CN114958851A - Inhibitor for reducing breast cancer metastasis - Google Patents
Inhibitor for reducing breast cancer metastasis Download PDFInfo
- Publication number
- CN114958851A CN114958851A CN202210627256.XA CN202210627256A CN114958851A CN 114958851 A CN114958851 A CN 114958851A CN 202210627256 A CN202210627256 A CN 202210627256A CN 114958851 A CN114958851 A CN 114958851A
- Authority
- CN
- China
- Prior art keywords
- breast cancer
- shrna
- linc02258
- inhibitor
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides an inhibitor for reducing breast cancer cell migration, and belongs to the technical field of breast cancer treatment. The inhibitor is linc02258-shRNA, and after the linc02258-shRNA is transfected in breast cancer cells, the migration capability of the breast cancer cells can be effectively inhibited, and the epithelial-mesenchymal transition of the breast cancer cells can be effectively inhibited. Therefore, inhibitors of linc02258 can be used to inhibit breast cancer metastasis.
Description
Technical Field
The invention belongs to the technical field of breast cancer treatment, and particularly relates to an inhibitor for reducing breast cancer metastasis.
Background
Malignant tumors are one of the major threats to human health and quality of life. Among malignant tumors, breast cancer is the most common malignant tumor in women worldwide, the incidence rate of the breast cancer tends to increase year by year, and the incidence rate of the breast cancer tends to be younger, which seriously harms the health of women. Although medical conditions have improved significantly in recent years, the incidence of breast cancer has not been effectively controlled, and thus, research into breast cancer is essential.
Non-coding regions of the genome that do not encode proteins have long been considered "garbage-associated regions," but with the development of high-throughput sequencing technology, it has been discovered that these non-coding RNAs can be transcribed to produce large quantities of non-coding RNA. By long non-coding RNA is meant non-coding RNA of about 200nt in length lacking an open reading frame. The current research shows that lncRNA can interact with DNA, RNA or protein molecules to regulate gene expression, and relates to the biological development processes of immunology, neurobiology, cancer, stress and the like.
linc02258 is one of long non-coding RNAs, and no document reports that linc02258 functions in breast cancer at present.
Disclosure of Invention
The invention aims to provide an inhibitor for reducing breast cancer metastasis.
In order to achieve the above objects, the present invention provides an inhibitor for reducing breast cancer cell migration, wherein the shRNA comprises Top Strand and Bottom Strand, the sequence of Top Strand is shown as SEQ ID NO.2, and the sequence of Bottom Strand is shown as SEQ ID NO. 3.
Preferably, the use of the shRNA according to claim 1 for the preparation of a medicament for inhibiting breast cancer cell migration.
Preferably, the shRNA as claimed in claim 1 is used for preparing a medicine for inhibiting epithelial-mesenchymal transition of breast cancer cells.
Secondly, the invention provides an application of the targeted inhibitor of linc02258 in preparing a breast cancer metastasis inhibiting drug.
Preferably, the targeted inhibitor of linc02258 is an shRNA of linc 02258.
Preferably, the shRNA comprises Top Strand and Bottom Strand, wherein the sequence of the Top Strand is shown as SEQ ID NO.2, and the sequence of the Bottom Strand is shown as SEQ ID NO. 3.
Preferably, the medicament may further comprise lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives and the like.
Preferably, the medicament can be administered orally or non-orally, and the non-oral administration mode can include intravenous injection, intranasal injection, local injection, intracerebroventricular injection, spinal cavity injection, subcutaneous injection, intraperitoneal injection and the like.
Further, the invention provides an application of the targeted inhibitor of linc02258 in preparation of a breast cancer epithelial-mesenchymal transition inhibition drug.
Preferably, the targeted inhibitor of linc02258 is an shRNA of linc 02258.
Preferably, the shRNA comprises Top Strand and Bottom Strand, wherein the sequence of the Top Strand is shown as SEQ ID NO.2, and the sequence of the Bottom Strand is shown as SEQ ID NO. 3.
Preferably, the medicament may further comprise lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives and the like.
