CN108456667B

CN108456667B - A kind of application of zytase and its encoding gene and they

Info

Publication number: CN108456667B
Application number: CN201710085783.1A
Authority: CN
Inventors: 马延和; 赖志华; 周成; 薛燕芬
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2017-02-17
Filing date: 2017-02-17
Publication date: 2019-10-18
Anticipated expiration: 2037-02-17
Also published as: CN108456667A

Abstract

The present invention relates to genetic engineering field, disclose a kind of (a) or (b) shown in zytase: (a) zytase that the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 forms；(b) amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 is by replacing, missing or adding one or several amino acid and the constant protein as derived from (a) of enzymatic activity, alternatively, the amino terminal and/or carboxyl terminal in SEQ ID NO:1 or SEQ ID NO:3 are connected with protein shown in the amino acid sequence of label.The invention also discloses gene, the recombinant vector containing gene, the recombinant bacterial strain containing recombinant vector and their applications of being capable of encoding xylanase.In addition, the invention also discloses the method for preparing zytase and for the composition of degradation of xylan.Xylanase activity of the invention is higher, and resistance is strong.

Description

A kind of application of zytase and its encoding gene and they

Technical field

The present invention relates to genetic engineering fields, and in particular, to a kind of zytase and its encoding gene and they answer With.

Background technique

Xylan (Xylan) is a kind of polysaccharose substance, is the main component of hemicellulose in cell wall, it accounts for plant carbon The 1/3 of hydrate total amount is the renewable biological source abundant of content second after nature relaying cellulose.It is presently found Xylan is there are two types of structure: (1,3)-β-D- xylan (seeing seaweed) and (1 → 4)-β-D- xylan (see terrestrial plant with Algae).The discovery most in the Filamentous caulerpa (Caulerpa filiformis, a kind of seabed water plant) of (1,3)-β-D- xylan, The glycan is not soluble in water, but solvable under alkaline condition, also has glucose residue in main chain, while there is also with β (Isosorbide-5-Nitrae) glucosides The xylose residues of key connection.The main chain of (1 → 4)-β-D- xylan is also to be made of xylose, but be often connected to it in xylose residues Its sugar, forms araboxylan and glucuronoxylan.In hardwood, the 2,3 of the xylose residues of glucuronoxylan There is 70-80% to be replaced by acetyl group on the hydroxyl of position.

Zytase is the general name of a kind of enzyme that can decompose xylan.Presently found zytase principally falls into F/10 With G/11 family.Zytase is prevalent in the seed of fungi, bacterium, protozoan, shellfish, insect and plant. Industrial wood dextranase is mainly from fungi.They bleach in no chlorine papermaking, increase greenfeed nutrient, food additive processing industry, There is important application value in the industrial productions such as juice clarification and plant fiber degumming.The following zytase is possibly used for degrading Plant cell wall is to produce the process of bioenergy.

It is well known that enzyme of different nature is needed in different industrial productions, and such as: papermaking needs the auxiliary drift of high temperature alkali resistant enzyme It is white；Feed pelleting production needs carry out at 70-95 DEG C；Require enzyme effective at low temperature in food industry；Biological degumming of ramie Process needs enzyme to have stronger degradation Preference to ramie xylan under alkaline condition.Therefore, studying new has Optimality The zytase of matter is of great significance with adapting to different industrial requirements.

Summary of the invention

The purpose of the present invention is overcome the deficiencies of the prior art and provide a kind of zytase that active high stability is strong and its The application of encoding gene and they.

To achieve the goals above, in a first aspect, zytase shown in the present invention provides a kind of (a) or (b):

(a) zytase that the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 forms；

(b) amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 through replacing, missing or adding one or Several amino acid and the constant protein as derived from (a) of enzymatic activity, alternatively, in the ammonia of SEQ ID NO:1 or SEQ ID NO:3 Base end and/or carboxyl terminal are connected with protein shown in the amino acid sequence of label.

Second aspect, the present invention provides the genes that one kind can encode zytase described in first aspect.

The third aspect, the present invention provides a kind of recombinant vectors containing gene described in second aspect.

Fourth aspect, the present invention provides a kind of recombinant bacterial strains containing recombinant vector described in the third aspect.

5th aspect, the present invention provides a kind of methods for preparing zytase, this method comprises: (1) culture four directions Recombinant bacterial strain described in face induces the expression of the gene of encoding xylanase；(2) zytase expressed by separating-purifying.

6th aspect, the present invention provides a kind of composition for degradation of xylan, the composition contains first aspect The zytase is as active constituent, and on the basis of the total weight of the composition, the content of the zytase is 10- 90 weight %.

7th aspect, the present invention provides genes described in zytase described in a kind of first aspect, second aspect, the Composition described in recombinant vector described in three aspects, recombinant bacterial strain described in fourth aspect and the 6th aspect is poly- in degradation wood Application in sugar.

Xylanase activity of the invention is higher, have good resistance (reaction temperature is high, and the pH scope of application is wide in range, Still there is activity well in high concentration salt solutions), stability and higher Rate activity.It is raw in paper pulp bleaching, detergent It produces, there is application prospect especially in biological degumming of ramie (degradation of ramie xylan).

Other features and advantages of the present invention will the following detailed description will be given in the detailed implementation section.

Detailed description of the invention

The drawings are intended to provide a further understanding of the invention, and constitutes part of specification, with following tool Body embodiment is used to explain the present invention together, but is not construed as limiting the invention.In the accompanying drawings:

Fig. 1 is the SDS-PAGE electrophoresis for recombinating the zytase of expression in escherichia coli；

Fig. 2 is the optimal pH curve of zytase of the present invention；

Fig. 3 is the pH curve of stability of zytase of the present invention；

Fig. 4 is the optimum temperature curve of zytase of the present invention；

Fig. 5 is the thermostabilization curve of zytase of the present invention at different temperatures；

Fig. 6 is the zytase phylogenetic tree of the nearly source kind of zytase source of the present invention bacterial strain；

Fig. 7 is activity curve of the zytase of the present invention under different salinity；

Fig. 8 is zytase of the present invention figure compared with similar zytase is to ramie xylan Rate activity.

Specific embodiment

Detailed description of the preferred embodiments below.It should be understood that described herein specific Embodiment is merely to illustrate and explain the present invention, and is not intended to restrict the invention.

The endpoint of disclosed range and any value are not limited to the accurate range or value herein, these ranges or Value should be understood as comprising the value close to these ranges or value.For numberical range, between the endpoint value of each range, respectively It can be combined with each other between the endpoint value of a range and individual point value, and individually between point value and obtain one or more New numberical range, these numberical ranges should be considered as specific open herein.

