CN101457206A - Acidic xylanase XYL10A and gene and application thereof - Google Patents

Abstract

The invention relates to the genetic engineering field, especially to a strain Bispora sp.MEY-1 which produces an acidic xylanase and the acidic xylanase XYL10A got from the strain having an amino acid sequence shown as SEQ ID NO.1 or 2, a gene for coding said xylanase having a nucleotide sequence shown as SEQ ID NO.1 or 2, and application of a recombinant vector, a recombinant strain and a recombinant enzyme containing said gene. The xylanase of the invention has the following advantages: the optimum pH 2.4, the optimum temperature 80 DEG C, good pH stability and thermostability, specific activity 5437 U/mg, good protease resistance and easy for industrial fermentation production. The product of the invention can be widely used for the animal feeding-stuffs, the food, the medicament, the brewing and the energy industry as a novel enzyme preparation.

Description

A kind of acidic xylanase XYL 10 A and gene thereof and application

Technical field

The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of produce the bacterial strain Bispora sp.MEY-1 of acidic xylanase and the acidic xylanase XYL 10 A that from this bacterial classification, obtains and gene, the recombinant vectors that comprises this gene and application.

Background technology

Xylan is the important component of hemicellulose, it is that occurring in nature content is only second to the cellulosic second abundant saccharan, / 3rd (Prade.Biotech.and Gentic Engi.Rev..13 (12): 101～131,1995) that almost take up an area of the renewable organic carbon content of ball.Extensively be present in agricultural by-products such as corn cob, wheat bran, rice bran, stalk, bagasse etc., but this important renewable resources is difficult to effectively be utilized always.Zytase is the general name that xylan degrading can be become the class of enzymes of oligose and wood sugar, research to zytase just began as far back as the sixties, main research concentrates on the zytase of aspects such as being suitable for foodstuffs industry, pulp and paper industry, energy industry, has been separated to the zytase of a large amount of dissimilar difference in functionalitys from the microorganism in difference source.And isolate multiple xylanase gene, the multiple zytase product of suitability for industrialized production.

But people to the research of acidophilia zytase far away from alkalescent xylanase (Collins et al.FEMSMicrobiol Rev, 29 (1): 3-23,2005), the report of relevant acidic xylanase is fewer, and the suitableeest action pH value of most of zytases is 6～7.Acidic xylanase (pH 4.0 still keeps the high enzyme activity when following) has caused researchist's extensive concern, and the architecture basics of the generation of acidic xylanase, purifying, character, acidic character and the application in fields such as feed processing, wine industry, fruit juice processing and the energy thereof deepen continuously.

More Aspergillus sp. (the Johan et al.CurrentGenetics.28 (5): 467～473 that derives from of research in having a liking for the sourwood glycanase, 1995), Penicillium sp. (Kimura et al.Biosci Biotechnol Biochem64:1230～1237,2000), Acidobacterium sp. (Inagaki et al.Biosci.Biotechnol.Biochem.62:1061～1067,1998), Cryptococcus sp. (Iefuji et al.Biosci Biotechnol Biochem 60:1331～1338,1996) and Scytalidium acidophilum (Al Balaa et al.Biosci Biotechnol Biochem.70 (1): acidic xylanase 269～272,2006).Their genes are cloned, and express in the expression systems such as intestinal bacteria, yeast saccharomyces cerevisiae, pichia spp, but still do not have suitability for industrialized production to have a liking for the sourwood glycanase.In China, to the research of having a liking for the sourwood glycanase seldom, only cloned the minority acidic xylanase gene, the utilization genetic engineering means comes industrialization production to have a liking for sourwood glycanase product to yet there are no report.

Summary of the invention

The object of the present invention is to provide a kind of bacterial strain Bispora sp.MEY-1 that produces acidic xylanase.

Still a further object of the present invention provides the acidic xylanase that derives from above-mentioned bacterial strains.

A further object of the present invention provides the gene of above-mentioned zytase.

A further object of the present invention provides the recombinant vectors that comprises above-mentioned zytase.

A further object of the present invention provides the recombinant bacterial strain that comprises above-mentioned xylanase gene.

A further object of the present invention provides a kind of method for preparing acidic xylanase.

A further object of the present invention provides the application of above-mentioned acidic xylanase.

