CN108456696A - A kind of construction method of 293T cell strains for virus packaging - Google Patents
A kind of construction method of 293T cell strains for virus packaging Download PDFInfo
- Publication number
- CN108456696A CN108456696A CN201810131733.7A CN201810131733A CN108456696A CN 108456696 A CN108456696 A CN 108456696A CN 201810131733 A CN201810131733 A CN 201810131733A CN 108456696 A CN108456696 A CN 108456696A
- Authority
- CN
- China
- Prior art keywords
- eif2ak2
- sgrna
- cells
- virus
- oligo
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15051—Methods of production or purification of viral material
- C12N2740/15052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of construction methods of the 293T cell strains for virus packaging, include the following steps：Step 1：The sgRNA cloned plasmids of synthesis targeting EIF2AK2 genes；Step 2：EIF2AK2 sgRNA CAS9 plasmid transfection 293T cells；Step 3：The monoclonal cell strain for obtaining EIF2AK2 gene knockouts is screened by puromycin；Step 4：Virus packaging.The 293T cells (EIF2AK2 KO) that the present invention is obtained by this method, when transfecting same amount of viral packaging plasmid, the virus quantity of production is higher than the 293T cells (EIF2AK2 CON) not processed.That is, can improve the output of virus by removing the expression of EIF2AK2 genes in 293T cells, reduce the production cost of virus.
Description
Technical field
The invention belongs to biotechnologies, more particularly to a kind of structure side of the 293T cell strains for virus packaging
Method.
Background technology
293T cells, by the derivative cell line of gene technology, are by Adenovirus E1A gene by HEK293 cells
Transfection, can express SV40 large T antigens, containing SV40 replication origins and promoter region, 293T cells are widely used in viral packet
Dress.50% is may be up to calcium phosphate transfection efficiency.Protein expression level is high, and being analyzed with alkaline phosphatase within 2-3 days after transfection can be compared with
Easily detect the albumen of expression.
Crispr/Cas9 technologies, be occur in recent years efficient genome fixed point editing technique, by engineer at
SgRNA (small guide RNA) with guiding function targets target gene, and guiding nuclease Cas9 albumen is fixed to DNA
Point cutting, causes target gene to be unable to normal expression.It needs first to divide the genome of target gene when using the technology
Analysis, the recognition site NGG of the effect of Cas9 enzymes is found in the exon region of the gene, and wherein N can be appointing in A, T, C, G
Meaning is a kind of, according to the sequence positive-sense strand and antisense strand of 20 base design synthesis sgRNA before action site in experiment.Two single-stranded
Structure carries out plasmid-transfected cells or is packaged into virus infected cell to sgRNA-Cas9 cloning vectors after being annealed into double-strand,
Targeting target gene cuts it in the cell so that the gene inactivates, to achieve the purpose that gene knockout.
EIF2AK2 (2 alpha kinase 2 of eukaryotic translation initiation factor), again
Name：PKR, Eukaryotic protein translation are initially a complicated cellular activity process, it needs a series of albumen to participate in,
These albumen are thus referred to as eukaryotic translation initiation factor (eukaryotic initiation factor, referred to as eIF), at present
Have discovered that at least 12 kinds of different initiation factors.After the albumen of the gene expression is phosphorylated activation, virus can be inhibited
Albumen cannot synthesize, and have antivirus action.Therefore, the gene is knocked out in the vehicles cells of virus packaging, it can
To improve the production toxic effect rate of virus.
Invention content
The invention mainly solves the technical problem of providing it is a kind of for virus packaging 293T cell strains construction method,
The 293T cells (EIF2AK2-KO) obtained by this method, when transfecting same amount of viral packaging plasmid, the virus of production
Amount is higher than the 293T cells (EIF2AK2-CON) not processed.That is, by removing EIF2AK2 genes in 293T cells
Expression can improve the output of virus, reduce the production cost of virus.
In order to solve the above technical problems, one aspect of the present invention is：A kind of 293T for virus packaging
The construction method of cell strain, includes the following steps：
Step 1：The sgRNA cloned plasmids of synthesis targeting EIF2AK2 genes；
Step 2：EIF2AK2-sgRNA-CAS9 plasmid transfection 293T cells；
Step 3：The monoclonal cell strain for obtaining EIF2AK2 gene knockouts is screened by puromycin；
Step 4：Virus packaging.