In the present invention, in the absence of explanation to the contrary, the i.e. enzyme content of the size of the term " enzyme activity " used How much, indicated with enzyme activity unit, i.e. enzyme unit (U), in the present invention definition of enzyme unit be: in pH 7.0 and 70 DEG C of condition Under, hydrolyzing poly- xylan per minute and generating the enzyme amount of the corresponding xylose of 1 μm of ol is an enzyme activity unit, i.e. 1U=1 μm of ol/ min；" Rate activity of enzyme " represents the catalytic capability of per unit mass protein, can react enzymatic activity size, and value is bigger, table Bright enzymatic activity is higher, the calculation formula of Rate activity are as follows: Rate activity (U/mg)=total enzyme activity unit of force number/mg total protein；Unit M table Show mol/L.

Zytase provided by the invention is for (a) or (b):

(b) amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 through replacing, missing or adding one or Several amino acid and the constant protein as derived from (a) of enzymatic activity, alternatively, in the ammonia of SEQ ID NO:1 or SEQ ID NO:3 Base end and/or carboxyl terminal are connected with protein shown in the amino acid sequence of label.Wherein, enzymatic activity is constant refers in phase Under same determination condition, the percentage (relative activity) between the enzyme activity of the protein as derived from (a) and the enzyme activity of (a) is no Lower than 95% (or 96% or 97% or 98% or 99% or 100%).

20 kinds of amino acid residues of constitutive protein matter, are segmented into four classes according to pendant polar: 1, nonpolar amino acid: Alanine (Ala), valine (Val), leucine (Leu), isoleucine (Ile), methionine (Met), phenylalanine (Phe), tryptophan (Trp) and proline (Pro)；2, the uncharged amino acid of polarity: glycine (Gly), serine (Ser), threonine (Thr), cysteine (Cys), aspartic acid (Asn), glutamine (Gln) and tyrosine (Tyr)；3, band The amino acid of positive charge: arginine (Arg), lysine (Lys) and histidine (His)；4, negatively charged amino acid: asparagus fern ammonia Sour (Asp) and glutamic acid (Glu) (referring to " biochemistry " (second edition) first volume, Shen Tong, Wang Jingyan, the 82-83 pages, high religion Educate publishing house, December nineteen ninety).If it happens the amino acid residue that a classification is belonged in protein replaces, such as is taken by Arg Replace Ile for Lys or by Leu, effect of the residue played in protein domain (for example provides positive charge or formed and dredged The effect of water bag structure) do not change, therefore the stereochemical structure of protein can't be had an impact, therefore still can be real The function of existing albumen.Any one in above-mentioned zytase can occur for the amino acid residue substitution for belonging to a classification On amino acid residue position.

As previously mentioned, zytase provided by the invention can also be modified or is mutated, derivative protein is obtained.This " derivative protein " described in invention refers to the difference having on amino acid sequence with the zytase with above-mentioned amino acid sequence, There can also be not the difference on the modified forms for influencing sequence, or have both at the same time.These albumen include natural or induction something lost Progress of disease allosome.The induction variant can be obtained by various technologies, such as the random mutation of radiation or mutagens generation, The technology of such as fixed-point mutation method or other known molecular biology can be passed through." the derivative protein " further includes with day The analog (such as D type amino acid) of the residue of right L-type amino acid, and (such as with non-naturally occurring or synthesis amino acid Beta-amino acids, gamma-amino acid etc.) analog.

(not changing primary structure usually, i.e., the do not change amino acid sequence) form of modification includes: internal or external albumen Chemical derivative form such as acetylation or carboxylated.Modification further include glycosylation, such as those in the synthesis and processing of albumen or Albumen that is glycosylation modified and generating is carried out in further processing step.This modification can be by being exposed to progress sugar for albumen The enzyme (glycosylase or deglycosylation enzyme of such as mammal) of base and complete.Modified forms further include with phosphorylation amino The sequence of sour residue (such as phosphotyrosine, phosphoserine, phosphothreonine).It further include being modified to improve its anti-egg White hydrolysis property or the albumen for optimizing solubility property.

In order to facilitate purifying, modification can also be added to (a) using the common label in this field, for example, (b) Can be connected by the amino terminal and/or carboxyl terminal at (a) label shown in the following table 1 (such as Poly-Arg, Poly-His, At least one of FLAG, Strep-tag II and c-myc) and obtain.The label will not influence zytase of the invention Activity, in actual application, can choose whether according to demand addition label.

Table 1

Label	Residue number	Amino acid sequence
			Poly-Arg	5-6 (usually 5)	RRRRR (SEQ ID NO:5)
Poly-His	2-10 (usually 6)	HHHHHH (SEQ ID NO:6)
			FLAG	8	DYKDDDDK (SEQ ID NO:7)
Strep-tagⅡ	8	WSHPQFEK (SEQ ID NO:8)
			c-myc	10	EQKLISEEDL (SEQ ID NO:9)

Above-mentioned zytase can be obtained by artificial synthesized, can also first synthesize its encoding gene, then pass through biological table Up to acquisition.

The present invention also provides the genes that can encode above-mentioned zytase.Correspondingly, the gene can be following (1) or (2):

(1) nucleotide sequence DNA molecular as shown in SEQ ID NO:2 or SEQ ID NO:4；

(2) enzymatic activity for the zytase for hybridizing and encoding with the DNA sequence dna that (1) limits under strict conditions is constant DNA molecular.Wherein, the stringent condition can be with are as follows: in 6 × SCC, the solution of 0.5%SDS, hybridizes at 65 DEG C, then uses 2 × SCC, 0.1%SDS and 1 × SCC, it is primary that 0.1%SDS respectively washes film.Enzymatic activity is constant to be referred under identical determination condition, It is not low by the percentage (relative activity) between the enzyme activity of the protein of the enzyme activity and (1) coding of the protein of (2) coding In 95% (or 96% or 97% or 98% or 99% or 100%).

It is known in the art that in 20 kinds of different amino acid of constitutive protein matter, except Met (ATG) or Trp (TGG) are respectively Single password coding is outer, other 18 kinds of amino acid encode (Sambrook etc., molecular cloning, cold spring by 2-6 codon respectively Publishing house, Cold Spring Harbor Laboratory, New York, the U.S., the second edition, 1989, see the Appendix D of page 950).I.e. due to the degeneracy of genetic codon, Determine the most more than one of the codon of an amino acid, the displacement of third nucleotide, tends not in triplet codon Change the composition of amino acid, therefore the nucleotide sequence for encoding the gene of same protein can be different.Those skilled in the art are according to public affairs The password sublist known, from amino acid sequence disclosed by the invention, and the xylanase activity obtained by the amino acid sequence Constant amino acid sequence can derive the nucleotide sequence that can encode their gene completely, pass through biological method (such as PCR method, mutation method) or chemical synthesis process obtain the nucleotide sequence, therefore the partial nucleotide sequence is all answered This is included in the scope of the present invention.On the contrary, using DNA sequence dna disclosed herein, it can also by methods known in the art, example The method (molecular cloning, CSH Press, New York, the U.S., the second edition, 1989) of such as Sambrook carries out, and leads to It crosses and modifies nucleic acid sequence provided by the invention, obtain and the consistent amino acid sequence of xylanase activity of the present invention.