The present invention's technical problem at first to be solved is to overcome the deficiencies in the prior art, provide a kind of character good, be suitable in feed, food, wine brewing and energy industry using new zytase.The inventor screens a kind of natural bacterial strain, and the zytase that it produced is suitable for using in feed, food, wine brewing and energy industry.This has a liking for sour fungi Bispora sp.MEY-1, be stored in (Datun Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms common micro-organisms center on May 19th, 2008, Institute of Microorganism, Academia Sinica, 100101), its preserving number is: CGMCC No.2500.

Obtained a kind of acidic xylanase XYL 10 A from above-mentioned bacterial strains, its aminoacid sequence is shown in SEQ ID NO.1:

MSFHSLLISG LLASVAVAVP KEAWGITVTE TKTVSTTIIA TVTELGTCSS

TITSPTSDAT 60

TTTTSSATNT NPTTTLLATP QPSNWGLNNA ARADGKLWFG TAADIPGLEQ

DDRYYMKEYN 120

NTHDFGGTTP ANIMKFMFTE PEQNVFNFTG AQEFLDIAFA SHKLVRCHNL

IWQSELPTWV 180

TNPTTNWTNE TLSKVLQNHV YTLVSHFGDQ CYSWDVVNEA LSDDPAGSYQ

NNIWFDTIGP 240

EYVAMAFEYA EKAVKDHKLN VKLYYNDYNI EYPGPKSTAA QNIVKELKAR

NIQIDGVGLE 300

SHFIAGETPS QATQITNMAD FTSLDIDVAV TELDVRLYLP PNATSEAQQV

ADYYATVAAC 360

AATERCIGIT VWDFDDTYSW VPSTFAGQGY ADLFFQPDGP NTPLVKKAAY

DGCLQALQHK 420

AESP 424

Wherein, 424 amino acid of this enzyme genes encoding, N holds 18 signal peptide sequences " MSFHSLLISG LLASVAVA " that amino acid is its prediction.

Therefore, the theoretical molecular of sophisticated acidic xylanase XYL 10 A is 45.8kDa, and its aminoacid sequence is shown in SEQ ID NO.2:

VPKEAWGITV TETKTVSTTI IATVTELGTC SSTITSPTSD ATTTTTSSAT

NTNPTTTLLA 60

TPQPSNWGLN NAARADGKLW FGTAADIPGL EQDDRYYMKE YNNTHDFGGT

TPANIMKFMF 120

TEPEQNVFNF TGAQEFLDIA FASHKLVRCH NLIWQSELPT WVTNPTTNWT

NETLSKVLQN 180

HVYTLVSHFG DQCYSWDVVN EALSDDPAGS YQNNIWFDTI GPEYVAMAFE

YAEKAVKDHK 240

LNVKLYYNDY NIEYPGPKST AAQNIVKELK ARNIQIDGVG LESHFIAGET

PSQATQITNM 300

ADFTSLDIDV AVTELDVRLY LPPNATSEAQ QVADYYATVA ACAATERCIG

ITVWDFDDTY 360

SWVPSTFAGQ GYADLFFQPD GPNTPLVKKA AYDGCLQALQ HKAESP

406。

This xylanase XYL 10 A has good thermostability simultaneously and must possess high reactivity at normal temperatures, all has characteristics such as high reactivity, protease inhibitor degraded in acidity and neutral scope.The present invention screens has a liking for the zytase that sour fungi Bispora sp.MEY-1 is produced, and its optimum pH is 2.4, keeps the enzymic activity more than 50% in the scope of pH2～5; Optimum temperuture is 80 ℃, handles 10 minutes down at 80 ℃, and enzymic activity maintains more than 70%; With stomach en-and trypsin treatment 60 minutes, enzymic activity maintained 130-150%.The also unprecedented report of the zytase of this character.

The present invention also provides the gene xyl10A of the above-mentioned acidic xylanase XYL 10 A of encoding.