It further says, 1. the target sequence that Cas9 effects are designed for the EIF2AK2 genes is
TAATACATACCGTCAGAAGCAGG；②ATTCAGGACCTCCACATGATAGG；③AATACATACCGTCAGAAGCAGGG.
Furthermore, the oligo of complex carrier cloning site demand is designed according to target sequence, sequence information is such as
Under：
①EIF2AK2-sgRNA-oligo-1F:CACCGTAATACATACCGTCAGAAGC；
EIF2AK2-sgRNA-oligo-1R:AAACGCTTCTGACGGTATGTATTAC；
②EIF2AK2-sgRNA-oligo-2F:CACCGATTCAGGACCTCCACATGAT；
EIF2AK2-sgRNA-oligo-2R:AAACATCATGTGGAGGTCCTGAATC；
③EIF2AK2-sgRNA-oligo-3F:CACCGAATACATACCGTCAGAAGCA；
EIF2AK2-sgRNA-oligo-3R:AAACTGCTTCTGACGGTATGTATTC。
It further says, the carrier enzyme selected in the step 1 is lentiCRISPRv2 carrier enzymes.
It further says, selects Lenti-GFP slow virus to be packed in the step 4.
It further says, a concentration of 3ug/ml of puromycin in the step 3.
The method that the present invention can also be interfered by RNAi reduces the expression of EIF2AK2 genes, to improve 293T cells
Production virus capable.
Beneficial effects of the present invention at least have the following：
1, the method by knocking out EIF2AK2 gene expressions, the viral wrapping tool cell of structure (including 293T cells, but
It is not limited only to 293T cells), for virus production (including slow virus packs but is not limited only to slow virus and packs)；
2, the expression of EIF2AK2 genes is knocked out by CRISPR technologies, building viral wrapping tool cell, (including 293T is thin
Born of the same parents, but it is not limited only to 293T cells).
Description of the drawings
Fig. 1 is the Genomic sequence information table (part) of EIF2AK2 genes of the present invention；
Fig. 2 is one of the transcript of EIF2AK2 genes of the present invention；
Fig. 3 is the two of the transcript of EIF2AK2 genes of the present invention；
Fig. 4 is the three of the transcript of EIF2AK2 genes of the present invention；
Fig. 5 is the protein expression detection comparison diagram of EIF2AK2-KO cells of the present invention and EIF2AK2-CON cells；
Fig. 6 is that EIF2AK2-KO cells of the present invention carry out Lenti-GFP slow virus packagings with EIF2AK2-CON cells, together
Deng under the conditions of, the Efficiency testing figure of EIF2AK2-KO cells and the virus infected cell of EIF2AK2-CON cells production；
Fig. 7 is that EIF2AK2-KO cells of the present invention carry out Lenti-GFP slow virus packagings with EIF2AK2-CON cells, together
Deng under the conditions of, EIF2AK2-KO cells are examined with after the virus infected cell of EIF2AK2-CON cells production by flow cytometer
Survey the viral efficiency of infection datagram that two kinds of cells of comparison obtain.
Specific implementation mode
The preferred embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings, so that advantages and features of the invention energy
It is easier to be readily appreciated by one skilled in the art, so as to make a clearer definition of the protection scope of the present invention.