Preferably, the nucleotide sequence of the gene is as shown in SEQ ID NO:2 or SEQ ID NO:4.

As described above, correspondingly, the end 5' and/or the end 3' of nucleotide sequence can also be connected with label shown in table 1 Coded sequence.

Nucleotide sequence provided by the invention can usually use polymerase chain reaction (PCR) amplification, recombination method or people Work synthetic method obtains.For example, those skilled in the art according to the present invention provided by nucleotide sequence, can be easy to To template and primer, amplification is carried out using PCR and obtains related sequence.

Once obtaining related nucleotide sequence, so that it may obtain related amino acid sequence with recombination method is large batch of.It is logical Often gained nucleotide sequence is cloned into carrier, then transgene engineering bacteria, then through conventional method after proliferation The isolated related nucleotide sequence of host cell.

In addition, also related nucleotide sequence can be synthesized with well known artificial chemistry synthetic method.

Recombinant vector provided by the invention contains gene provided by the invention.

The recombinant vector is preferably recombinant plasmid pET28a-Xyn30Y5." carrier " used in recombinant vector can be selected Various carriers known in the art, such as commercially available various plasmids, clay, bacteriophage and retrovirus, the present invention are preferred PET28a plasmid.Construction of recombinant vector can be used can be in various endonucleases of the vector multiple cloning site with cleavage site (such as pUC18, Sal I, BamH I, EcoR I etc. can be used；For pET28a, Nde I, Nhe I, EcoR I, BamH can be used I, Hind III etc.) digestion acquisition linear plasmid is carried out, it connect, is weighed with the genetic fragment using the cutting of identical nucleic acid restriction endonuclease Group plasmid.Present invention preferably employs Nhe I and I double digestion pET28a of Xho and genetic fragment connected to it, linked enzyme connects It connects, building obtains recombinant vector pET28a-Xyn30Y5.

Recombinant bacterial strain provided by the invention contains recombinant vector provided by the invention.

The recombinant vector can be converted, transduceed or is transfected into host cell (bacterium by the method for this field routine Strain) in, it is preferably electroporated such as Calcium Chloride Method chemical conversion, electroporation.The host cell can be prokaryotic cell Or eukaryocyte, preferably rod bacterium (such as Escherichia coli (Escherichia coli) or bacillus subtilis (Bacillus )) or saccharomycete (such as pichia pastoris yeast (Pichia pastoris) or saccharomyces cerevisiae (Saccharomyces subtilis Cerevisiae)), it is highly preferred that the host cell is Escherichia coli (such as e. coli bl21 (DE3) or bacillus coli DH 5 α)。

The method provided by the invention for preparing zytase includes: culture recombinant bacterial strain provided by the invention, induction coding The expression of the gene of zytase；Zytase expressed by separating-purifying.The condition of culture is conventional condition of culture, such as Using LB culture medium, (solvent is water, and solute and its final concentration are respectively as follows: Tryptone10g/L, yeast extract 5g/L, NaCl 10g/L), it cultivates at 35-37 DEG C to OD₆₀₀It is 0.6.Due to containing encoding xylanase in recombinant bacterial strain provided by the invention Gene, can efficiently expressed xylanase.By separating-purifying after culture, the zytase of high-purity can be obtained. It can be using well known to a person skilled in the art method progress separating-purifying, (e.g., into culture solution, addition isopropyl-β-d- is thio Galactoside (IPTG) is to final concentration of 0.7mM, and 37 DEG C are collected thallus after continuation shaken cultivation 4 hours, with the pH 7.9 of 20mM Tris-HCl buffer suspend and sonicated cells, zytase can be obtained using purifying), details are not described herein.

Contain zytase of the invention as active constituent provided by the present invention for the composition of degradation of xylan, with On the basis of the total weight of the composition, the content of the zytase is 10-90 weight %.It can also contain in the composition Solvent well known to capable field technique personnel (such as glycerol, carbohydrate and protease inhibitors protein protective agent), agonist are (such as NiCl₂, calcium chloride) etc..

The present invention also provides above-mentioned zytase, gene, recombinant vector, recombinant bacterial strain and compositions of the invention to exist Application in degradation of xylan.

In the present invention, the method using the zytase degradation of xylan may include: by xylan sample with it is described Zytase contact.Relative to every gram of the xylan sample in terms of xylan, the dosage of the zytase can be 105- 130μg.The condition of the contact may include: that temperature is 60-75 DEG C, pH value 6-10.The time of the contact can be 5- 15min.In order to obtain more preferably degradation effect, it is preferable that the contact is in Ni²⁺In the presence of carry out.It is highly preferred that Ni²⁺? Content in contact system is 0.2-0.7mM.The xylan sample can be the xylan in various sources, as zelkova schneideriana wood is poly- Sugar, birch xylan, ramie xylan etc..

The present invention will be described in detail by way of examples below.

Experimental method used in following embodiments is conventional method unless otherwise specified.Institute in following embodiments Material, reagent etc., are commercially available unless otherwise specified.

Protein content (Xyn30Y5 enzyme solution concentration) measurement used kit is Bole's protein determination kit in embodiment (Quick Start Bradford Protein Assay Kit), catalogue number is 500-0201；Xylan purchase used From Sigma, catalogue number is X4252-100G.

Embodiment 1

The acquisition of zytase and its encoding gene etc.

(1) clone of zytase (Xyn30Y5) encoding gene

1. according to the conserved sequence for producing zytase bacterial strain Bacillus sp.30Y5 analysis zytase

The bacillus (Bacillus sp.30Y5) for being isolated from Inner Mongol salt lake is taken, is mentioned using genome extraction kit The total DNA of Bacillus sp.30Y5 is taken, ultraviolet specrophotometer measures the purity result of DNA are as follows: A260/A280=1.80, A260/A230=2.00.The total DNA is used for subsequent each experiment.

By 16S rRNA gene universal primer 8F (SEQ ID NO:12,5'-AGAGTTTGATCCTGGCTCAG-3')/ 1492R (SEQ ID NO:13,5'-CGGTTACCTTGTTACGACTT-3') amplification obtains the 16S of Bacillus sp.30Y5 The gene order of rRNA, PCR reaction system are following (30 μ l):

PCR Mix is a kind of PCR reaction solution of premix, and from Beijing, Qing Ke biotech firm is bought, article No. TSE001.

PCR amplification condition are as follows: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C of extension 1.5min, 32 circulations；Last 72 DEG C of extensions 10min.PCR product detects yield and specificity with 1% agarose gel electrophoresis.PCR product Deliver the sequencing of Beijing Qing Ke biotech firm.

It is compared online by NCBI, discovery and the immediate bacterial strain of bacterium 16S rRNA gene order are Bacillus Neizhouensis strain JSM 071004, sequence similarity 95.5%.