Preferably, the medicament can be administered orally or non-orally, and non-oral administration modes can include intravenous injection, intranasal injection, local injection, intracerebroventricular injection, spinal cavity injection, subcutaneous injection, intraperitoneal injection and the like.
The invention has the beneficial effects that:
the invention discovers that the linc02258-shRNA provided by the invention can effectively inhibit the migration capability of breast cancer cells, and the linc02258-shRNA can effectively promote the protein expression of E-cadherin and inhibit the protein expression of N-cadherin, which indicates that the linc02258-shRNA can inhibit the migration of breast cancer cells by inhibiting EMT. Therefore, the inhibitor of linc02258 can be used for preparing the breast cancer cell metastasis inhibitor.
Drawings
FIG. 1 shows the results of the detection of the inhibitory effect of linc 02258-shRNA;
FIG. 2 is a result of the detection of the effect of linc02258-shRNA on breast cancer angiogenesis;
FIG. 3 is a result of the detection of the effect of linc02258-shRNA on the expression of vascular endothelial growth factor A protein;
FIG. 4 is a result of the detection of the effect of linc02258-shRNA on the cell migration ability of breast cancer cells;
FIG. 5 is a result of the detection of the effect of linc02258-shRNA on EMT transformation of breast cancer cells.
Detailed Description
In order to clearly illustrate the technical features of the present solution, the present solution is explained below by way of specific embodiments.
Example 1 detection of inhibitory Effect of shRNA targeting linc02258
(1) The shRNA (plasmid pENTR/U6) of linc02258 is designed according to the sequence SEQ ID NO.1 of the linc02258, and the designed linc02258-shRNA is constructed by the following sequence:
Top Strand:
5'-CACCGCTAATTTCTCTACCCTACTGCGAACAGTAGGGTAGAGAAATTAGC -3', SEQ ID NO.2;
Bottom Strand:
5'-AAAAGCTAATTTCTCTACCCTACTGTTCGCAGTAGGGTAGAGAAATTAGC -3', SEQ ID NO.3；
(2) inoculating the breast cancer cell MDA-MB-231 into a 6-hole cell culture plate, wherein a blank control group does not carry out transfection, an NC control group carries out transfection on NC-shRNA, an experimental group carries out transfection on linc02258-shRNA, after the transfection is finished, the cell is placed in a cell culture box, a transfection medium is removed within 6 hours, a complete culture medium containing 10% FBS is added, and the cell culture box is placed for continuous culture;
(3) after the culture is continued for 48 hours, taking out the cells, extracting RNA, and carrying out fluorescent quantitative PCR detection;
(4) the primer sequence for LINC02258 is shown below:
5’-ACCACCACCAACGTTCACAT-3’，SEQ ID NO.4；
5’-TGCTGGAGTTCCAATTTCTCAC-3’, SEQ ID NO.5；
beta-actin is used as internal reference;
the fluorescence quantification setup procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 10s, extension at 72 ℃ for 10s, and 45 cycles; 5s at 95 ℃ and 1min at 65 ℃;
(5) calculation of Gene quantification data Using 2 -ΔΔCt The method is carried out.
The results are shown in FIG. 1, where A is blank control, B is NC control, and C is experimental; from the results in fig. 1, it is seen that the linc02258-shRNA designed by the present invention can significantly reduce the expression of linc02258, and the inhibition rate is 88.3%, and the knock-out effect is excellent.
Example 2
Effect of linc02258-shRNA on Breast cancer angiogenesis
1. Inoculating breast cancer cells MDA-MB-231 into a 6-hole culture plate, transfecting NC-shRNA by using a control group, transfecting linc02258-shRNA by using an experimental group, placing the cells into a cell culture box after transfection, removing a transfection medium after 6 hours, adding a serum-free medium, culturing for 24 hours, and collecting the medium;
2. taking out the matrigel from a refrigerator at the temperature of-20 ℃, putting the matrigel in the refrigerator at the temperature of 4 ℃ for overnight melting, and simultaneously putting the 96-pore plate and the gun head in the refrigerator at the temperature of-20 ℃ for precooling;
3. taking out the 96-well plate, adding 50ul of melted matrigel into each well, slightly and uniformly shaking, and transferring the 96-well plate to an incubator at 37 ℃ for 30 min;
4. 100ul of 3X 10 4 Adding the HUVEC cell suspension into a 96-well plate, wherein each group is provided with 3 multiple wells, a control group is added with a culture medium of NC-shRNA MDA-MB-231 cells, and an experimental group is added with a culture medium of linc02258-shRNA MDA-MB-231 cells;
5. the 96-well plate was placed in a cell incubator and cultured for 4 hours, and the cells were observed for tube formation and photographed.