Embodiment 1 designs and builds the sgRNA cloned plasmids of targeting EIF2AK2 genes
(1) altogether there are three transcript, the CDS regional sequences design for selecting three transcripts shared meets EIF2AK2 genes
Site PAM (NGG) of Cas9 effects；The target site that can be designed for structure is more, chooses wherein three and is tested for this,
Target sequence is as follows：
①TAATACATACCGTCAGAAGCAGG；
②ATTCAGGACCTCCACATGATAGG；
③AATACATACCGTCAGAAGCAGGG；
(2) oligo of complex carrier cloning site demand is designed according to target sequence, sequence information is as follows：
①EIF2AK2-sgRNA-oligo-1F:CACCGTAATACATACCGTCAGAAGC；
EIF2AK2-sgRNA-oligo-1R:AAACGCTTCTGACGGTATGTATTAC；
②EIF2AK2-sgRNA-oligo-2F:CACCGATTCAGGACCTCCACATGAT；
EIF2AK2-sgRNA-oligo-2R:AAACATCATGTGGAGGTCCTGAATC；
③EIF2AK2-sgRNA-oligo-3F:CACCGAATACATACCGTCAGAAGCA；
EIF2AK2-sgRNA-oligo-3R:AAACTGCTTCTGACGGTATGTATTC；
(3) oligo dissolves, and primer dry powder is first centrifuged 30s in room temperature 8000rpm, adds DDH2Primer is dissolved as 20uM by O
Final concentration；
(4) oligo annealing systems are prepared
Table 1.oligo annealing systems are as follows：
(5) oligo annealing reactions
Table 2.oligo annealing reaction conditions：
(6) lentiCRISPRv2 carriers digestion
3. digestion system of table is as follows：
(7) agarose gel electrophoresis and glue return purpose product
With 1% agarose, 120V constant pressure 30~40min of electrophoresis, single target fragment is put into dry under ultraviolet irradiation incision
Glue recovery purifying is used in net centrifuge tube.
(8) oligo annealed products connect (room temperature 1h) with digestion glue return load body
4. carrier linked system of table is as follows：
(9) connection product converts
(1) it takes 50ul competent cells to be placed on ice to melt, takes 5ul connection products and competent cell mixing；
(2) ice bath 30min, 42 DEG C of water-bath heat shock 90s continue ice bath 2min；
(3) 1ml non-resistant SOB fluid nutrient mediums are added in converted product, 37 DEG C of shaking table, shakes bacterium 1h by 250 turns/min；
(4) after shaking bacterium, 4000rpm centrifuges 2min；
(5) it stays about 200ul mixings to precipitate after removing part supernatant, is applied on LB culture plates, plate is buckled to, 37 DEG C of bacteriums
In incubator overnight (12~16h).
2 EIF2AK2-sgRNA-CAS9 plasmid transfection 293T cells of embodiment
(1) 293T cells in good condition are selected, carry out cell passage bed board, experimental day microscope for 24 hours before transfection
Lower observation cell density, density, which reaches 80%-90%, to be transfected；
(2) 30min-2h removes old culture medium before transfecting, be added it is fresh contain 2% fetal calf serum FBS DMEM, gently shake
It is put into after even in CO2 incubators；
(3) prepare rotaring redyeing system (by taking diameter 10cm culture dishes as an example)
500ul serum free medium Opti-MEM are added in 1.5mL EP pipes, the matter for waiting for 9ug transfections is added wherein
27ul (3 times of transfection DNA total amount volumes) transfection reagent 1X PEI transfection reagents are added after blowing and beating uniformly in grain；
(4) it is stored at room temperature 10-15min after mixing, takes out the culture dish in incubator, the rotaring redyeing system of mixing is equal
Even to be added drop-wise to culture dish surface, culture dish is put into incubator culture after rocking mixing.
Embodiment 3 screens the monoclonal cell strain for obtaining EIF2AK2 gene knockouts by puromycin
(1) culture dish is taken out after cell transfecting 48h, replaces the DMEM of the puromycin-resistant containing final concentration of 3ug/ml
Culture medium (contains 10%FBS)；
(2) drug-treated replaces the DMEM culture mediums (containing 10%FBS) containing no puromycin-resistant, removal after 48 hours
The cell of non-resistant；
(3) it when cell density grows to 90%, is inoculated in after conventional digestion in 96 orifice plates, adjusts the cell density of inoculation
For 0.5/hole；
(4) continue culture two weeks or so, during which in due course fluid infusion or change liquid, when cell in orifice plate is grown to cell clone, choose
It takes and expands culture and the expression of testing goal gene (or knockout) in positive cell clone to 24 orifice plates；
(5) correct clone is further expands culture, until obtaining the cell concentration needed.