The complete genome sequence of this enzyme is shown in SEQ ID NO.3:

atgtctttcc?actcgcttct?aatctcaggt?cttctggcat?ctgtggctgt?ggctgtcccc 60

aaagaagctt?ggggaattac?agtgacggag?acaaaaacgg?tctccacaac?aatcatcgca 120

acagtcaccg?aattgggcac?ttgctcttcc?acaattactt?cacctaccag?tgatgctacc 180

acgacgacca?cgtctagtgc?aaccaacact?aatcctacca?cgacacttct?tgccacgccg 240

cagccttcca?attggggtct?taataatgca?gctcgagccg?atggcaagct?ttggtttgga 300

actgctgcag?atatccccgg?tttagagcag?gatgatcgct?attacatgaa?ggaatacaac 360

aatacgcatg?attttggtgg?taccacaccc?gcgaatatta?tgaaattcat?gttcacggag 420

ccagagcaaa?acgtttttaa?tttcaccggc?gcgcaggagt?tcctggacat?tgcctttgcg 480

tcgcacaagc?ttgttcgttg?ccacaatctt?atctggcaat?ccgagcttcc?cacatgggtt 540

actaacccta?ccacaaattg?gacaaacgaa?accttgagca?aggtgctaca?aaatcatgta 600

tatactctag?tctcacattt?tggagatcag?tgctatagct?gggatgtggt?taacgaagcc 660

ctctctgatg?acccagccgg?atcgtatcaa?aacaatatct?ggttcgacac?tattggtccc 720

gagtacgttg?cgatggcatt?cgagtatgcc?gagaaagccg?tcaaagacca?taagttgaat 780

gttaagctct?actacaatga?ctacaacatt?gaatatcctg?ggcccaaatc?tacagcagca 840

cagaatattg?tcaaggagct?taaagcaagg?aacatccaaa?tagatggcgt?cggccttgag 900

tcccacttca?tcggtaagtc?ctaaagcttc?tgagggaatc?ctatgttcac?aacttgatgc 960

ttacccttcc?ctagctggtg?aaactccgtc?tcaggctacg?caaatcacaa?acatggctga 1020

tttcacttct?cttgacattg?acgttgctgt?taccgagctc?gatgtacgtc?tttatctgcc 1080

tccaaatgct?accagcgagg?cccagcaagt?tgccgactat?tacgccaccg?tcgcagcctg 1140

tgctgcaaca?gaacgctgta?tcggtataac?tgtctgggat?tttgacgata?catattcatg 1200

ggtgcccagc?acgttcgccg?gccaagggta?tgcggatctg?ttcttccagc?cagacggccc 1260

caacactccc?ctagtgaaaa?aagcggcgta?cgacggttgc?ctacaggctt?tgcaacataa 1320

ggcggaaagt?ccatga 1336

The method separating clone of the present invention by PCR this xylanase gene xyl10A, the DNA complete sequence analysis is the result show, xylanase XYL 10 A structure gene xyl10A total length 1336bp, contain an intron, the long 1275bp of cDNA, + 914～+ 974bp is the intron sequences of 61bp, its cDNA sequence is shown in SEQ ID NO.4.

