CN108467903A - A kind of primer sets and kit for A types and O-shaped foot and mouth disease virus antidiastole - Google Patents
A kind of primer sets and kit for A types and O-shaped foot and mouth disease virus antidiastole Download PDFInfo
- Publication number
- CN108467903A CN108467903A CN201810410559.XA CN201810410559A CN108467903A CN 108467903 A CN108467903 A CN 108467903A CN 201810410559 A CN201810410559 A CN 201810410559A CN 108467903 A CN108467903 A CN 108467903A
- Authority
- CN
- China
- Prior art keywords
- mouth disease
- types
- disease virus
- pcr amplification
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer sets and kit for A types and O-shaped foot and mouth disease virus antidiastole, and the primer sets include primer S1, S2, wherein：S1:5’‑ATTCTTAGCCTAGCACCACAT‑3’,S2：5’‑CCCAATAAGCTTAGTCGACTGTATG‑3’.The present invention designs specific primer S1, S2 according to the difference between A types and O-shaped foot and mouth disease virus, can carry out specific amplification to A types and O-shaped foot and mouth disease virus.The dedicated kit of the present invention has very strong sensibility, specificity, and coincidence rate can be widely applied for the antidiastole of A types and O-shaped foot and mouth disease virus up to 100% compared with the methods of virus purification and IFA.
Description
Technical field
The present invention relates to veterinary biological virus detection techniques fields, and in particular to one kind being used for A types and O-shaped foot and mouth disease virus
The primer sets and kit of antidiastole.
Background technology
Aftosa (Foot-and-mouth disease, FMD) is a kind of highly contagious disease of artiodactyls.
Foot and mouth disease virus (Foot-and-mouth disease virus, FMDV) is the pathogen of FMD, belongs to Picornaviridae
Hostis, is the single strand plus RNA virus of no cyst membrane, FMDV include 7 kinds of serotypes (A, O, C, Asial, SAT1,
SAT2、SAT3).In China, O-shaped serotype aftosa is in be dispersed in generation, the artiodactyls such as main infection pig, ox, sheep.Due to mouth
Aphtovirus includes various serotype, and symptom is also similar, therefore establishes one kind and can quickly distinguish A types aftosa and O-shaped mouth hoof
The multiplex PCR and dedicated kit of epidemic disease can facilitate and occur fast and accurately to diagnose epidemic disease in early days in epidemic disease, be
The prevention and control of epidemic disease provide effective reference.
Invention content
In view of this, the purpose of the present invention is to provide a kind of primers for A types and O-shaped foot and mouth disease virus antidiastole
Group and kit, the kit can quickly distinguish A types and O-shaped foot and mouth disease virus.
To achieve the goals above, the technical solution adopted in the present invention is：
A kind of primer sets for A types and O-shaped foot and mouth disease virus antidiastole, the primer sets include primer S1, S2,
Wherein：
S1：5’-ATTCTTAGCCTAGCACCACAT-3’；
S2：5’-CCCAATAAGCTTAGTCGACTGTATG-3’.
Application of the primer sets in preparing for A types and O-shaped foot and mouth disease virus differential diagnosis kit a kind of described in.
The A types and O-shaped foot and mouth disease virus differential diagnosis kit of primer sets described in a kind of.
The kit further includes nucleic acid extracting reagent, Reverse Transcription, PCR amplification reagent, and/or Ago-Gel
Electrophoresis reagents.
The Reverse Transcription include 10 × M-MLV buffer solutions, dNTP, M-MLV reverse transcriptase, RNase enzyme inhibitors,
S2 primers.
The PCR amplification reagent includes 10 × PCR amplification buffer solution, dNTP, S1 primer, S2 primers, Taq DNA polymerizations
Enzyme and distilled water.
PCR amplification system constructed by the PCR amplification reagent is：10 × PCR amplification buffer solution, 5.0 μ L,
2.5mmol/L dNTP8.0 μ L, 1.0 μ L of 10mmol/L S1 primers, 1.0 μ L of 10mmol/L S2 primers, 5U/ μ L Taq DNA are poly-
1.0 μ L of synthase, 3.0 μ L of template, add distilled water to 50 μ L.