4 Lenti-GFP slow virus of embodiment is packed
(1) before transfecting, (EIF2AK2-KO cells and EIF2AK2-CON are thin for the state of microscopically observation vehicles cells
Born of the same parents), determine that cell state is good, density 90% or so, it is pollution-free；
(2) often disk cell replaces DMEM culture mediums of the 10ml containing 2%FBS；
(3) it is as follows to prepare rotaring redyeing system：Helper plasmid Helper 1 (2.5ug/ disks), 2 (2ug/ of helper plasmid Helper
Disk), Lenti-GFP plasmids (5.5ug/ disks) and transfection reagent PEI 27ul are mixed to join in the EP pipes of the OMEM containing 500ul,
It is stored at room temperature 15min.
(4) rotaring redyeing system is slowly added dropwise into Tissue Culture Dish to (EIF2AK2-KO cells and EIF2AK2-CON are thin respectively
Born of the same parents), it keeps culture dish horizontal, shakes culture dish so that transfection composite is uniformly distributed in cell surface；
(5) 8h after transfecting, often disk cell replacement DMEM culture mediums of the 10ml containing 2%FBS；
(6) 48h collects cell supernatant after transfecting, and has contained Lenti-GFP slow virus in the supernatant.
5 Lenti-GFP slow-virus infection aim cells of embodiment
(1) aim cell is inoculated in 6 orifice plates, and cell density is 80% or so when experiment；
(2) slow virus (Lenti-GFP) 10ul of the production of two kinds of cells is taken to be added dropwise in above-mentioned detection cell respectively；
(3) pass through the cell proportion containing GFP in micro- sem observation cell after 48h；
(4) ratio measuring that cell passes through flow cytomery GFP cells is collected.
Test result is as shown in Figure 6 and Figure 7, and the slow virus yield of EIF2AK2-KO groups of cells is far above EIF2AK2-CON
Groups of cells, and the positive rate of the lenti-GFP slow-virus infection aim cells of EIF2AK2-KO cells production is 95%,
The positive rate of the lenti-GFP slow-virus infection aim cells of EIF2AK2-CON cells production is 25%, EIF2AK2-KO cells
Produce the output that lenti-GFP amounts are far above EIF2AK2-CON cells.
6 EIF2AK2 protein expressions of embodiment detection (protein immunoblot reacts, WB)
(1) it is 10% SDS PAGE protein electrophoresis glue to require configuration concentration according to molecular cloning handbook；
(2) take albumen sample appropriate (total protein of Lenti-GFP slow-virus infection aim cells) slow with loading respectively
Fliud flushing presses 3：1 ratio mixing, is denaturalized 5min in boiling water bath；
(3) it is loaded in a predetermined sequence, adds 10ug per hole sample；
(4) upper layer glue (concentration glue) electrophoretic voltage is 100V, and 20min, lower layer's glue (separation gel) is 200V, waits for that bromjophenol blue is swum
It moves at away from gel lower edge about 1cm and cuts off the power, terminate electrophoresis；
(5) albumen transferring film is tested, and nitrocellulose membrane is cut into onesize with glue, and is soaked in methanol
1min is soaked in after taking-up in distilled water or transfering buffering liquid, spare.Lower glass plate is unloaded from electrophoretic apparatus, carefully pries open glass
Glass plate, the stripping careful by glue part is concentrated, separation gel leaves spare.Transfer folder is opened, from black interlayer one side, according to sponge
The sequencing place mat of pad, filter paper, gel, film, filter paper and foam-rubber cushion, after shut white interlayer, by clip pick up come, fastening,
Internal layer is not moved carefully, is put into electric turn trough, makes the black flour of clip to the black flour of slot, and the fine flour of clip is to the red face of slot, slowly
Transferring film buffer solution is poured into, is put into cooling wherein with ice chest, covers transfer capping；
1. connecting with the mains, 200mA is generally used, shifts 60min；
2. closing：The film to take a turn for the better is closed with lock solution, is incubated 1 hour with 37 DEG C of shaking tables；
3. film is put into antibody containing EIF2AK2 (1:1000 dilutions) primary antibody in, set 37 DEG C of shaking tables and be incubated 1 hour；After use
PBST washes film 3 times, each 5min；
4. again moving film in the secondary antibody for diluting anti-mouse HRP in 5000 times, sets 37 DEG C of shaking tables and be incubated 1 hour；After use PBST
Film 5 times, each 5min is washed, finally uses PBS solution rinse primary；
5. albumen color developing detection.