SEQ?ID?NO.4：

gtccccaaag?aagcttgggg?aattacagtg?acggagacaa?aaacggtctc?cacaacaatc 60

atcgcaacag?tcaccgaatt?gggcacttgc?tcttccacaa?ttacttcacc?taccagtgat 120

gctaccacga?cgaccacgtc?tagtgcaacc?aacactaatc?ctaccacgac?acttcttgcc 180

acgccgcagc?cttccaattg?gggtcttaat?aatgcagctc?gagccgatgg?caagctttgg 240

tttggaactg?ctgcagatat?ccccggttta?gagcaggatg?atcgctatta?catgaaggaa 300

tacaacaata?cgcatgattt?tggtggtacc?acacccgcga?atattatgaa?attcatgttc 360

acggagccag?agcaaaacgt?ttttaatttc?accggcgcgc?aggagttcct?ggacattgcc 420

tttgcgtcgc?acaagcttgt?tcgttgccac?aatcttatct?ggcaatccga?gcttcccaca 480

tgggttacta?accctaccac?aaattggaca?aacgaaacct?tgagcaaggt?gctacaaaat 540

catgtatata?ctctagtctc?acattttgga?gatcagtgct?atagctggga?tgtggttaac 600

gaagccctct?ctgatgaccc?agccggatcg?tatcaaaaca?atatctggtt?cgacactatt 660

ggtcccgagt?acgttgcgatggcattcgag?tatgccgaga?aagccgtcaa?agaccataag 720

ttgaatgtta?agctctacta?caatgactac?aacattgaat?atcctgggcc?caaatctaca 780

gcagcacaga?atattgtcaa?ggagcttaaa?gcaaggaaca?tccaaataga?tggcgtcggc 840

cttgagtccc?acttcatcgc?tggtgaaact?ccgtctcagg?ctacgcaaat?cacaaacatg 900

gctgatttca?cttctcttga?cattgacgtt?gctgttaccg?agctcgatgt?acgtctttat 960

ctgcctccaa?atgctaccag?cgaggcccag?caagttgccg?actattacgc?caccgtcgca 1020

gcctgtgctg?caacagaacg?ctgtatcggt?ataactgtct?gggattttga?cgatacatat 1080

tcatgggtgc?ccagcacgtt?cgccggccaa?gggtatgcgg?atctgttctt?ccagccagac 1140

ggccccaaca?ctcccctagt?gaaaaaagcg?gcgtacgacg?gttgcctaca?ggctttgcaa 1200

cataaggcgg?aaagtccatg?a 1221

Wherein, the base sequence of signal peptide is: ATGTCTTTCC ACTCGCTTCT AATCTCAGGTCTTCTGGCAT CTGTGGCTGT GGCT.

The maturation protein theoretical molecular is 45.8kDa.Xylanase gene xyl10A cDNA sequence and the aminoacid sequence derived are carried out the BLAST comparison in GenBank.What discovery linked to each other with signal peptide is one section zone (19～57 amino acid) of being rich in Serine and Threonine, there be not to find the sequence consistent in the comparison with this district's protein sequence, removing after this section sequence with the zytase D nucleotide sequence consistence that derives from Penicillium funiculosum is 57.1%, and consensus amino acid sequence is 45.7%.The transformation of gene and in various heterologous gene expression systems, efficiently express the genetic material that provides good for this reason.Illustrate that XYL10A is a kind of new zytase.

The present invention also provides the recombinant vectors that comprises above-mentioned xylanase gene, is preferably pPIC9-xyl10A.Xylanase gene of the present invention is inserted between the suitable restriction enzyme site of expression vector, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, be preferably xylanase gene is inserted between the EcoR I and NotI restriction enzyme site on the plasmid pPIC9, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulated and control by it, obtain expression of recombinant yeast plasmid pPIC9-xyl10A.

The present invention also provides the recombinant bacterial strain that comprises above-mentioned xylanase gene, is preferably recombinant bacterial strain GS115/xyl10A.

The present invention also provides a kind of method for preparing acidic xylanase, may further comprise the steps:

1) with claim recombinant vectors transformed host cell, gets recombinant bacterial strain;

2) cultivate recombinant bacterial strain, induce the expression of recombined xylanase; And

3) reclaim the also expressed zytase of purifying.

Wherein, preferred described host cell is pichia spp cell, cerevisiae or many types of inferior yeast cell, preferably the expression of recombinant yeast plasmid is transformed pichia spp cell (Pichic pastoris) GS115, obtains recombinant bacterial strain GS115/xyl10A.

The present invention also provides the application of above-mentioned acidic xylanase.

Zytase optimal pH of the present invention is 2.4, in pH2.0～6.0 higher enzymic activity is arranged all; Heat stability is good can satisfy the normal diet granulating process; Ability with fabulous protease inhibitor.Meet animal digestion physilogical characteristics, pH subject range raising feed digestible energy and metabolizable energy, reduce formulation cost, reduce environmental pollution; Improve the nutritive value of cereal processed side product, promote the feeds product quality.This zytase can be applicable to wine industry, reduces material viscosity, can help diastatic action in starch layer, improves starch utilization ratio, increases the productive rate of alcohol.Xylan in paper industry waste material and the agricultural wastes can also be converted into D-wood sugar monomer, and the D-wood sugar can be changed into valuable fuel by bacterium, yeast and fungi.Therefore, the application of this zytase in energy industry also demonstrates its great potential.Hydrolysate (wood sugar and xylo-oligosaccharide) can be applicable to food service industry, as thickening material, fatty quid pro quo and freeze proof foodstuff additive; Xylan is used in combination with other material in pharmaceutical industry, can delay the release of pharmaceutical cpd.The hydrolysate of xylan can also further be converted into liquid fuel, single cell protein, solvent and low calorie sweetener.

Description of drawings

The present inventor's separation obtains having a liking for sour fungi Bispora sp.MEY-1, be stored in (Datun Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms common micro-organisms center on May 19th, 2008, Institute of Microorganism, Academia Sinica, 100101), its preserving number is: CGMCC No.2500.