The results are shown in fig. 2, and it can be seen that the promotion effect of the breast cancer cells on the tube formation of HUVEC cells is remarkably reduced after the interference of linc02258-shRNA relative to the control group, which indicates that the linc02258-shRNA effectively inhibits the breast cancer angiogenesis.
Example 3
Effect of linc02258-shRNA on Vascular Endothelial Growth Factor A (VEGFA) of Breast cancer
1. Breast cancer cells MDA-MB-231 are inoculated in a 6-hole culture plate, a control group is transfected with NC-shRNA, an experimental group is transfected with linc02258-shRNA, after transfection, the cells are placed in a cell culture box, after 6 hours, a transfection medium is removed, and a complete medium is added;
2. after transfection for 48h, the medium in the wells was discarded, the cells were washed 1 time with PBS, trypsinized, blown down with 1ml complete medium, blown up and mixed well, transferred to a 1.5ml centrifuge tube;
3. transferring the centrifugal tube into a centrifuge, centrifuging at 1500rpm for 5min, removing the culture medium, resuspending and washing the cells by using 1ml of PBS buffer solution, centrifuging at 1500rpm for 5min again, and removing the supernatant;
4. adding 100ul of RIPA lysate containing protease inhibitor PMSF, blowing, mixing, placing on ice, standing for 30min, and mixing the centrifuge tube at intervals of 10 min;
5. placing the centrifuge tube in a centrifuge, centrifuging at 12000rpm and 4 ℃ for 10min, and transferring the supernatant into a new centrifuge tube;
6. detecting the protein concentration by using a Byunnan BCA protein quantitative kit, adding a loading buffer, and boiling in boiling water for 5 min;
7. performing protein electrophoresis on 10% SDS-PAGE gel, performing electrotransfer after the electrophoresis is finished, and transferring the protein to a PVDF membrane;
8. after the electro-transformation is finished, taking out the PVDF membrane, putting the PVDF membrane into 5% of skimmed milk powder, adding VEGFA and beta-actin primary antibody, and incubating overnight at 4 ℃;
9. after the primary antibody incubation is finished, washing for 3 times by using PBS, adding a secondary antibody, and incubating for 1h on a shaker at room temperature;
10. after the incubation was completed, development exposure was performed.
The experimental results are shown in fig. 3, and it can be seen that the expression level of VEGFA in the experimental group is significantly reduced compared to the control group, which indicates that linc02258-shRNA can effectively inhibit protein expression of VEGFA in breast cancer cells, and thus can effectively inhibit breast cancer angiogenesis.
Example 4
Effect of linc02258-shRNA on Breast cancer cell migration
1. Preparing MDA-MB-231 cells transfected with NC-shRNA and linc02258-shRNA into cell suspension, and adjusting the cell concentration to be 2 x 10 5 /ml；
2. Placing a Transwell chamber in a cell culture plate, adding 600ul of medium containing 10% FBS to the culture well, adding 100ul of cell suspension to the chamber, and placing the cell culture plate in a cell culture box;
3. after 24h of culture, the chamber was taken out using forceps, the medium in the chamber was removed, and the chamber was placed in a culture well to which a fixing solution was added and fixed for 30 min;
4. after fixation is finished, taking out the small chamber by using a pair of tweezers, sucking the fixation solution, adding the fixation solution into the staining solution, and staining for 20min at room temperature;
5. after dyeing is finished, soaking the small chamber for 3 times by using clear water, and wiping off cells on the surface of the inner membrane of the small chamber by using a cotton swab;
6. the chamber was placed under a microscope and photographed.