A kind of application method of the kit, including nucleic acid extraction, reverse transcription, PCR amplification and Ago-Gel electricity
Swimming.
Further include analyzing the result of agarose gel electrophoresis：When amplified fragments are 1472bp, the then ox in sample
Viral diarrhea virus is vaccine strain；When amplified fragments size is 824bp, then the bovine viral diarrhea virus in sample is now
Separation strains.
The PCR amplification condition is：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C extend
90s, totally 35 recycle；Last 72 DEG C of extensions 10min.
Beneficial effects of the present invention：
The present invention designs specific primer S1, S2 by the difference of comparison A types and O-shaped foot and mouth disease virus, can be to A types
Specific amplification is carried out with O-shaped foot and mouth disease virus；Dedicated kit is had developed on this basis, first extracts viral RNA, is reused
S2 primed reverse transcriptions synthesize cDNA, and differentiate that detection A types and O-shaped foot and mouth disease virus, A type foot and mouth disease viruses are pre- using PCR method
Phase amplified fragments size is 1472bp, and it is 824bp that O-shaped foot and mouth disease virus, which is expected clip size,.Compared with prior art, of the invention
Dedicated kit have by very strong sensibility, specificity, to c-type foot and mouth disease virus, Asial types foot and mouth disease virus, SAT1 types
The amplification of foot and mouth disease virus, SAT2 types foot and mouth disease virus and SAT3 type foot and mouth disease viruses is feminine gender, can be widely applied for A
The antidiastole of type and O-shaped foot and mouth disease virus.
Specific implementation mode
To make the objectives, technical solutions, and advantages of the present invention clearer, below in conjunction with specific embodiment, to this hair
Bright to be described in further detail, the embodiment is only for explaining the present invention, is not intended to limit the scope of the present invention..
Experimental method used in following embodiments is the conventional method of this field unless otherwise specified, or according to institute of manufactory
It is recommended that condition and implementation steps.
The structure of embodiment 1, differential diagnostic method
1, design of primers
Two specific primers are designed, it is specific as follows:
S1：5’-ATTCTTAGCCTAGCACCACAT-3’(SEQ ID NO.1)
S2：5’-CCCAATAAGCTTAGTCGACTGTATG-3’(SEQ ID NO.2)
PCR amplification is carried out using S1 and S2, it is 1472bp, O-shaped aftosa that A type foot and mouth disease viruses, which are expected amplified fragments size,
The expected amplified fragments size of virus is 824bp.
2, the extraction of viral RNA
Take foot and mouth disease virus culture solution, after multigelation 3 times, 5000g centrifuges 15min, takes supernatant spare.
(1) 0.2ml chloroforms are taken, isometric supernatant is added, acutely rocks 15s, are placed at room temperature for 3min, then 12,000g,
4 DEG C of centrifugation 5min.Be divided into 3 layers after centrifugation, it is nethermost it is red be phenol-chloroform phase, a middle layer, upper layer is colourless water
Phase, RNA are present in water phase；
(2) upper strata aqueous phase in step (1) is transferred in the clean EP pipes of another, the isopropyl of 0.5ml precoolings is added
Alcohol is stored at room temperature 10min, then 12,000g, 4 DEG C of centrifugation 10min；
(3) it outwells supernatant, 75% ethyl alcohol of 1ml volume fractions is added and washs RNA precipitate, after mixing, 7500g, 4 DEG C of centrifugations
5min；
(4) supernatant is outwelled, 10min is placed at room temperature for, is then added in right amount without RNAse water dissolutions RNA to get to total serum IgE.
3, reverse transcription
The RNA extracted using step 2 carries out reverse transcription as template, obtains cDNA, and reverse transcription reaction system is：
| Template ribonucleic acid | 4.9μL |
| S2 primers (10mmol/L) | 0.3μL |
| RTase enzyme inhibitors (40U/ μ L) | 0.3μL |
| M-MLV reverse transcriptase (200U/ μ L) | 0.5μL |
| dNTP(2.5mmol/L) | 2.0μL |
| 10 × M-MLV buffer solutions | 2.0μL |
Reaction condition is：42 DEG C of heat preservations 60min, 70 DEG C of 10min.