The SDS-PAGE of the zytase that Fig. 1 xyl10A expresses in pichia spp analyzes, and 1, molecular weight standard; 2, the fermentation culture supernatant; 3, the recombined xylanase of purifying.

The optimum pH of Fig. 2 recombined xylanase of the present invention.

The pH stability of Fig. 3 zytase of the present invention.

Fig. 4 zytase optimal reactive temperature of the present invention.

Fig. 5 zytase thermostability of the present invention.

Enzyme behind Fig. 6 protease treatment zytase of the present invention curve (A) alive and SDS-PAGE analyze (B),

1, molecular weight standard; 2, xylanase XYL 10 A; 3, the XYL10A after the trypsin treatment; 4, trypsinase; 5,6, the XYL10A after the pepsin; 7, stomach en-.

Embodiment

Test materials and reagent

1, bacterial strain and carrier: Bispora sp.MEY-1 separates acquisition by the inventor, and yeast expression vector pPIC9 and bacterial strain GS115 are available from Invitrogen company.

2, enzyme and other biochemical reagents: restriction endonuclease is available from TaKaRa company, and ligase enzyme is available from Invitrogen company.The oat xylan is available from Sigma company, and other all is domestic reagent (all can buy from common biochemical reagents company and obtain).

3, substratum:

(1) Bispora sp.MEY-1 substratum is the potato juice substratum: 1000mL potato juice, 10g glucose, 25g agar, pH2.5.

(2) intestinal bacteria substratum LB (1% peptone, 0.5% yeast extract, 1% NaCl, pH7.0).

(3) BMGY substratum: 1% yeast extract, 2% peptone, 1.34%YNB, 0.00004% Biotin, 1% glycerine (V/V).

(4) BMMY substratum: replace glycerine divided by 0.5% methyl alcohol, all the other compositions are all identical with BMGY, pH4.0.

Illustrate: make the experimental methods of molecular biology specify in following examples, all carry out, perhaps carry out according to test kit and product description with reference to listed concrete grammar in " molecular cloning experiment guide " (third edition) J. Sa nurse Brooker one book.

Sour fungi Bispora sp.MEY-1 is had a liking in embodiment 1 separation

Uranium ore wastewater sample (enrichment medium: (NH after enrichment culture in ore deposit, Jiangxi will be derived from ₄) ₂SO ₄5g/L, KH ₂PO ₄1g/L, MgSO ₄7H ₂O 0.5g/L, FeSO ₄7H ₂O 0.01g/L, CaCl ₂0.2g/L, corn cob meal 0.5%, wheat bran 0.5% pH2.5), is coated after the dilution routinely and is produced enzyme substratum ((NH ₄) ₂SO ₄5g/L, KH ₂PO ₄1g/L, MgSO ₄7H ₂O 0.5g/L, FeSO ₄7H ₂O 0.01g/L, CaCl ₂0.2g/L xylan 1%, 1.5% agarose pH2.5) on the flat board, is cultivated 5～6d for 30 ℃, picking produces the transparent circle bacterium colony and is producing enzyme culture medium flat plate line separation, and the sepn process 3 that repeats to rule is taken turns, and makes the bacterial strain purifying.Screen the bacterial strain of this secretion zytase by this method.

This bacterial strain is cultivated 7d colony diameter 2～3cm under 30 ℃ on PDA, grey black or beige, and rounded radial, there is velvet-like gauffer on the surface and is not easy to provoke.Conidiophore is upright, (6～9) μ m * (10～13) μ m.The top produces chain and gives birth to spore, conidium have every, 0～1 every, oval to fusiform, no branch, brown to dark-brown, (5～8.25) μ m * (10～19) μ m.Its suitableeest growth pH is 2.5～3.0,30 ℃ of optimum temperutures.This has a liking for sour fungi Bispora sp.MEY-1, be stored in (Datun Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms common micro-organisms center on May 19th, 2008, Institute of Microorganism, Academia Sinica, 100101), its preserving number is: CGMCC No.2500.