Test result is as shown in figure 5, Eif2ak2-KO cells, icon KO；Eif2ak2-CON cells, icon CON,
EIF2AK2-KO 293T cells do not detect the expression (no band) of EIF2AK2 genes, can be examined in EIF2AK2-CON cells
Measure the expression (having band) of EIF2AK2 genes.
Example the above is only the implementation of the present invention is not intended to limit the scope of the invention, every to utilize this hair
Equivalent structure transformation made by bright specification and accompanying drawing content is applied directly or indirectly in other relevant technical fields,
Similarly it is included within the scope of the present invention.
Claims (6)
1. a kind of construction method of 293T cell strains for virus packaging, it is characterised in that：Include the following steps：
Step 1：The sgRNA cloned plasmids of synthesis targeting EIF2AK2 genes；
Step 2：EIF2AK2-sgRNA-Cas9 plasmid transfection 293T cells；
Step 3：The monoclonal cell strain for obtaining EIF2AK2 gene knockouts is screened by puromycin；
Step 4：Virus packaging.
2. a kind of construction method of 293T cell strains for virus packaging according to claim 1, it is characterised in that：With
The EIF2AK2 genes are 1. TAATACATACCGTCAGAAGCAGG designed for the target sequence of Cas9 effects；②
ATTCAGGACCTCCACATGATAGG；③AATACATACCGTCAGAAGCAGGG.
3. a kind of construction method of 293T cell strains for virus packaging according to claim 2, it is characterised in that：Root
The oligo of complex carrier cloning site demand is designed according to target sequence, sequence information is as follows：①EIF2AK2-sgRNA-oligo-
1F:CACCGTAATACATACCGTCAGAAGC；EIF2AK2-sgRNA-oligo-1R:
AAACGCTTCTGACGGTATGTATTAC；
②EIF2AK2-sgRNA-oligo-2F:CACCGATTCAGGACCTCCACATGAT；
EIF2AK2-sgRNA-oligo-2R:AAACATCATGTGGAGGTCCTGAATC；
③EIF2AK2-sgRNA-oligo-3F:CACCGAATACATACCGTCAGAAGCA；
EIF2AK2-sgRNA-oligo-3R:AAACTGCTTCTGACGGTATGTATTC。
4. a kind of construction method of 293T cell strains for virus packaging according to claim 1, it is characterised in that：Institute
It is lentiCRISPRv2 carriers to state the gene knockout carrier selected in step 1.
5. a kind of construction method of 293T cell strains for virus packaging according to claim 1, it is characterised in that：Institute
Stating in step 4 selects Lenti-GFP slow virus to be packed.
6. a kind of construction method of 293T cell strains for virus packaging according to claim 1, it is characterised in that：Institute
State a concentration of 3ug/ml of puromycin in step 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810131733.7A CN108456696A (en) | 2018-02-09 | 2018-02-09 | A kind of construction method of 293T cell strains for virus packaging |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810131733.7A CN108456696A (en) | 2018-02-09 | 2018-02-09 | A kind of construction method of 293T cell strains for virus packaging |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108456696A true CN108456696A (en) | 2018-08-28 |
Family
ID=63239985
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810131733.7A Pending CN108456696A (en) | 2018-02-09 | 2018-02-09 | A kind of construction method of 293T cell strains for virus packaging |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108456696A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536529A (en) * | 2018-12-10 | 2019-03-29 | 中国医学科学院病原生物学研究所 | A kind of efficient vaccinia virus recombinant carrier and its method for building up |
| CN113699150A (en) * | 2021-08-23 | 2021-11-26 | 山东省滨州畜牧兽医研究院 | PKR-knocking-down Marc-145 cell line |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017046737A1 (en) * | 2015-09-15 | 2017-03-23 | Glaxosmithkline Intellectual Property (No.2) Limited | 1-phenylpyrrolidin-2-one derivatives as perk inhibitors |
| CN107630004A (en) * | 2017-09-01 | 2018-01-26 | 康希诺生物股份公司 | Reduce cell line and construction method and application caused by repeatable adenovirus |
-
2018
