgaa?tcacaagccc?agcaacacca?aggtggacaa?gaaagttgag 660

cccaaatctt?gtgacaaaac?tcacacatgc?ccaccgtgcc?cagcacctga?actcctgggg 720

ggaccgtcag?tcttcctctt?ccccccaaaa?cccaaggaca?ccctcatgat?ctcccggacc 780

cctgaggtca?catgcgtggt?ggtggacgtg?agccacgaag?accctgaggt?caagttcaac 840

tggtacgtgg?acggcgtgga?ggtgcataat?gccaagacaa?agccgcggga?agagcagtac 900

aacagcacgt?accgtgtggt?cagcgtcctc?accgtcctgc?accaggactg?gctgaatggc 960

aaggagtaca?agtgcaaggt?ctccaacaaa?gccctcccag?cccccatcga?gaaaaccatc 1020

tccaaagcca?aagggcagcc?ccgagaacca?caggtgtaca?ccctgccccc?atcccgggat 1080

gagctgacca?agaaccaggt?cagcctgacc?tgcctggtca?aaggcttcta?tcccagcgac 1140

atcgccgtgg?agtgggagag?caatgggcag?ccggagaaca?actacaagac?cacgcctccc 1200

gtgctggact?ccgacggctc?cttcttcctc?tacagcaagc?tcaccgtgga?caagagcagg 1260

tggcagcagg?ggaacgtctt?ctcatgctcc?gtgatgcatg?aggctctgca?caaccactac 1320

acgcagaaga?gcctctccct?gtctcccggt?aaa 1353

<210>6

<211>451

<212>PRT

<213> humanized antibody h8F6 heavy chain amino acid sequence

<400>6

Glu?Val?Gln?Leu?Val?Glu?Ser?Gly?Gly?Gly?Leu?Val?Gln?Pro?Gly?Gly

1 5 10 15

Ser?Leu?Arg?Leu?Ser?Cys?Ala?Ala?Ser?Gly?Phe?Thr?Phe?Thr?Asn?Tyr

20 25 30

Trp?Met?Gln?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Ile

35 40 45

Gly?Ala?Ile?Tyr?Pro?Gly?Asp?Gly?Asp?Thr?Arg?Tyr?Thr?Gln?Lys?Phe

50 55 60

Lys?Gly?Arg?Ala?Thr?Ile?Ser?Ala?Asp?Lys?Ser?Lys?Asn?Thr?Ala?Tyr

65 70 75 80

Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

Ala?Arg?Glu?Gly?Ala?Tyr?Gly?Tyr?Asp?Asp?Gly?Met?Asp?Tyr?Trp?Gly

100 105 110

Gln?Gly?Thr?Leu?Val?Thr?Val?Ser?Ser?Ala?Ser?Thr?Lys?Gly?Pro?Ser

115 120 125

Val?Phe?Pro?Leu?Ala?Pro?Ser?Ser?Lys?Ser?Thr?Ser?Gly?Gly?Thr?Ala

130 135 140

Ala?Leu?Gly?Cys?Leu?Val?Lys?Asp?Tyr?Phe?Pro?Glu?Pro?Val?Thr?Val

145 150 155 160

Ser?Trp?Asn?Ser?Gly?Ala?Leu?Thr?Ser?Gly?Val?His?Thr?Phe?Pro?Ala

165 170 175

Val?Leu?Gln?Ser?Ser?Gly?Leu?Tyr?Ser?Leu?Ser?Ser?Val?Val?Thr?Val

180 185 190

Pro?Ser?Ser?Ser?Leu?Gly?Thr?Gln?Thr?Tyr?Ile?Cys?Asn?Val?Asn?His

195 200 205

Lys?Pro?Ser?Asn?Thr?Lys?Val?Asp?Lys?Lys?Val?Glu?Pro?Lys?Ser?Cys

210 215 220

Asp?Lys?Thr?His?Thr?Cys?Pro?Pro?Cys?Pro?Ala?Pro?Glu?Leu?Leu?Gly

225 230 235 240

Gly?Pro?Ser?Val?Phe?Leu?Phe?Pro?Pro?Lys?Pro?Lys?Asp?Thr?Leu?Met

245 250 255

Ile?Ser?Arg?Thr?Pro?Glu?Val?Thr?Cys?Val?Val?Val?Asp?Val?Ser?His

260 265 270