4, PCR (PCR)
4.1 PCR reaction systems
The cDNA obtained using step 3 carries out PCR amplification as template, and PCR reaction systems are：
| dNTP(2.5mmol/L) | 8.0μL |
| 10 × PCR amplification buffer solution | 5μL |
| S1 primers (10mmol/L) | 1.0μL |
| S2 primers (10mmol/L) | 1.0μL |
| cDNA | 3.0μL |
| Taq DNA polymerase (5U/ μ L) | 1.0μL |
| ddH2O | To 50 μ L |
4.2 PCR reaction condition optimizations
The PCR reaction conditions of A type foot and mouth disease viruses are optimized, respectively with annealing temperature be 54 DEG C, 55 DEG C, 56 DEG C,
57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C carry out PCR reaction amplification A type foot and mouth disease viruses, reaction condition
For：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, anneal 30s, 72 DEG C of extension 90s, totally 35 cycles；72 DEG C of extension 10min.Hair
Present 57 and 62 DEG C of segments that can amplify 1472bp sizes, it is in the same size with expection.
The PCR reaction conditions of O-shaped foot and mouth disease virus are optimized, respectively with annealing temperature be 52 DEG C, 53 DEG C, 54 DEG C,
55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C carry out PCR reactions and expand O-shaped foot and mouth disease virus, and reaction condition is：95
DEG C pre-degeneration 5min；94 DEG C of denaturation 30s, anneal 30s, 72 DEG C of extension 90s, totally 35 cycles；72 DEG C of extension 10min.It was found that
57 DEG C of segments for 824bp sizes occur, it is in the same size with expection.
In summary it reacts, the annealing temperature of composite PCR is finally set as 57 DEG C by the present invention, the reaction condition after optimization
For：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 90s, totally 35 recycle；Last 72 DEG C of extensions
10min.Pcr amplification product is placed in -20 DEG C of preservations.
5, electrophoresis
To PCR product into row agarose gel electrophoresis, voltage 100V, electrophoresis 40min, under DNA gel imaging system instrument
Observe result.
The dedicated kit of the present invention includes nucleic acid extracting reagent, Reverse Transcription, PCR used in above-mentioned detection method
Amplifing reagent, agarose gel electrophoresis reagent.
Embodiment 2, A types foot and mouth disease virus and O-shaped foot and mouth disease virus sample differential diagnostic method
Respectively using A types foot and mouth disease virus and O-shaped foot and mouth disease virus as sample, it is detected according to the method in embodiment 1,
The result shows that A types foot and mouth disease virus can obtain about 1472bp segments, O-shaped foot and mouth disease virus amplified fragments size is 824bp pieces
Section is consistent with expection.
Embodiment 3, specificity experiments
Respectively with c-type foot and mouth disease virus, Asial types foot and mouth disease virus, SAT1 types foot and mouth disease virus, SAT2 type hoof-and-mouth diseases
Poison and SAT3 type foot and mouth disease viruses are control strain, are detected according to the method in embodiment 1, the results showed that, only A types mouth
Aphtovirus and O-shaped foot and mouth disease virus can respectively obtain 1472bp and 824bp segments, other viruses are produced without amplified band
It is raw.Experimental result confirms that primer of the invention and detection method have very high specificity.
Embodiment 4, sensitivity experiment
O-shaped hoof-and-mouth disease venom is subjected to 10 times of gradient dilutions, it is 5.4 × 10 to make virus concentration4-5.4×10- 4Copies/ μ L, and be detected according to the method for embodiment 1, the results showed that, in the 8th swimming lane a concentration of 5.4 × 10- 3Copies/ μ L it is amplifiable go out expected segment, the minimum detection of nucleic acids amount of primer of the invention and detection method is 5.4 × 10- 3Copies/ μ L, but the 9th swimming lane 5.4 × 10-4Segments of the copies/ μ L without expected size, judges its sensitivity for 5.4 × 10- 3copies/μL。
A type hoof-and-mouth disease venom is subjected to 10 times of gradient dilutions, it is 1.5 × 10 to make virus concentration4-1.0×10- 4Copies/ μ L, and be detected according to the method for embodiment 1, the results showed that, in the 8th swimming lane a concentration of 1.5 × 10- 3Copies/ μ L it is amplifiable go out expected segment, the minimum detection of nucleic acids amount of primer of the invention and detection method is 1.5 × 10- 3Copies/ μ L, but the 9th swimming lane 1.5 × 10-4Segments of the copies/ μ L without expected size, judges its sensitivity for 1.5 × 10- 3copies/μL。
The above is only presently preferred embodiments of the present invention, is not imposed any restrictions to the present invention, every according to the present invention
Technical spirit changes any simple modification, change and equivalent structure made by above example, still falls within skill of the present invention
In the protection domain of art scheme.