Embodiment 2 has a liking for the clone of sour fungi Bispora sp.MEY-1 Xylanase coding gene xyl10A

Sour fungi Bispora sp.MEY-1 genomic dna is had a liking in extraction:

3 days mycelium of liquid culture is put into mortar with the aseptic filter paper filtration, add the 2mL extracting solution, grind 5min, then lapping liquid is placed the 50mL centrifuge tube, 65 ℃ of water-bath cracking 20min, every the 10min mixing once, at 4 ℃ of centrifugal 5min of following 10000rpm.Get supernatant extrct foreigh protein removing in phenol/chloroform, get supernatant again and add the equal-volume Virahol, after room temperature leaves standstill 5min, 4 ℃ of centrifugal 10min of following 10000rpm.Abandon supernatant, precipitation is with 70% washing with alcohol twice, and vacuum-drying adds an amount of TE and dissolves, place-20 ℃ standby.

Conservative (WDVVNEA and NDY (F) NL (I) EY) sequences Design according to the tenth family's xylanase gene has been synthesized degenerated primer P1, P2

P1：5′-TGGGA(C/T)GT(A/G/C/T)GT(A/G/C/T)AA(C/T)GA(A/G)GC-3′；

P2：5′-TA(C/T)TCTAT(A/G)TT(A/G)WA(A/G)TC(A/G)TT-3′)。

To have a liking for the total DNA of sour fungi Bispora sp.MEY-1 is that template is carried out pcr amplification.The PCR reaction parameter is: 94 ℃ of sex change 3min; 94 ℃ of sex change 30sec then, 46 ℃ of annealing 30sec, 72 ℃ are extended 1min, 32 back 72 ℃ of insulation 10min of circulation.Obtain an about 180bp fragment, this fragment recovery back is linked to each other with the pEASY-T3 carrier send the order-checking of three rich Bioisystech Co., Ltd.

According to the nucleotide sequence that order-checking obtains, each three TAIL-PCR Auele Specific Primer of design upstream and downstream: design direction is for needing the zone of ignorance direction of amplification, and the Position Design of sp2 is in the inboard of sp1, and sp3 is positioned at the inboard of sp2.Distance between per two primers does not have strict regulation, the general 22～30nt of primer length, and annealing temperature is at 60～65 ℃.And with they difference called after usp1, usp2, usp3 (upstream Auele Specific Primer), dsp1, dsp2, dsp3 (downstream Auele Specific Primer) sees Table 1.

Table 1. xylanase XYL 10 A TAIL-PCR Auele Specific Primer

Obtain the flanking sequence of known sequence by reverse TAIL-PCR, amplification obtains sending after product reclaims the order-checking of three rich Bioisystech Co., Ltd.

The RT-PCR of embodiment 3 xylanase genes analyzes

Extract total RNA of Bispora sp.MEY-1, utilize ThermoScript II to obtain the chain of cDNA, design then appropriate primer (Xyl10AF:5 '-ATGTCTTTCCACTCGCTTCTAATCTCAGGTCTTC-3 ', Xyl10AR:5 '-TCATGGACTTTCCGCCTTATGTTGCAAAGCC-3 ') this strand cDNA that increases, obtain the cDNA sequence of zytase, amplification obtains sending after product reclaims the order-checking of three rich Bioisystech Co., Ltd.

Find that this gene has 1 intron after genome sequence by zytase relatively and the cDNA sequence, the long 1275bp of cDNA, encode 424 amino acid and a terminator codon, N holds 18 signal peptide sequences that amino acid is its prediction.The maturation protein part nucleotide sequence of measured gene xyl10A and the xylanase gene sequence on the GeneBank are carried out homology relatively, the highest consistence is 57.1%, the highest consistence of aminoacid sequence is 45.7%, and the gene that proves the coding zytase that separating clone obtains from Bispora sp.MEY-1 is new gene.

The preparation of embodiment 4 recombined xylanases.

Expression vector pPIC9 is carried out double digestion (EcoRI+NotI), to encode the simultaneously gene xyl10A double digestion (EcoRI+NotI) of zytase, the gene fragment that cuts out the encoding mature zytase is connected with expression vector pPIC9, acquisition contains the recombinant plasmid pPIC-xyl10A of Bispora sp.MEY-1 xylanase gene xyl10A and transforms pichia spp GS115, obtains recombinant pichia yeast strain GS115/xyl10A.