- 2018-02-09 CN CN201810131733.7A patent/CN108456696A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017046737A1 (en) * | 2015-09-15 | 2017-03-23 | Glaxosmithkline Intellectual Property (No.2) Limited | 1-phenylpyrrolidin-2-one derivatives as perk inhibitors |
| CN107630004A (en) * | 2017-09-01 | 2018-01-26 | 康希诺生物股份公司 | Reduce cell line and construction method and application caused by repeatable adenovirus |
Non-Patent Citations (2)
| Title |
|---|
| GILLES PERNOD 等: "Increasing lentiviral vector titer using inhibitors of protein kinase R", 《BIOTECHNIQUES》 * |
| RUIKANG LIU 等: "Opposing Roles of Double-Stranded RNA Effector Pathways and Viral Defense Proteins Revealed with CRISPR-Cas9 Knockout Cell Lines and Vaccinia Virus Mutants", 《JOURNAL OF VIROLOGY》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536529A (en) * | 2018-12-10 | 2019-03-29 | 中国医学科学院病原生物学研究所 | A kind of efficient vaccinia virus recombinant carrier and its method for building up |
| CN113699150A (en) * | 2021-08-23 | 2021-11-26 | 山东省滨州畜牧兽医研究院 | PKR-knocking-down Marc-145 cell line |
| CN113699150B (en) * | 2021-08-23 | 2022-04-15 | 山东省滨州畜牧兽医研究院 | PKR-knocking-down Marc-145 cell line |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106636090B (en) | SiRNA, recombinant expression CAR-T carrier and its construction method of human leukocyte interleukin 6 and application | |
| CN105924533B (en) | ROR1 specific chimeric antigen receptor and application thereof | |
| CN109750035B (en) | sgRNA for targeting and guiding Cas9 protein to efficiently cleave TCR and B2M gene locus | |
| CN111073856A (en) | Trophoblast, preparation method thereof and application thereof in NK cell amplification | |
| CN108456696A (en) | A kind of construction method of 293T cell strains for virus packaging | |
| CN106978442B (en) | Preparation method of chimeric antigen receptor T cell | |
| CN117402248B (en) | Application of antibody composition, method for detecting anti-tumor activity of immune cells and kit | |
| CN116004822B (en) | PCR kit for breast cancer diagnosis | |
| CN114958851A (en) | Inhibitor for reducing breast cancer metastasis | |
| CN109266683B (en) | Lentiviral recombinant vector containing E4BP4 gene and preparation method and application thereof | |
| CN104673831B (en) | A kind of method and its application of maintenance and recovery human hair papilla cell primitiveness | |
| CN105420196A (en) | Construction method and application for stably expressing HPV16 E5 protein cell strain | |
| CN114480293B (en) | HBB fusion gene modified autologous hematopoietic stem cell, preparation method and application thereof | |
| CN116640229B (en) | Construction and application of low-pH targeted CAR-T cells | |
| CN115975916B (en) | Application of circIGF1R in promoting myogenic differentiation of porcine skeletal muscle satellite cells | |
| CN111549033B (en) | Lentiviral-infected human epidermal keratinocyte strain and construction method and application thereof | |
| CN114410589B (en) | Application of ETV4 gene in reprogramming Cheng Zeng-derived scar fibroblast | |
| CN118546935B (en) | Method for preparing enhanced CAR-T cells based on interference or knocked-out human PCSK9 gene and application | |
| CN110951783B (en) | Method for inhibiting bovine skeletal muscle satellite cell myogenic differentiation by interfering UCH-L3 expression | |
| CN107760719B (en) | Application of Coxsackie virus in adoptive immune gene delivery system | |
| CN114717323B (en) | Application of gene regulator in preparation of liver cancer metastasis drugs | |
| WO2012002452A1 (en) | Gene introduction method | |
| CN114958916A (en) | Construction method and application of 293T cell strain for improving virus packaging yield | |
| CN114836472A (en) | PARP-1shRNA recombinant lentiviral vector, cell line stably transfected with HaCaT by vector and application of cell line | |
| CN116814690A (en) | Method for repairing CRISPR/Cas9 gene editing related host gene damage by using DNA repair protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180828 |
|
| RJ01 | Rejection of invention patent application after publication |