Claims (10)
1. a kind of primer sets for A types and O-shaped foot and mouth disease virus antidiastole, which is characterized in that the primer sets include
S1, S2, wherein：
S1：5’-ATTCTTAGCCTAGCACCACAT-3’；
S1：5’-CCCAATAAGCTTAGTCGACTGTATG-3’.
2. a kind of primer sets as described in claim 1 are in preparing for A types and O-shaped foot and mouth disease virus differential diagnosis kit
Application.
3. a kind of A types comprising primer sets as described in claim 1 and O-shaped foot and mouth disease virus differential diagnosis kit.
4. kit according to claim 3, which is characterized in that the kit further includes nucleic acid extracting reagent, anti-
Transcript reagent, PCR amplification reagent, and/or agarose gel electrophoresis reagent.
5. kit according to claim 4, which is characterized in that the Reverse Transcription is buffered including 10 × M-MLV
Liquid, dNTP, M-MLV reverse transcriptase, RNase enzyme inhibitors, S2 primers.
6. kit according to claim 4, which is characterized in that the PCR amplification reagent is slow including 10 × PCR amplification
Fliud flushing, dNTP, S1 primer, S2 primers, Taq archaeal dna polymerases and distilled water.
7. kit according to claim 6, which is characterized in that the PCR amplification body constructed by the PCR amplification reagent
System is：10 × PCR amplification buffer solution, 5.0 μ L, 2.5mmol/L dNTP8.0 μ L, 1.0 μ L of 10mmol/L S1 primers, 10mmol/L
1.0 μ L of S2 primers, 1.0 μ L of 5U/ μ L Taq archaeal dna polymerases, 3.0 μ L of template, add distilled water to 50 μ L.
8. a kind of application method such as claim 3-7 any one of them kits, which is characterized in that including nucleic acid extraction,
Reverse transcription, PCR amplification and agarose gel electrophoresis.
9. the application method of kit according to claim 8, which is characterized in that further include to agarose gel electrophoresis
As a result it is analyzed：When amplified fragments are 1472bp, then the bovine viral diarrhea virus in sample is vaccine strain；Work as amplified fragments
Size is 824bp, then the bovine viral diarrhea virus in sample is now separation strains.
10. the application method of kit according to claim 8, which is characterized in that the PCR amplification condition is：95
DEG C pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 90s, totally 35 recycle；Last 72 DEG C of extensions
10min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810410559.XA CN108467903A (en) | 2018-05-02 | 2018-05-02 | A kind of primer sets and kit for A types and O-shaped foot and mouth disease virus antidiastole |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810410559.XA CN108467903A (en) | 2018-05-02 | 2018-05-02 | A kind of primer sets and kit for A types and O-shaped foot and mouth disease virus antidiastole |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108467903A true CN108467903A (en) | 2018-08-31 |
Family
ID=63263991
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810410559.XA Withdrawn CN108467903A (en) | 2018-05-02 | 2018-05-02 | A kind of primer sets and kit for A types and O-shaped foot and mouth disease virus antidiastole |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108467903A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004058300A1 (en) * | 2002-12-20 | 2004-07-15 | E.I. Du Pont De Nemours And Company | Sequences diagnostic for foot and mouth disease |
| CN1858246A (en) * | 2006-03-22 | 2006-11-08 | 东北农业大学 | Detecting and typing method for hoof and mouth disease virus RT-PCR |
| WO2008140829A2 (en) * | 2007-01-12 | 2008-11-20 | Lawrence Livermore National Security, Llc | Multiplex detection of agricultural pathogens |
| US8354514B2 (en) * | 2007-01-12 | 2013-01-15 | Lawrence Livermore National Security, Llc | Multiplex detection of agricultural pathogens |
| CN103667520A (en) * | 2013-03-04 | 2014-03-26 | 中国检验检疫科学研究院 | Primers, probes and kit for classification diagnosis of foot and mouth disease viruses, and using method of kit |