The zytase (EC 3.2.1.8) that bacillus is searched in Uniprot database, is looked for according to search result To all relevant bacterial strains and record.The 16S rRNA gene order that these bacterial strains are downloaded in ncbi database, together with The 16S rRNA gene order of Bacillus sp.30Y5 carries out evo-devo analysis.It finds and evolves with Bacillus sp.30Y5 The immediate bacterial strain of relationship.Search for the zytase sequence of these bacterial strains, and by phylogenetic tree construction carry out a point group (Fig. 6, Software is analyzed as the achievement of Mega5.2 adjacent method, parameter is defaulted).The conserved sequence of each similar monoid xylanase gene is analyzed, And the conserved region degenerate primer of each monoid is designed accordingly.

2. obtaining the conserved region sequence of Bacillus sp.30Y5 zytase sequence

By the PCR product obtained by conserved region degenerate primer, (PCR program is as previously mentioned, the end PCR product 3' is being reacted Will increase an additional adenine afterwards) by DNA purification kit (ultrathin centrifugal column type, the production of Sigma company) purifying.So PCR product is connected to TA cloning vector (precious biotech firm produces) afterwards, coupled reaction system is following (10ul):

Ensure the molar ratio of PCR product and TA carrier between 3:1 to 7:1 in reaction system.

Connection product is converted to DH5 α competent cell (production of Beijing Quan Shijin biotech firm), converts bacterial strain dilution spread In the LB solid plate containing IPTG and X-gal.It screens to obtain the monoclonal colonies of positive transformant by blue hickie.Picking list Colonies are dissolved in distilled water on a small quantity, and handle 10 minutes in boiling water bath, and the plasmid converted in bacterial strain will release.So The template that centrifuging and taking supernatant is reacted as PCR afterwards.Use universal primer M13F (SEQ ID NO:14, TGT AAA ACG ACG GCC AGT) and M13R (SEQ ID NO:15, AGG AAA CAG CTA TGA CCA T) amplification be inserted into the DNA piece of TA carrier Section, PCR response procedures are as described above.

It is verified by above-mentioned PCR, the objective gene sequence of the following available one section of about 460bp of degenerate primer group:

XynA691F:ACTGAAAATBGTTCCRCTY (SEQ ID NO:16)

XynA1216R:ACCCTRCANTARTTACTTC (SEQ ID NO:17)

3. obtaining the full length sequence of Bacillus sp.30Y5 xylanase gene by Tail-PCR

On knowing chromosome after one section of sequence of certain gene, the flank of the known array can be obtained by Tail-PCR Sequence, Tail-PCR and relevant primer design are as follows:

Specific primer RSP1:CTACGACGAGATTCCAATG (SEQ ID NO:18)

Specific primer RSP2:GAAAGACAAGCAGATCGCTAT (SEQ ID NO:19)

Specific primer RSP3:GTCAATCAGACAATATTAGTAGC (SEQ ID NO:20)

Specific primer FSP1:CATTGGAATCTCGTCGTAG (SEQ ID NO:21)

Specific primer FSP2:CCATCCGTATAAACTCACATCA (SEQ ID NO:22)

Specific primer FSP3:GTGTCTCAAGACGCTCTAG (SEQ ID NO:23)

Article that random primer was delivered with reference to Zhou etc. in 2010 (Zhou, J.P., H.Q.Huang, K.Meng, P.J.Shi,Y.R.Wang,H.Y.Luo,P.L.Yang,Y.G.Bai and B.Yao(2010)."Cloning of a New Xylanase Gene from Streptomyces sp TN119Using a Modified Thermal Asymmetric Interlaced-PCR Specific for GC-Rich Genes and Biochemical Characterization." Applied Biochemistry and Biotechnology 160(5):1277-1292.)

Random primer AD1:NTCGASTWTSGWGTT (SEQ ID NO:24)

Random primer AD2:NGTCGASWGANAWGAA (SEQ ID NO:25)

Random primer AD3:WGTGNAGWANCANAGA (SEQ ID NO:26)

Random primer AD4:TGWGNAGWANCASAGA (SEQ ID NO:27)

Random primer AD5:AGWGNAGWANCAWAGG (SEQ ID NO:28)

Random primer AD6:STTGNTASTNCTNTGC (SEQ ID NO:29)

Random primer AD7:WCAGNTGWTNGTNCTG (SEQ ID NO:30)

Tail-PCR program is as follows:

Firstly, the reaction system of 7 difference AD primers of setting, special primer SP1 and AD primer molar ratio=1:10

Program:

Then, the dilution of first round product 1/200 is used as template, special primer SP2:AD primer=1:10

94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 3min

94 DEG C of 30s, 45 DEG C of 1min, 72 DEG C of 3min × 15

72℃5min——4℃

(3) first round product 1/200 dilutes, special primer SP3:AD primer=1:10

94 DEG C of 30s, 45 DEG C of 1min, 72 DEG C of 3min × 20

72℃5min——4℃

The principal product band after the completion of Tail-PCR is recycled using the plastic recovery kit of Sigma company.Then by its structure It is built to TA carrier, conversion to DH5 α cell carries out blue hickie screening, and several positive clone molecules of picking carry out sequencing analysis.Experiment Details is as previously mentioned, repeat no more.

4. Bacillus sp.30Y5 xylanase sequence is analyzed

Bacillus sp.30Y5 xylanase gene and its upstream and downstream partial sequence are obtained by Tail-PCR.Pass through NCBI ORF finder (https: //www.ncbi.nlm.nih.gov/orffinder/) predicts Bacillus The encoder block of sp.30Y5 xylanase gene.It is compared online by NCBI Protein Data Bank and finds that the zytase C-terminal exists One SLH structural domain (being responsible for albumen being anchored to S layers of cell).Since the zytase approximation albumen is mostly with peptide fragment WAIAD As C-terminal end sequence, therefore the SLH structural domain of the enzyme C-terminal is clipped using the site as separation.By the nucleosides of this obtained gene Acid sequence is as shown in SEQ ID NO:4, and the amino acid sequence of coding is as shown in SEQ ID NO:3.

It is obtained by 4.1 Server of signal peptide on-line prediction software SignalP analysis: the 1st to 26 in SEQ ID NO:3 Position is signal peptide sequence.Therefore mature zytase totally 354 amino acid, is named as Xyn30Y5, sequence such as SEQ ID NO: Shown in 1, the nucleotide sequence of encoding gene is as shown in SEQ ID NO:2.Use http: // Www.ncbi.nlm.nih.gov/Blast.cgi/ carries out sequence homology analysis, compares and finds the zytase and come from The amino acid sequence of the XynSL4 (gene number: AIX48023.1) of Planococcus sp.SL4 has 72% similarity, belongs to 10 family member of glycosyl hydrolase, the XynSL4 enzyme are 244U/mg to the Rate activity of zelkova schneideriana xylan.