The experimental results are shown in fig. 4, and it can be seen that the number of cells passing through the chamber is significantly reduced in the experimental group compared to the control group, indicating that linc02258-shRNA can effectively inhibit the migration of breast cancer cells.
Example 5
1. Breast cancer cells MDA-MB-231 are inoculated in a 6-hole culture plate, a control group is transfected with NC-shRNA, an experimental group is transfected with linc02258-shRNA, after transfection, the cells are placed in a cell culture box, after 6 hours, a transfection medium is removed, and a complete medium is added;
2. after transfection for 48h, the medium in the wells was discarded, the cells were washed 1 time with PBS, trypsinized, blown down with 1ml complete medium, blown up and mixed well, transferred to a 1.5ml centrifuge tube;
3. transferring the centrifugal tube into a centrifuge, centrifuging at 1500rpm for 5min, removing the culture medium, resuspending and washing the cells by using 1ml of PBS buffer solution, centrifuging at 1500rpm for 5min again, and removing the supernatant;
4. adding 100ul of RIPA lysate containing protease inhibitor PMSF, blowing, mixing, placing on ice, standing for 30min, and mixing the centrifuge tube at intervals of 10 min;
5. placing the centrifuge tube in a centrifuge, centrifuging at 12000rpm and 4 ℃ for 10min, and transferring the supernatant into a new centrifuge tube;
6. detecting the protein concentration by using a Byunnan BCA protein quantitative kit, and adding a loading buffer solution;
7. performing protein electrophoresis on 10% SDS-PAGE gel, performing electrotransfer after the electrophoresis is finished, and transferring the protein to a PVDF membrane;
8. after the electrotransformation is finished, taking out the PVDF membrane, putting the PVDF membrane into 5% of skimmed milk powder, adding E-cadherin, N-cadherin and beta-actin primary antibody, and incubating overnight at 4 ℃;
9. after the primary antibody incubation is finished, washing the mixture by PBS (phosphate buffer solution) for 3 times, and adding a secondary antibody to incubate for 1 hour on a shaker at room temperature;
10. after the incubation was completed, development exposure was performed.
As shown in FIG. 5, it can be seen that the expression level of E-cadherin in the experimental group is increased and the expression level of N-cadherin is decreased compared with the control group, which indicates that the linc02258-shRNA can effectively inhibit epithelial-mesenchymal transition (EMT transition) of the breast cancer cells, thereby effectively inhibiting the migration of the breast cancer cells.
The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Sino Situo New cell medicine Limited
<120> an inhibitor for reducing breast cancer metastasis
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 495
<212> DNA
<213> Human source (Human)
<400> 1
gtatttgttc tgattcatct aaataccgag gtggcagaaa agcctcttcc tgtggccccc 60
accacctcca gtccacagtg aattctacca gaccaccacc aacgttcaca taaagcccgc 120
ggactcttcc atcagatttt ggtgaatgct gccaaaactg ggactgaccc ttcagggcat 180
tgggctgcta tttggcccag ggaaggtctg gaaatttacc taagagaccg ggcctggact 240
cagggacccc aaaagcctgc taatttctct accctactgt ggtcaagctg gtaccaaagg 300
ctcttcactg aaaagaatgc caaatgcctc tggaagtaat aaagagactg aactaatcta 360
aaattgtttg aaacactcaa gtcatttgga accaatatat gttgtcgtta tcccattcca 420
gtctatcctc attcctgtcc atcctcaatt accgaaaaga aatgtgacct gtgagaaatt 480
ggaactccag caaca 495
<210> 2
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caccgctaat ttctctaccc tactgcgaac agtagggtag agaaattagc 50
<210> 3
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aaaagctaat ttctctaccc tactgttcgc agtagggtag agaaattagc 50
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
accaccacca acgttcacat 20
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tgctggagtt ccaatttctc ac 22
Claims (9)
1. An inhibitor for reducing breast cancer metastasis, wherein the inhibitor is shRNA, and the shRNA comprises Top Strand and Bottom Strand, wherein the sequence of the Top Strand is shown as SEQ ID NO.2, and the sequence of the Bottom Strand is shown as SEQ ID NO. 3.