| CN106435022A (en) * | 2016-09-23 | 2017-02-22 | 中国农业科学院兰州兽医研究所 | A type and O type foot and mouth disease virus specific primer and kit |
-
2018
- 2018-05-02 CN CN201810410559.XA patent/CN108467903A/en not_active Withdrawn
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004058300A1 (en) * | 2002-12-20 | 2004-07-15 | E.I. Du Pont De Nemours And Company | Sequences diagnostic for foot and mouth disease |
| CN1858246A (en) * | 2006-03-22 | 2006-11-08 | 东北农业大学 | Detecting and typing method for hoof and mouth disease virus RT-PCR |
| WO2008140829A2 (en) * | 2007-01-12 | 2008-11-20 | Lawrence Livermore National Security, Llc | Multiplex detection of agricultural pathogens |
| US8354514B2 (en) * | 2007-01-12 | 2013-01-15 | Lawrence Livermore National Security, Llc | Multiplex detection of agricultural pathogens |
| CN103667520A (en) * | 2013-03-04 | 2014-03-26 | 中国检验检疫科学研究院 | Primers, probes and kit for classification diagnosis of foot and mouth disease viruses, and using method of kit |
| CN106435022A (en) * | 2016-09-23 | 2017-02-22 | 中国农业科学院兰州兽医研究所 | A type and O type foot and mouth disease virus specific primer and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3636769B1 (en) | Sample nucleic acid measurement test kit, reagent, and application thereof | |
| CN103255227B (en) | Primer-mediated cyclized constant-temperature nucleic acid rolling circle amplification method and kit | |
| CN107988428A (en) | Shrimp irido virus（SIV）RAA constant temperature fluorescence detection method and reagent | |
| CN103397107B (en) | Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| US20200270673A1 (en) | Pcr assays for specific detection of enterocytozoon hepatopenaei | |
| CN105018485A (en) | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique | |
| CN110669870A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for serotype of Palima serogroup virus | |
| CN104630387B (en) | The LAMP detection kit of Porcine epidemic diarrhea virus | |
| CN106591287A (en) | Polymerase chain reaction enhancing method | |
| CN108251561A (en) | It is a kind of to be used for bovine viral diarrhea virus now separation strains and the primer sets and kit of vaccine strain antidiastole | |
| CN108060272A (en) | A kind of quick differentiation pig Delta coronavirus and the multiple PCR detection primer group and kit of pig ridge virus | |
| CN101487064B (en) | Method and special reagent kit for detecting five zoonosis virus | |
| GB2401175A (en) | Detection of SARS virus by PCR | |
| CN107475450A (en) | A kind of primer sets and kit for the strain of Porcine epidemic diarrhea virus novel variant and vaccine strain antidiastole | |
| CN107988334B (en) | Method for SNP typing by direct PCR of oral swab | |
| WO2014036972A1 (en) | Nucleic acid amplification method | |
| CN108467903A (en) | A kind of primer sets and kit for A types and O-shaped foot and mouth disease virus antidiastole | |
| CN108300812A (en) | A kind of RT-PCR detection kit and its detection method of Pigeon paramyxovirus type I | |
| CN110643740A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for Palimam serogroup virus | |
| CN108950075A (en) | The RT-PCR detection kit and its detection method of one seed shrimp haemocyte irido virus | |
| CN108315489A (en) | A kind of primer sets and kit for transmissible gastro-enteritis virus now separation strains and vaccine strain antidiastole | |
| CN107326082A (en) | A kind of universal primer, nucleotide sequence and its discrimination method of three-type-person source tapeworm ep45 genes | |
| CN108300811A (en) | The RT-PCR detection kit and its detection method of one boar Sai Nika paddy viruses | |
| Bokharaei-Salim et al. | The first detection of co-infection of double-stranded RNA virus 1, 2 and 3 in Iranian isolates of Trichomonas vaginalis | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180831 |
|
| WW01 | Invention patent application withdrawn after publication |