Glu?Asp?Pro?Glu?Val?Lys?Phe?Asn?Trp?Tyr?Val?Asp?Gly?Val?Glu?Val

275 280 285

His?Asn?Ala?Lys?Thr?Lys?Pro?Arg?Glu?Glu?Gln?Tyr?Asn?Ser?Thr?Tyr

290 295 300

Arg?Val?Val?Ser?Val?Leu?Thr?Val?Leu?His?Gln?Asp?Trp?Leu?Asn?Gly

305 310 315 320

Lys?Glu?Tyr?Lys?Cys?Lys?Val?Ser?Asn?Lys?Ala?Leu?Pro?Ala?Pro?Ile

325 330 335

Glu?Lys?Thr?Ile?Ser?Lys?Ala?Lys?Gly?Gln?Pro?Arg?Glu?Pro?Gln?Val

340 345 350

Tyr?Thr?Leu?Pro?Pro?Ser?Arg?Asp?Glu?Leu?Thr?Lys?Asn?Gln?Val?Ser

355 360 365

Leu?Thr?Cys?Leu?Val?Lys?Gly?Phe?Tyr?Pro?Ser?Asp?Ile?Ala?Val?Glu

370 375 380

Trp?Glu?Ser?Asn?Gly?Gln?Pro?Glu?Asn?Asn?Tyr?Lys?Thr?Thr?Pro?Pro

385 390 395 400

Val?Leu?Asp?Ser?Asp?Gly?Ser?Phe?Phe?Leu?Tyr?Ser?Lys?Leu?Thr?Val

405 410 415

Asp?Lys?Ser?Arg?Trp?Gln?Gln?Gly?Asn?Val?Phe?Ser?Cys?Ser?Val?Met

420 425 430

His?Glu?Ala?Leu?His?Asn?His?Tyr?Thr?Gln?Lys?Ser?Leu?Ser?Leu?Ser

435 440 445

Pro?Gly?Lys

450

<210>7

<211>642

<212>DNA

<213> humanized antibody h8F6 light chain nucleotide sequence

<400>7

gacatcgtac?ttacccaaag?tcccagtagc?ctcagcgcga?gtgtaggtga?ccgcgtgacc 60

atcacctgcc?gcgcgagtca?aagcatcaga?aacaatctcc?attggttcca?acagaagcca 120

ggtaaggctc?caaaactcct?cataaaatat?gccagccaga?gcatatctgg?cgtgccgtct 180

agattctctg?gctccggctc?cggcacagac?ttcacactaa?cgatatcctc?cctacagcct 240

gaggactttg?ctacgtatta?ttgccaacaa?tcaaatacgt?ggcctctgac?ttttggccag 300

ggcactaagg?tggagattaa?gaggactgtg?gctgcaccat?ctgtcttcat?cttcccgcca 360

tctgatgagc?agttgaaatc?tggaactgcc?tctgttgtgt?gcctgctgaa?taacttctat 420

cccagagagg?ccaaagtaca?gtggaaggtg?gataacgccc?tccaatcggg?taactcccag 480

gagagtgtca?cagagcagga?cagcaaggac?agcacctaca?gcctcagcag?caccctgacg 540

ctgagcaaag?cagactacga?gaaacacaaa?gtctacgcct?gcgaagtcac?ccatcagggc 600

ctgagctcgc?ccgtcacaaa?gagcttcaac?aggggagagt?gt 642

<210>8

<211>214

<212>PRT

<213> humanized antibody h8F6 light-chain amino acid sequence

<400>8

Asp?Ile?Val?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Leu?Ser?Ala?Ser?Val?Gly

1 5 10 15

Asp?Arg?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Ser?Ile?Arg?Asn?Asn

20 25 30

Leu?His?Trp?Phe?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

Lys?Tyr?Ala?Ser?Gln?Ser?Ile?Ser?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Gln?Pro

65 70 75 80

Glu?Asp?Phe?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Ser?Asn?Thr?Trp?Pro?Leu