(2) building of the expression vector and recombinant bacterial strain of Xyn30Y5

According to nucleotide sequence shown in SEQ ID NO:2, design primer is to as follows:

Forward primer: 5 '-CTAGCTAGCTCCCCGTTTGCGGAGGAAC-3 ' (SEQ ID NO:10), underscore part For Nhe I restriction enzyme site；Reverse primer: 5 '-ACCGCTCGAGTTAATCTGCAATTGCCCAGTAGC-3 ' (SEQ ID NO: 11), underscore part is Xho I restriction enzyme site.

Using the total DNA of Bacillus sp.30Y5 as template, PCR amplification, PCR reaction system are carried out with the primer pair of design As follows (50 μ l):

PCR amplification condition are as follows: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 54 DEG C of annealing 30s, 72 DEG C of extension 1.5min, 32 circulations；Last 72 DEG C of extensions 10min.It is sequenced, is detected whether as SEQ after PCR product DNA Purification Kit Genetic fragment shown in ID NO:2.To be sequenced correct PCR product and plasmid pET28a (purchased from Novogen) through Nhe I and Xho I double digestion is simultaneously recycled through agarose electrophoresis, and two digestion products are then attached reaction, obtain recombinant plasmid, even Narrow bars part is 16 hours at 4 DEG C, and coupled reaction system is following (10 μ l):

The correct recombinant plasmid of sequence verification is named as pET28a-Xyn30Y5, and converts e. coli bl21 with it (DE3) it is coated on the LB solid plate containing 50 μ g/ml kanamycins after competent cell (Beijing Quan Shijin biotech firm), 37 DEG C are incubated overnight to obtain the recombination engineering containing pET28a-Xyn30Y5.

(3) preparation and purification of Xyn30Y5

Obtained recombination engineering is inoculated in the LB culture medium containing 50 μ g/ml kanamycins, 37 DEG C are incubated overnight Activation obtains seed liquor, is then inoculated in seed liquor in the fresh LB culture medium of 200ml (containing 50 μ g/ml by the amount of 1 volume % Kanamycins), 37 DEG C are cultivated about 3 hours to OD₆₀₀=0.6, IPTG to final concentration of 0.7mM, 37 DEG C of continuation Fiber differentiations are added 4 hours.Culture solution 8000g centrifugation 3min is collected into thallus, is suspended in 25ml solution A (20mM Tris-HCl, pH 7.9,0.5M NaCl, 10mM imidazoles) in, ultrasonication (60w, the 8min in ice bath；Ultrasonic 3s stops 3s), 9000g is centrifuged 6min and removes later Remove cell fragment.Supernatant crosses Ni-IDA HisBind Superflow purification column (Novogen), is washed with 5ml solution A, then It is rinsed with 10ml solution B (20mM Tris-HCl, pH7.9,0.5M NaCl, 30mM imidazoles), then uses 2ml solution C (20mM Tris-HCl, pH7.9,0.5M NaCl, 1M imidazoles) elution, collect eluent.By eluent desalination buffer (20mM Tris-HCl, pH7.9) in AKTA FPLC (rapid protein liquid chromatography) system desalination is carried out, obtain the Xyn30Y5 of purifying. The molecular weight of the Xyn30Y5 of SDS-PAGE electrophoresis showed purifying is about 40kDa (see Fig. 1, wherein 1 is after ni-sepharose purification Xyn30Y5,2 express the shell egg white spectra of bacterial strain BL21 (DE3) for Xyn30Y5, and 3 be the holoprotein of e. coli bl21 (DE3) Spectrum), substantially conform to theoretical value (40.8kDa).

Embodiment 2

The detection of the zymologic property of zytase (Xyn30Y5)

(1) measurement of standard enzyme vigor

The Xyn30Y5 enzyme solution (being diluted to 44.9 μ g/ml) and 196 μ l for taking 4 μ l embodiments 1 to obtain are containing 1 weight % xylan (Xylan) and 0.6mM NiCl₂PH value be 7.0 Good's buffer mix after, react 10min at 70 DEG C, be added 200 μ l dinitrosalicylic acid solution (DNS) terminates reaction, and (chief editor such as Zhang Longxiang, " biochemical test methods and techniques ", higher education goes out Version society, 1996), light absorption value of the measurement at 540nm after 5min is then reacted in boiling water bath.

Further, the method for the kinetic parameter of enzyme is measured are as follows: the various concentration substrate solution of 1-10mg/ml is prepared, Enzyme activity is measured according to the above method.Pass through Lineweaver-Burk graphing method computational dynamics parameter again.Xyn30Y5 after measured Km value be 1.1mg/ml, it is during Determination of Kinetic Parameters statistics indicate that, approached substantially when concentration of substrate is 8mg/ml Maximum enzyme activity.

(2) measurement of Xyn30Y5 optimum pH and pH stability

At 37 DEG C, Xyn30Y5 enzyme solution is carried out in the buffer of different pH value (pH 4.0-12.0) enzymatic reaction with Its optimum pH is measured, concentration of substrate is 0.2 weight %, and for remaining condition with (1), buffer used is the 50mM of pH4.0-6.0 Citrate buffer, the 50mM Good's buffer of pH 6.0-8.0, the Tris-HCl buffer of pH 8.0-9.0 and The glycine-NaOH buffer of pH9.0-12.0.As a result as shown in Fig. 2, the optimum pH of Xyn30Y5 is 7.0.

Enzyme solution is handled 12 hours at 37 DEG C in the buffer of different pH (pH 4.0-12.0), then measures enzymatic activity With the pH stability of studying enzyme, for other actual conditions with (1), buffer used is as described above.As a result as shown in figure 3, Xyn30Y5 It is very stable between pH 6.0-10.0, maintain 80% or more enzyme activity.

(3) measurement of Xyn30Y5 optimum temperature and thermal stability

In the Good's buffer solution system (NiCl containing 0.2 weight % xylan and 0.6mM of pH 7.0₂) or pH 10 Enzymatic reaction is carried out under 50mM glycine-NaOH buffer system and different temperature (30-85 DEG C) to measure Xyn30Y5 most Thermophilic degree, remaining condition is the same as (1).Enzyme optimum temperature measurement result (see Fig. 4) display, the optimum temperature of Xyn30Y5 are 70 DEG C.

Xyn30Y5 is kept the temperature under different temperatures (55-60 DEG C), then the different time points at 0-120 minutes sample survey Fixed remaining enzyme activity, other specific determination conditions draw the thermal stability curve of enzyme with (1).As a result it is shown (see Fig. 5), Xyn30Y5 is still able to maintain 95.7% enzyme activity after being heat-treated at 55 DEG C nearly 2 hours.Therefore, Xyn30Y5 has preferable heat Stability.

(4) influence of the salt ionic concentration to Xyn30Y5 vigor

By Xyn30Y5 the NaCl (0-4M) containing various concentration 0.2 weight % zelkova schneideriana xylan (Beechwood Xylan is surveyed purchased from Sigma) substrate (20mM MOPS, pH7.0) solution according to the enzyme activity determination method of above-mentioned steps (1) The enzyme activity of zytase Xyn30Y5 is determined, to measure influence of the salt ionic concentration to Xyn30Y5.As a result as shown in fig. 7, Xyn30Y5 still retains 81.6% enzyme activity under 2M salinity, and 41.0% enzyme is remained under the salinity of 4M (nearly saturation) Vigor.

(5)Ni²⁺Influence of the concentration to Xyn30Y5 enzymatic activity

By measurement different kinds of ions on the active influence of zytase Xyn30Y5, the Ni of low concentration is found²⁺It can effectively increase Its enzyme activity.Using the NiCl of various concentration₂Solution measures Ni referring to method in (1)²⁺Shadow of the concentration to the enzymatic activity of Xyn30Y5 It rings, the activity of Xyn30Y5 is in Ni as the result is shown²⁺Concentration is higher when being within the scope of 0.2-0.7mM, and reaches highest in 0.6mM.

(6) the substrate specificity measurement of Xyn30Y5

Configure that the Amy- pectin (Amy-pectin, be purchased from Sigma) of 1 weight %, (guar gum, is purchased from guar gum Aldrich chemical), sodium carboxymethylcellulose (CMC-Na, be purchased from Chinese medicines group), starch (Starch, it is odd purchased from Beijing Te Xin chemical company), chitin (Chintin, be purchased from J.T.Baker), (Beechwood xylan, is purchased from zelkova schneideriana xylan Sigma) and birch xylan (Brichwood xylan, be purchased from Sigma) solution, in standard conditions (i.e. most suitable reaction item Part: 70 DEG C, the NiCl of pH 7.0,0.6mM₂) Xyn30Y5 is measured to the hydrolysis of these glycan substrates, as a result, it has been found that the enzyme Only there is degradation to xylan.It specifically, is 397.0U/mg to the Rate activity of zelkova schneideriana xylan, to the ratio of birch xylan Vigor is 360.2U/mg, this illustrates that the catalysis specificity of Xyn30Y5 is very strong.

(7) degradation capability of the measurement Xyn30Y5 to ramie xylan

Enzyme to substrate there are Preference be one be widely recognized the fact.Zytase Xyn11A (Bai W, Xue Y, Zhou C,Ma Y.Cloning,expression,and characterization of a novel alkali- tolerant xylanase from alkaliphilic Bacillus sp.SN5.Biotechnol Appl Biochem.2015；62 (2): 208-217.doi:10.1002/bab.1265., with the similarity of Xyn30Y5 be 14.1%) and Zytase S7 (Mamo G, Delgado O, Martinez A, Mattiasson B, Hatti-Kaul R (2006) Cloning,sequence analysis,and expression of a gene encoding an endoxylanase 33:149-159. from Bacillus halodurans S7.Mol Biotechnol, the similarity with Xyn30Y5 are 63.7%) being reported under alkaline condition has high vigor.Therefore we compare both enzymes and Xyn30Y5 in degradation of ramie The enzyme activity difference of source xylan.

The preparation method of ramie xylan: taking ramie appropriate, after cleaning in the NaOH solution of 10 weight % boiling water bath 2h. After solution is cooled to room temperature (25 DEG C), its pH is adjusted to 5.0 with hydrochloric acid.Then by solution 70 volume % concentrations above work 1h is precipitated in industry ethyl alcohol, centrifugation recycling sediment is dried afterwards twice with ethanol washing.

The ramie xylan of extraction is dissolved in the glycine-NaOH buffer of 20mM, the substrate for being configured to 0.5 weight % is molten Liquid measures enzyme activity by the method for (1) under industrial application condition (37 DEG C, pH10.0).As a result as shown in figure 8, and xylan Enzyme Xyn11A compares with S7, and Xyn30Y5 is to 2.6 times and 1.5 times that the Rate activity of ramie xylan is rear the two respectively.Wood is poly- Carbohydrase Xyn30Y5 on degradation of ramie xylan substrate advantageously.

As can be seen from the above embodiments, zytase of the invention has following features:

A has higher reaction temperature and stronger thermal stability.The enzyme optimal reactive temperature is 70 DEG C, in 55 DEG C of conditions Lower processing is still able to maintain 95.7% vigor after nearly 2 hours.

B has wide pH application range.Optimum pH is 7.0, and 80% or more vigor is kept within the scope of pH6-10.

C has very strong saline-alkaline tolerance.The vigor for still retaining 81% or more under the conditions of 2M NaCl, in 4M NaCl condition The enzyme activity of lower reservation 41%.

D has stronger specificity.The enzyme only has degradation to xylan, specifically, in the concentration of substrate of 1 weight % Under, the Rate activity to zelkova schneideriana xylan is 397.0U/mg, and the Rate activity to birch xylan is 360.2U/mg.

E, under the conditions of industrial application advantageously to the degradation of ramie source xylan.By living with high under alkaline condition Property zytase Xyn11A and zytase S7 compare, Xyn30Y5 is both rear 2.6 respectively to the Rate activity of ramie xylan Times and 1.5 times.

In conclusion zytase Xyn30Y5 has good resistance, stability and higher Rate activity.In paper Slurry bleaching, detergent production, have application prospect especially in biological degumming of ramie.

The preferred embodiment of the present invention has been described above in detail, still, during present invention is not limited to the embodiments described above Detail within the scope of the technical concept of the present invention can be with various simple variants of the technical solution of the present invention are made, this A little simple variants all belong to the scope of protection of the present invention.

It is further to note that specific technical features described in the above specific embodiments, in not lance In the case where shield, can be combined in any appropriate way, in order to avoid unnecessary repetition, the present invention to it is various can No further explanation will be given for the combination of energy.

In addition, various embodiments of the present invention can be combined randomly, as long as it is without prejudice to originally The thought of invention, it should also be regarded as the disclosure of the present invention.

SEQUENCE LISTING

<110>Institute of Microorganism, Academia Sinica

<120>application of a kind of zytase and its encoding gene and they

<130> I43318ZKW

<160> 30

<170> PatentIn version 3.5

<210> 1

<211> 354

<212> PRT

<213> Bacillus sp.30Y5

<400> 1

Ser Pro Phe Ala Glu Glu Pro His Ala Leu Asp Val Thr Pro Leu His

1 5 10 15

Glu Ile Tyr Ser Asp Ile Phe Asp Ile Gly Ala Ala Val Glu Pro His

20 25 30

Gln Leu Leu Gly Glu Thr Gly Asp Val Leu Arg His His Tyr Asn Ser

35 40 45

Leu Val Ala Glu Asn Val Met Lys Pro Ile Ser Ile Gln Pro Val Glu

50 55 60

Gly Glu Phe Asp Phe Thr Glu Ala Asp Lys Leu Val Glu Phe Ala Arg

65 70 75 80

Glu Asn Asp Met Ser Leu Arg Phe His Thr Leu Ile Trp His Ser Gln

85 90 95

Val Pro Asp Trp Phe Phe Leu Asp Glu Ala Gly Asn Pro Met Val Asp

100 105 110

Ala Thr Asp Pro Val Ala Arg Glu Ala Asn Lys Val Leu Leu Leu Glu

115 120 125

Arg Leu Glu Thr His Val Arg Thr Ile Val Glu Arg Tyr Lys Asp Asp

130 135 140

Val Asp Ser Trp Asp Val Val Asn Glu Val Val Asp Asp Asn Gly Gly

145 150 155 160

Leu Arg Glu Ser Pro Trp Tyr Leu Ile Thr Gly Thr Asp Tyr Ile Arg

165 170 175

Val Ala Phe Glu Thr Ala Ala Glu Tyr Lys His Glu Asp Ala Lys Leu

180 185 190

Phe Ile Asn Asp Tyr Asn Thr Glu Val Glu Pro Lys Arg Ser Ala Ile

195 200 205

Phe Asn Leu Val Glu Glu Leu Val Glu Asp Gly Val Pro Ile Asp Gly

210 215 220

Met Gly His Gln Gly His Ile Gln Ile Gly Trp Pro Ser Leu Glu Glu

225 230 235 240

Met Glu Asp Ser Ile Glu Met Phe Ala Gly Leu Gly Leu Asp Asn Gln

245 250 255

Ile Thr Glu Leu Asp Val Ser Leu Tyr Gly Trp Pro Pro Arg Pro Ala

260 265 270

Tyr Pro Ser Tyr Asp Glu Ile Pro Met Phe Glu Phe Glu Arg Gln Ala

275 280 285

Asp Arg Tyr Asn Asp Ile Phe Glu Leu Tyr Glu Arg Gln Ser Asp Asn

290 295 300

Ile Ser Ser Val Thr Phe Trp Gly Ile Ser Asp Asn His Thr Trp Leu

305 310 315 320

Asp Asp Arg Ala Glu Glu Tyr Asn Asp Gly Ile Gly Lys Asp Ala Pro

325 330 335

Phe Val Phe Asp Val Asn Tyr Arg Val Lys Pro Ser Tyr Trp Ala Ile

340 345 350

Ala Asp

<210> 2

<211> 1062

<212> DNA

<213> Bacillus sp.30Y5

<400> 2

tccccgtttg cggaggaacc acacgcgctt gatgtgacac ctttacacga gatttactca 60

gatatttttg atatcggagc ggccgtagag cctcaccagc tattaggaga gacgggcgat 120

gtgctccgtc accattacaa tagcttagtg gccgaaaatg tgatgaagcc tatctccatt 180

cagccagttg aaggagaatt tgacttcaca gaagcagaca agctcgttga atttgcacgt 240

gagaacgata tgtcgcttcg ctttcataca ctaatttggc acagccaagt acctgactgg 300

tttttcctcg acgaagctgg aaatccaatg gtagacgcga cagatccagt cgctagagaa 360

gcaaataaag tgctccttct agagcgtctt gagacacacg taagaacaat tgttgaacgc 420

tataaagacg atgttgattc gtgggatgtc gtaaacgaag tggtggatga taatggtgga 480

cttcgtgagt caccttggta cttaattact ggcacagatt acattcgagt agccttcgag 540

accgctgccg agtataagca tgaggatgct aagctattta tcaacgatta caatacggag 600

gttgaaccga agcgctctgc tatctttaat ttagtagaag agcttgtgga agatggcgtt 660

ccaattgatg gtatgggaca tcaaggacac attcaaattg gctggccgtc attagaagag 720

atggaagact ctattgaaat gtttgccggt cttggattag ataatcaaat tacagagctt 780

gatgtgagtt tatacggatg gccacctcgc ccggcttacc caagctacga cgagattcca 840

atgtttgagt ttgaaagaca agcagatcgc tataatgata tttttgagct ttatgagcgt 900

caatcagaca atattagtag cgttaccttc tggggaatta gcgataacca tacatggtta 960

gacgatcgcg cagaagaata caacgatgga attggtaagg acgctccgtt cgtcttcgac 1020

gtcaactatc gcgtgaagcc aagctactgg gcaattgcag at 1062

<210> 3

<211> 380

<212> PRT

<213> Bacillus sp.30Y5

<400> 3

Met Ile Thr Arg Lys Thr Lys Leu Ser Val Ala Thr Gly Leu Ser Leu

1 5 10 15

Ala Leu Leu Leu Pro Thr Thr Ala Gly Ala Ser Pro Phe Ala Glu Glu

20 25 30

Pro His Ala Leu Asp Val Thr Pro Leu His Glu Ile Tyr Ser Asp Ile

35 40 45

Phe Asp Ile Gly Ala Ala Val Glu Pro His Gln Leu Leu Gly Glu Thr

50 55 60

Gly Asp Val Leu Arg His His Tyr Asn Ser Leu Val Ala Glu Asn Val

65 70 75 80

Met Lys Pro Ile Ser Ile Gln Pro Val Glu Gly Glu Phe Asp Phe Thr

85 90 95

Glu Ala Asp Lys Leu Val Glu Phe Ala Arg Glu Asn Asp Met Ser Leu

100 105 110

Arg Phe His Thr Leu Ile Trp His Ser Gln Val Pro Asp Trp Phe Phe

115 120 125

Leu Asp Glu Ala Gly Asn Pro Met Val Asp Ala Thr Asp Pro Val Ala

130 135 140

Arg Glu Ala Asn Lys Val Leu Leu Leu Glu Arg Leu Glu Thr His Val

145 150 155 160

Arg Thr Ile Val Glu Arg Tyr Lys Asp Asp Val Asp Ser Trp Asp Val

165 170 175

Val Asn Glu Val Val Asp Asp Asn Gly Gly Leu Arg Glu Ser Pro Trp

180 185 190

Tyr Leu Ile Thr Gly Thr Asp Tyr Ile Arg Val Ala Phe Glu Thr Ala

195 200 205

Ala Glu Tyr Lys His Glu Asp Ala Lys Leu Phe Ile Asn Asp Tyr Asn

210 215 220

Thr Glu Val Glu Pro Lys Arg Ser Ala Ile Phe Asn Leu Val Glu Glu

225 230 235 240

Leu Val Glu Asp Gly Val Pro Ile Asp Gly Met Gly His Gln Gly His

245 250 255

Ile Gln Ile Gly Trp Pro Ser Leu Glu Glu Met Glu Asp Ser Ile Glu

260 265 270

Met Phe Ala Gly Leu Gly Leu Asp Asn Gln Ile Thr Glu Leu Asp Val

275 280 285

Ser Leu Tyr Gly Trp Pro Pro Arg Pro Ala Tyr Pro Ser Tyr Asp Glu

290 295 300

Ile Pro Met Phe Glu Phe Glu Arg Gln Ala Asp Arg Tyr Asn Asp Ile

305 310 315 320

Phe Glu Leu Tyr Glu Arg Gln Ser Asp Asn Ile Ser Ser Val Thr Phe

325 330 335

Trp Gly Ile Ser Asp Asn His Thr Trp Leu Asp Asp Arg Ala Glu Glu

340 345 350

Tyr Asn Asp Gly Ile Gly Lys Asp Ala Pro Phe Val Phe Asp Val Asn

355 360 365

Tyr Arg Val Lys Pro Ser Tyr Trp Ala Ile Ala Asp

370 375 380

<210> 4

<211> 1140

<212> DNA

<213> Bacillus sp.30Y5

<400> 4

atgattacac gcaagacaaa attgtccgtt gctacaggtt tatcgctcgc actcttatta 60

ccgactacag ctggtgcttc cccgtttgcg gaggaaccac acgcgcttga tgtgacacct 120

ttacacgaga tttactcaga tatttttgat atcggagcgg ccgtagagcc tcaccagcta 180

ttaggagaga cgggcgatgt gctccgtcac cattacaata gcttagtggc cgaaaatgtg 240

atgaagccta tctccattca gccagttgaa ggagaatttg acttcacaga agcagacaag 300

ctcgttgaat ttgcacgtga gaacgatatg tcgcttcgct ttcatacact aatttggcac 360

agccaagtac ctgactggtt tttcctcgac gaagctggaa atccaatggt agacgcgaca 420

gatccagtcg ctagagaagc aaataaagtg ctccttctag agcgtcttga gacacacgta 480

agaacaattg ttgaacgcta taaagacgat gttgattcgt gggatgtcgt aaacgaagtg 540

gtggatgata atggtggact tcgtgagtca ccttggtact taattactgg cacagattac 600

attcgagtag ccttcgagac cgctgccgag tataagcatg aggatgctaa gctatttatc 660

aacgattaca atacggaggt tgaaccgaag cgctctgcta tctttaattt agtagaagag 720

cttgtggaag atggcgttcc aattgatggt atgggacatc aaggacacat tcaaattggc 780

tggccgtcat tagaagagat ggaagactct attgaaatgt ttgccggtct tggattagat 840

aatcaaatta cagagcttga tgtgagttta tacggatggc cacctcgccc ggcttaccca 900

agctacgacg agattccaat gtttgagttt gaaagacaag cagatcgcta taatgatatt 960

tttgagcttt atgagcgtca atcagacaat attagtagcg ttaccttctg gggaattagc 1020

gataaccata catggttaga cgatcgcgca gaagaataca acgatggaat tggtaaggac 1080

gctccgttcg tcttcgacgt caactatcgc gtgaagccaa gctactgggc aattgcagat 1140

<210> 5

<211> 5

<212> PRT

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 5

Arg Arg Arg Arg Arg

1 5

<210> 6

<211> 6

<212> PRT

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 6

His His His His His His

1 5

<210> 7

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 7

Asp Tyr Lys Asp Asp Asp Asp Lys

1 5

<210> 8

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 8

Trp Ser His Pro Gln Phe Glu Lys

1 5

<210> 9

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 9

Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu

1 5 10

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 10

ctagctagct ccccgtttgc ggaggaac 28

<210> 11

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 11

accgctcgag ttaatctgca attgcccagt agc 33

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 12

agagtttgat cctggctcag 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 13

cggttacctt gttacgactt 20

<210> 14

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 14

tgtaaaacga cggccagt 18

<210> 15

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 15

aggaaacagc tatgaccat 19

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 16

actgaaaatb gttccrcty 19

<210> 17

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<220>

<221> misc_feature

<222> (9)..(9)

<223> n is a, c, g, or t

<400> 17

accctrcant arttacttc 19

<210> 18

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 18

ctacgacgag attccaatg 19

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 19

gaaagacaag cagatcgcta t 21

<210> 20

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 20

gtcaatcaga caatattagt agc 23

<210> 21

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 21

cattggaatc tcgtcgtag 19

<210> 22

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 22

ccatccgtat aaactcacat ca 22

<210> 23

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 23

gtgtctcaag acgctctag 19

<210> 24

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<220>

<221> misc_feature

<222> (1)..(1)

<223> n is a, c, g, or t

<400> 24

ntcgastwts gwgtt 15

<210> 25

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<220>

<221> misc_feature

<222> (1)..(1)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (11)..(11)

<223> n is a, c, g, or t

<400> 25

ngtcgaswga nawgaa 16

<210> 26

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (10)..(10)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (13)..(13)

<223> n is a, c, g, or t

<400> 26

wgtgnagwan canaga 16

<210> 27

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (10)..(10)

<223> n is a, c, g, or t

<400> 27

tgwgnagwan casaga 16

<210> 28

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (10)..(10)

<223> n is a, c, g, or t

<400> 28

agwgnagwan cawagg 16

<210> 29

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (10)..(10)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (13)..(13)

<223> n is a, c, g, or t

<400> 29

sttgntastn ctntgc 16

<210> 30

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (10)..(10)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (13)..(13)

<223> n is a, c, g, or t

<400> 30

wcagntgwtn gtnctg 16

Claims

1. a kind of zytase, which is characterized in that the zytase is for (a) or (b):

(b) the amino acid sequence of label is connected in the amino terminal and/or carboxyl terminal of SEQ ID NO:1 or SEQ ID NO:3 Protein shown in column.

2. the gene that one kind can encode zytase described in claim 1.

3. gene according to claim 2, wherein the nucleotide sequence of the gene such as SEQ ID NO:2 or SEQ ID Shown in NO:4.

4. a kind of recombinant vector, which is characterized in that the recombinant vector contains gene described in claim 2 or 3.

5. a kind of recombinant bacterial strain, which is characterized in that the recombinant bacterial strain contains recombinant vector as claimed in claim 4.

6. recombinant bacterial strain according to claim 5, wherein the bacterial strain is rod bacterium or saccharomycete.

7. recombinant bacterial strain according to claim 5 or 6, wherein the bacterial strain is Escherichia coli (Escherichia Coli), bacillus subtilis (Bacillus subtilis), pichia pastoris yeast (Pichia pastoris) or wine brewing ferment Female (Saccharomyces cerevisiae).

8. a kind of method for preparing zytase, which is characterized in that method includes the following steps:

(1) recombinant bacterial strain described in any one of claim 5-7 is cultivated, the expression of the gene of encoding xylanase is induced；

(2) zytase expressed by separating-purifying.

9. a kind of composition for degradation of xylan, which is characterized in that the composition contains xylan described in claim 1 Enzyme is as active constituent, and on the basis of the total weight of the composition, the content of the zytase is 10-90 weight %.

10. zytase described in claim 1, gene described in claim 2 or 3, recombination as claimed in claim 4 carry Recombinant bacterial strain described in any one of body, claim 5-7 and composition as claimed in claim 9 are in degradation of xylan Application.