2. Use of the shRNA according to claim 1 in preparation of a drug for inhibiting breast cancer cell migration.
3. Use of the shRNA according to claim 1 in the preparation of a medicament for inhibiting epithelial-mesenchymal transition of breast cancer cells.
Use of a targeted inhibitor of linc02258 in the preparation of a drug for inhibiting breast cancer cell migration.
5. The use according to claim 4, wherein the targeted inhibitor of linc02258 is an shRNA of linc 02258.
6. The use according to claim 5, wherein the shRNA comprises Top Strand and having the sequence shown in SEQ ID No.2 and Bottom Strand having the sequence shown in SEQ ID No. 3.
Use of a targeted inhibitor of linc02258 in the preparation of a medicament for inhibiting epithelial-mesenchymal transition in breast cancer cells.
8. The use according to claim 7, wherein the targeted inhibitor of linc02258 is an shRNA of linc 02258.
9. The use according to claim 8, wherein the shRNA comprises Top Strand and having the sequence shown in SEQ ID No.2 and Bottom Strand having the sequence shown in SEQ ID No. 3.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210627256.XA CN114958851B (en) | 2022-06-06 | 2022-06-06 | Inhibitor for reducing breast cancer metastasis |
| CN202310356979.5A CN116286824A (en) | 2022-06-06 | 2022-06-06 | Application of gene inhibitor in preparation of breast cancer angiogenesis inhibition drugs |
| CN202310351599.2A CN116286822A (en) | 2022-06-06 | 2022-06-06 | Application of targeted inhibitor in preparation of breast cancer cell epithelial mesenchymal transition inhibition drug |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210627256.XA CN114958851B (en) | 2022-06-06 | 2022-06-06 | Inhibitor for reducing breast cancer metastasis |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310351599.2A Division CN116286822A (en) | 2022-06-06 | 2022-06-06 | Application of targeted inhibitor in preparation of breast cancer cell epithelial mesenchymal transition inhibition drug |
| CN202310356979.5A Division CN116286824A (en) | 2022-06-06 | 2022-06-06 | Application of gene inhibitor in preparation of breast cancer angiogenesis inhibition drugs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114958851A true CN114958851A (en) | 2022-08-30 |
| CN114958851B CN114958851B (en) | 2023-10-17 |
Family
ID=82959717
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210627256.XA Active CN114958851B (en) | 2022-06-06 | 2022-06-06 | Inhibitor for reducing breast cancer metastasis |
| CN202310351599.2A Pending CN116286822A (en) | 2022-06-06 | 2022-06-06 | Application of targeted inhibitor in preparation of breast cancer cell epithelial mesenchymal transition inhibition drug |
| CN202310356979.5A Pending CN116286824A (en) | 2022-06-06 | 2022-06-06 | Application of gene inhibitor in preparation of breast cancer angiogenesis inhibition drugs |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310351599.2A Pending CN116286822A (en) | 2022-06-06 | 2022-06-06 | Application of targeted inhibitor in preparation of breast cancer cell epithelial mesenchymal transition inhibition drug |
| CN202310356979.5A Pending CN116286824A (en) | 2022-06-06 | 2022-06-06 | Application of gene inhibitor in preparation of breast cancer angiogenesis inhibition drugs |
Country Status (1)
| Country | Link |
|---|---|
| CN (3) | CN114958851B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115778976A (en) * | 2022-07-13 | 2023-03-14 | 青岛思拓新源细胞医学有限公司 | Application of inhibitor of targeted linc02258 gene in preparation of breast cancer angiogenesis inhibiting drugs |
-
2022
- 2022-06-06 CN CN202210627256.XA patent/CN114958851B/en active Active
- 2022-06-06 CN CN202310351599.2A patent/CN116286822A/en active Pending
- 2022-06-06 CN CN202310356979.5A patent/CN116286824A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "Homo sapiens long intergenic non-protein coding RNA 2258 (LINC02258), long non-coding RNA", 《GENBANK》 * |