85 90 95

Thr?Phe?Gly?Gln?Gly?Thr?Lys?Val?Glu?Ile?Lys?Arg?Thr?Val?Ala?Ala

100 105 110

Pro?Ser?Val?Phe?Ile?Phe?Pro?Pro?Ser?Asp?Glu?Gln?Leu?Lys?Ser?Gly

115 120 125

Thr?Ala?Ser?Val?Val?Cys?Leu?Leu?Asn?Asn?Phe?Tyr?Pro?Arg?Glu?Ala

130 135 140

Lys?Val?Gln?Trp?Lys?Val?Asp?Asn?Ala?Leu?Gln?Ser?Gly?Asn?Ser?Gln

145 150 155 160

Glu?Ser?Val?Thr?Glu?Gln?Asp?Ser?Lys?Asp?Ser?Thr?Tyr?Ser?Leu?Ser

165 170 175

Ser?Thr?Leu?Thr?Leu?Ser?Lys?Ala?Asp?Tyr?Glu?Lys?His?Lys?Val?Tyr

180 185 190

Ala?Cys?Glu?Val?Thr?His?Gln?Gly?Leu?Ser?Ser?Pro?Val?Thr?Lys?Ser

195 200 205

Phe?Asn?Arg?Gly?Glu?Cys

210

<210>9

<211>363

<212>DNA

<213> humanized antibody h8F6 weight chain variable region nucleotide sequence

<400>9

gaggtgcagc?tcgttgagag?tggcggcggc?ctcgttcaac?ctggcggcag?tctccgcctg 60

agttgcgctg?cttctggatt?tacttttacc?aattattgga?tgcaatgggt?tcgccaggct 120

cctggaaaag?gattagaatg?gattggagct?atttatcccg?gggatgggga?tacccgatac 180

acacagaagt?tcaaggggcg?ggccacaatc?tctgccgaca?agtccaagaa?cacggcctac 240

ttgcagatga?actcattgcg?ggcagaagac?acggcagtct?actactgtgc?gcgcgaaggg 300

gcgtacggtt?acgatgatgg?tatggactat?tggggtcaag?gtactcttgt?cactgtctcg 360

tcg 363

<210>10

<211>121

<212>PRT

<213> humanized antibody h8F6 weight chain variable region amino acid sequence

<400>10

Glu?Val?Gln?Leu?Val?Glu?Ser?Gly?Gly?Gly?Leu?Val?Gln?Pro?Gly?Gly

1 5 10 15

Ser?Leu?Arg?Leu?Ser?Cys?Ala?Ala?Ser?Gly?Phe?Thr?Phe?Thr?Asn?Tyr

20 25 30

Trp?Met?Gln?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Ile

35 40 45

Gly?Ala?Ile?Tyr?Pro?Gly?Asp?Gly?Asp?Thr?Arg?Tyr?Thr?Gln?Lys?Phe

50 55 60

Lys?Gly?Arg?Ala?Thr?Ile?Ser?Ala?Asp?Lys?Ser?Lys?Asn?Thr?Ala?Tyr

65 70 75 80

Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

Ala?Arg?Glu?Gly?Ala?Tyr?Gly?Tyr?Asp?Asp?Gly?Met?Asp?Tyr?Trp?Gly

100 105 110

Gln?Gly?Thr?Leu?Val?Thr?Val?Ser?Ser

115 120

<210>11

<211>324

<212>DNA

<213> humanized antibody h8F6 light chain variable region nucleotide sequence

<400>11

gacatcgtac?ttacccaaag?tcccagtagc?ctcagcgcga?gtgtaggtga?ccgcgtgacc 60

atcacctgcc?gcgcgagtca?aagcatcaga?aacaatctcc?attggttcca?acagaagcca 120

ggtaaggctc?caaaactcct?cataaaatat?gccagccaga?gcatatctgg?cgtgccgtct 180

agattctctg?gctccggctc?cggcacagac?ttcacactaa?cgatatcctc?cctacagcct 240

gaggactttg?ctacgtatta?ttgccaacaa?tcaaatacgt?ggcctctgac?ttttggccag 300

ggcactaagg?tggagattaa?gagg 324

<210>12

<211>108

<212>PRT

<213> humanized antibody h8F6 light chain variable region amino acid sequence

<400>12

Asp?Ile?Val?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Leu?Ser?Ala?Ser?Val?Gly

1 5 10 15

Asp?Arg?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Ser?Ile?Arg?Asn?Asn

20 25 30

Leu?His?Trp?Phe?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

Lys?Tyr?Ala?Ser?Gln?Ser?Ile?Ser?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Gln?Pro

65 70 75 80

Glu?Asp?Phe?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Ser?Asn?Thr?Trp?Pro?Leu

85 90 95

Thr?Phe?Gly?Gln?Gly?Thr?Lys?Val?Glu?Ile?Lys?Arg

100 105

Claims (8)

1. an anti-humen CD 20 humanized antibody, its weight chain variable region amino acid sequence is SEQ ID NO:10, light chain variable region amino acid sequence is SEQ ID NO:12.

2. anti-humen CD 20 humanized antibody claimed in claim 1, its heavy chain amino acid sequence is SEQ ID NO:6, light-chain amino acid sequence is SEQ ID NO:8.

3. a nucleic acid molecule, the arbitrary described anti-humen CD 20 humanized antibody of coding claim 1～2.

4. nucleic acid molecule claimed in claim 3, wherein the nucleotides sequence of encoding heavy chain variable region is classified SEQ ID NO:9 as, and the nucleotides sequence of encoded light chain variable region is classified SEQ ID NO:11 as.

5. nucleic acid molecule claimed in claim 4, wherein the nucleotides sequence of encoding heavy chain is classified SEQ ID NO:5 as, and the nucleotides sequence of coding light chain is classified SEQ ID NO:7 as.

6. the preparation method of the humanized antibody of the arbitrary described anti-humen CD 20 of claim 1～2, comprise the aminoacid sequence that goes out humanized antibody by computer aided design (CAD), the heavy chain that full gene is synthetic and chain variable region gene through gene recombination, constant region of light chain gene splicing heavy with human normal immunoglobulin respectively, be cloned in carrier for expression of eukaryon, build respectively light, the heavy chain expression carrier of humanized antibody, then will be light, liposome method cotransfection Chinese hamster ovary celI for heavy chain expression carrier, then screen, culture purified and get final product.

7. the purposes of the humanized antibody of the arbitrary described anti-humen CD 20 of claim 1～2 in the lymphoid tumor medicament of preparation treatment high expression level CD20.

8. purposes claimed in claim 7, wherein the lymphoma of high expression level CD20 is non-Hodgkin′s lymphomas.

Images