Get the GS115 bacterial strain that contains recombinant plasmid, be inoculated in the 400mL BMGY nutrient solution, behind 30 ℃ of 250rpm shaking culture 48h, centrifugal collection thalline.Resuspended in 200mL BMMY substratum then, 30 ℃ of 250rpm shaking culture.After inducing 48h, centrifugal collection supernatant.Measure the vigor of zytase.The expression amount of recombined xylanase is 101U/mL.SDS-PAGE result (Fig. 1) shows that recombined xylanase has obtained expression in pichia spp.Expressed zytase is through after the purifying, and its Protein content reaches more than 90% (Fig. 4) of total protein.

The activation analysis of embodiment 5 recombined xylanases

The DNS method: concrete grammar is as follows: at pH2.4, under 80 ℃ of conditions, the reaction system of 1mL comprises 100 μ L suitable dilution enzyme liquid, 900 μ L substrates, and reaction 10min adds 1.5mL DNS termination reaction, and boiling water boils 5min.Cooling back 540nm measures the OD value.1 enzyme unit (U) that lives is defined as the enzyme amount that under given condition per minute discharges 1 μ mol reducing sugar.

The property testing of embodiment 6 recombined xylanase XYL10A

1, the measuring method of the optimal pH of recombined xylanase XYL10A and pH stability is as follows:

The recombined xylanase of embodiment 4 purifying is carried out enzymatic reaction to measure its optimal pH under different pH.The substrate xylan carries out Xylanase activity mensuration under in 0.1mol/L citric acid-Sodium phosphate dibasic damping fluid of different pH 80 ℃.Result (Fig. 2) shows that the optimal pH of XYL10A is 2.4, and in the scope of pH2～5, enzymic activity all maintains more than 50% of maximum enzyme activity.Zytase is 37 ℃ of processing 60min in the damping fluid of above-mentioned various different pH, measure enzymic activity again under 80 ℃ in the pH2.4 buffer solution system, with the pH patience of research enzyme.Result (Fig. 3) shows that zytase is stable in the scope of pH1～7, illustrates that this enzyme has acid resistance preferably.

2, the optimum temperuture of zytase and thermal stability determination method are as follows:

Enzymatic reaction is carried out in being determined as under citric acid-Sodium phosphate dibasic damping fluid (pH2.4) buffer solution system and differing temps of the optimum temperuture of zytase.Temperature tolerance is determined as zytase and handles different time under differing temps, carries out enzyme assay again under 65 ℃.Enzyme reaction optimum temperuture measurement result (Fig. 4) shows that its optimum temperuture is 80 ℃.The thermostability test of enzyme shows (Fig. 5), and behind 80 ℃ of processing 10min, residual enzyme is lived and also had about 70%, and behind the processing 20min, enzymic activity still maintains more than 55%.

3, the K of zytase _mValues determination method is as follows:

Xylan (4-O-Me-D-glucurono-D-xylan, Sigma From birchwood) with different concns is a substrate, in citric acid-Sodium phosphate dibasic damping fluid (pH2.4) buffer solution system, measures enzymic activity down, calculates its k under 80 ℃ for 80 ℃ _mValue.After measured, this zytase is the k of substrate with the xylan under 80 ℃ _mValue is 1.005mg/mL,, maximum reaction velocity V _MaxBe 2709 μ mol/minmg.

4, different metal ion chemistry reagent is as follows to XYL10A enzyme influence mensuration alive:

Add the different metal ions and the chemical reagent of different concns in enzymatic reaction system, study its influence to enzymic activity, various material final concentrations are 1,5 and 10mmol/L.Under 80 ℃, pH2.4 condition, measure enzymic activity.Result's (table 2) shows, the Cr of lower concentration ³⁺, Ag ⁺With beta-mercaptoethanol xylanase XYL 10 A there is tangible activation.The Zn of lower concentration ², ⁺Cu ²⁺, Pb ³⁺, Mn ²⁺, Hg ²⁺Work has certain restraining effect to enzyme with SDS.The enzymatic reaction to XYL10A when lower concentration of all the other metal ions does not make significant difference.The Cr of high density ³⁺Work has tangible activation to enzyme with beta-mercaptoethanol.The Ca of high density ²⁺, Mg ²⁺, Co ²⁺And Zn ²⁺Work has certain restraining effect to enzyme.The Cu of high density ²⁺, Ni ²⁺, Fe ³⁺And Pb ³⁺Work has very strong restraining effect, Hg to enzyme ²⁺Can make the enzyme complete deactivation with SDS.Other ions enzyme of high density is lived influence not quite.

The various chemical reagent of table 2. are to the influence of xylanase XYL 10 A vigor

Annotate: "-" representative can't detect.

5, zytase antipepsin and trypsinase ability are measured as follows:

With pH2.0 KCl-HCl damping fluid preparation 0.1mg/mL stomach en-, pH7.0 Tris-HCl damping fluid preparation 0.1mg/mL trypsinase.The enzyme liquid of getting the 0.5mL purifying after pH2.0 KCl-HCl damping fluid dilutes adds the 0.5mL stomach en-, the enzyme liquid of the 0.5mL purifying after the dilution of pH7.0 Tris-HCl damping fluid adds 0.5mL trypsinase and mixes, proteolytic enzyme/zytase (w/w) ≈ 0.1,37 ℃ of insulations 0,2,5,8,10,20,30 and 60min sampling are measured enzymic activity under pH2.4 and 80 ℃ of conditions.After experimental result shows that xylanase XYL 10 A is with stomach en-and trypsin treatment 60min, and all increases to some extent of the vigor of zytase (Fig. 6-A).The enzyme of XYL10A after the pepsin is lived and improved 30% before being handled, and the xylanase activity of the XYL10A after the trypsin treatment has improved 50% before handling.Xylanase XYL 10 A after stomach en-and the trypsin treatment is through the SDS-PAGE analysis revealed: the molecular weight of the XYL10A after the trypsin treatment slightly reduces.The molecular weight of XYL10A after the pepsin (Fig. 6-B) that do not change substantially.

6, being analyzed as follows of zytase degraded oat xylan product:

In the xylan of 500 μ L 1%, add the enzyme liquid of 100 μ L purifying, be incubated 3～4h under the optimum temperuture.With dehydrated alcohol zymoprotein is precipitated, supernatant liquor 2500 chromatographic instruments utilize high performance anion exchange chromatography-pulse ampere (HPAEC-PAD) detection method, carry out the analysis of sugar type in the product.Analytical results shows: the product of xylanase XYL 10 A degraded oat xylan mainly is wood sugar and xylo-bioses.Wood sugar content is 72.23% in the product, and xylobiose content is 27.77%.

Sequence table

＜110〉Institute of Feeds,China Academy of Agriculture Sciences

＜120〉a kind of acidic xylanase XYL 10 A and gene thereof and application

<160>4

<210>1

<211>424

<212>PRT

＜213〉fungi (Bispora sp.MEY-1)

<400>1

<210>2

<211>406

<212>PRT

＜213〉fungi (Bispora sp.MEY-1)

<400>2

<210>3

<211>1336

<212>DNA

＜213〉fungi (Bispora sp.MEY-1)

<400>3：

<210>4

<211>1221

<212>DNA

＜213〉fungi (Bispora sp.MEY-1)

<400>4：

Claims (12)

1, a kind ofly have a liking for sour fungi Bispora sp.MEY-1, its preserving number is: CGMCC No.2500.

2, a kind of acidic xylanase XYL 10 A is characterized in that, its aminoacid sequence is shown in SEQ ID NO.1.

3, a kind of acidic xylanase XYL 10 A is characterized in that, its aminoacid sequence is shown in SEQ ID NO.2.

4, a kind of acidic xylanase gene xyl10A is characterized in that, coding claim 2 or 3 described zytases.

5, xylanase gene xyl10A as claimed in claim 4 is characterized in that, its base sequence is shown in SEQID NO.3.

6, xylanase gene xyl10A as claimed in claim 4 is characterized in that, its base sequence is shown in SEQID NO.4.

7, the recombinant vectors that comprises claim 4,5 or 6 described xylanase genes.

8, the recombinant vectors pPIC9-xyl10A that comprises claim 4,5 or 6 described xylanase genes.

9, the recombinant bacterial strain that comprises claim 4,5 or 6 described xylanase genes.

10, a kind of method for preparing acidic xylanase XYL 10 A is characterized in that, may further comprise the steps:

1) with claim 7 recombinant vectors transformed host cell, gets recombinant bacterial strain;

2) cultivate recombinant bacterial strain, induce the expression of recombined xylanase; And

3) reclaim the also expressed xylanase XYL 10 A of purifying.

11, method as claimed in claim 10 is characterized in that, described host cell is pichia spp cell, cerevisiae or many types of inferior yeast cell.

12, the application of claim 2 or 3 described acidic xylanase XYL 10 As.

Images