| SAI HUANG: "Identification of Potential Key Long Non-Coding RNAs and Target Genes Associated with Pneumonia Using Long Non-Coding RNA Sequencing (lncRNA-Seq): A Preliminary Study", 《MEDICAL SCIENCE MONITOR : INTERNATIONAL MEDICAL JOURNAL OF EXPERIMENTAL AND CLINICAL RESEARCH》 * |
| XIU, B.: "LINC02273 drives breast cancer metastasis by epigenetically increasing AGR2 transcription", 《MOLECULAR CANCER》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115778976A (en) * | 2022-07-13 | 2023-03-14 | 青岛思拓新源细胞医学有限公司 | Application of inhibitor of targeted linc02258 gene in preparation of breast cancer angiogenesis inhibiting drugs |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114958851B (en) | 2023-10-17 |
| CN116286822A (en) | 2023-06-23 |
| CN116286824A (en) | 2023-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108315330A (en) | The sgRNA and knockout technique of CRISPR-Cas9 systemic characteristics targeting people's RSPO2 genes and application | |
| CN111154763B (en) | Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function | |
| CN114958851B (en) | Inhibitor for reducing breast cancer metastasis | |
| CN114432452B (en) | Medicine for resisting esophageal squamous cell carcinoma | |
| CN106086075B (en) | The construction method of CXCR4RNAi slow virus carrier | |
| CN111743912A (en) | Gene inhibitor for promoting colon cancer cell apoptosis and inhibiting colon cancer cell migration | |
| CN111676222A (en) | shRNA for inhibiting Mettl3 gene expression, recombinant adeno-associated virus thereof and application thereof | |
| CN106620703A (en) | Application of inhibitor of GINS2 genes or protein to preparation of antitumor drugs | |
| CN115778976A (en) | Application of inhibitor of targeted linc02258 gene in preparation of breast cancer angiogenesis inhibiting drugs | |
| CN114032236B (en) | shRNA of TMEM2 and application thereof | |
| CN112391385B (en) | siRNA, siRNA plasmid and lentivirus for targeted inhibition of NCEH1 gene expression as well as construction method and application thereof | |
| CN111549033B (en) | Lentiviral-infected human epidermal keratinocyte strain and construction method and application thereof | |
| CN114657181B (en) | H1.4-targeted sgRNA and H1.4 gene editing method | |
| CN115896112B (en) | Method for constructing gene deletion cell strain by targeting sgRNA of knocked-out human TMEM121 gene and application | |
| CN108424914B (en) | Targeted AUF1 gene inhibitor for inhibiting human malignant brain glioma and application thereof | |
| CN111228292B (en) | Application of human TPT1/TCTP gene in preparation of antitumor drugs | |
| CN116004625B (en) | Circular RNA related to sheep fur bending and application thereof | |
| CN114958849B (en) | Application of lncRNACACF to miR-520b-3p adsorption in regulation of human umbilical vein endothelial cell cycle | |
| CN116004723A (en) | Method for stably knocking out CBX4 gene in osteosarcoma cell 143B | |
| CN115869388A (en) | Application of FKBP11 protein or coding gene in preparation of drugs for treating squamous cell carcinoma of larynx | |
| CN116162624A (en) | High-efficiency human PCL3 gene sgRNA knocked out combination and plasmid, lentivirus, kit and application thereof | |
| CN116004629A (en) | Application of lncRNACACF to miR-106a adsorption in preparation of human umbilical vein endothelial cell autophagy inducer | |
| CN114410685A (en) | Stk11 gene knockout cell line and construction method and application thereof | |
| CN114958855A (en) | siRNA for promoting endothelial cell apoptosis and SIRT6 low-expression cell line | |
| CN115141828A (en) | shRNA interfering SQR gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230920 Address after: 523000 401, room 4, building 10, innovation and Technology Park, Songshan Lake high tech Industrial Development Zone, Dongguan, Guangdong, China Applicant after: Guangdong cel Biotechnology Co.,Ltd. Address before: Room 202, building 15, Max business Hongwan, 17 Guangbo Road, high tech Zone, Chengyang District, Qingdao City, Shandong Province 266109 Applicant before: Qingdao Situo Xinyuan Cell Medicine Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |