CN108424922A - It is a kind of reduce nicotine conversion ratio CYP82E10 gene missense mutant M271 and its application - Google Patents
It is a kind of reduce nicotine conversion ratio CYP82E10 gene missense mutant M271 and its application Download PDFInfo
- Publication number
- CN108424922A CN108424922A CN201810360474.5A CN201810360474A CN108424922A CN 108424922 A CN108424922 A CN 108424922A CN 201810360474 A CN201810360474 A CN 201810360474A CN 108424922 A CN108424922 A CN 108424922A
- Authority
- CN
- China
- Prior art keywords
- cyp82e10
- conversion ratio
- gene
- nicotine
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Abstract
The invention discloses a kind of nicotine conversion ratiosCYP82E10Gene missense mutant M271 and its application.The reduction nicotine conversion ratioCYP82E10Gene missense mutant M271 is classified as relative to nucleotides sequence shown in SEQ ID NO.1CYP82E10Gene, the reduction nicotine conversion ratioCYP82E10Gene missense mutant M271 containsCYP82E10385 C are replaced by T in gene order has occurred point mutation, the reduction nicotine conversion ratioCYP82E10The nucleotide sequence of gene missense mutant M271 is as shown in SEQ ID NO.2.Using for the described reduction nicotine conversion ratioCYP82E10Applications of the gene missense mutant M271 in the tobacco plant for obtaining nicotine low-conversion.Reduction nicotine conversion ratio of the present inventionCYP82E10In 87 material of cloud and mist that gene missense mutant M271 is obtained, blade nicotine conversion ratio declines about 62% than control respectively, significantly reduces the conversion ratio of nicotine.
Description
Technical field
The invention belongs to genetic engineering technology fields, and in particular to a kind of to reduce nicotine conversion ratioCYP82E10Gene
Missense mutant M271 and its application.
Background technology
Nicotine（nicotine）, nornicotine（nornicotine）, anabasine（anabasine）And new cigarette
Alkali（anatabine）It is tobacco（Nicotiana tobacum）In main alkaloid, wherein nicotine is primary biology
Alkali accounts for the 90-95% of biological total alkali content, and nornicotine content is usually less than the 3.5% of total alkaloid, is that nicotine passes through
Demethylation is converted into.Nornicotine can generate harm to health, and it is cigarette cigarette to be mainly manifested in it
Potential carcinogen matter nitroso nornicotine in gas（nitrosonornicotine, NNN）Synthesis precursor, may lead
Cause the generation of the cancer of the esophagus, carcinoma of mouth.Nornicotine also can directly induce the Aberrant glycosylation of albumen in smoker's blood plasma,
Some researches show that it covalent reaction occurs with common steroid drugs, influences drug effect and toxicity.Therefore, nicotine is reduced to turn
Metaplasia reduces the important goal that nicotine conversion ratio is tobacco harm reduction at nornicotine.
There are two types of the tobacco extensive use in production of type, burley tobaccos and flue-cured tobaccos, wherein burley tobaccos production master in the world
Flue-cured tobacco is mainly planted in western developed country and South America, China.Burley tobaccosCYP82E2SubfamilyCYP82E4、CYP82E5、CYP82E10Gene can encode active nicotine demethyl enzyme, be the key enzyme of nicotine conversion.
Gavilano etc. inhibits burley tobaccos strong " transformant " by RNAi technologyCYP82E4And its expression of homologous gene, demethyl Buddhist nun
Gu Ding synthesis is significantly inhibited, nicotine conversion ratio minimum only 0.8%, even lower than " non-turn of burley tobaccos of transfer-gen plant
The conversion ratio of the universal about 3-5% of change strain ".Julio et al. screened in 1132 EMS mutagenic mutants obtain 10 plantsCYP82E4The tobacco of point mutation occurs for locus, and wherein nicotine conversion ratio is down to extremely in nonsense mutation and missense mutation strain
Minor levels.Lewis et al. is obtained respectively with the method for EMS mutagenesisCYP82E4、CYP82E5、CYP82E10It mutates
Burley tobaccos material is foundCYP82E5、CYP82E10Gene mutation does not influence nicotine conversion ratio, three gene simultaneous mutations
Nicotine conversion ratio is well below control strain in mutant strain.The studies above shows in burley tobaccosCYP82E4It is to determine that nicotine turns
The key gene of rate,CYP82E5、CYP82E10Gene has no significant effect.
Flue-cured tobacco is the primary raw material of Chinese-style cigarette, reduces its nicotine conversion ratio and then reduces NNN content centering type cigarette
Harm reduction is significant.But the research so far about the synthesis of flue-cured tobacco nornicotine is less, the conjunction of flue-cured tobacco and burley tobaccos
At mechanism, unanimously whether how there is no literature reported on reduce flue-cured tobacco nicotine conversion ratio and still need to explore at present.
Invention content
The first object of the present invention is to provide a kind of nicotine conversion ratio that reducesCYP82E10Gene missense mutant
M271；Second is designed to provide the reduction nicotine conversion ratioCYP82E10Gene missense mutant M271's answers
With.
The first object of the present invention is achieved in that the reduction nicotine conversion ratioCYP82E10Gene missense
Mutant M271 is classified as relative to nucleotides sequence shown in SEQ ID NO.1CYP82E10Gene, the reduction nicotine turn
RateCYP82E10Gene missense mutant M271 containsCYP82E10385 C are replaced by T in gene order has occurred
Point mutation, the reduction nicotine conversion ratioCYP82E10The nucleotide sequence of gene missense mutant M271 such as SEQ ID
Shown in NO.2.
The second object of the present invention is achieved in that the reduction nicotine conversion ratioCYP82E10Gene missense
Applications of the mutant M271 in the tobacco plant for obtaining nicotine low-conversion.
Reduction nicotine conversion ratio of the present inventionCYP82E10The cloud and mist 87 that gene missense mutant M271 is obtained
In material, blade nicotine conversion ratio declines about 62% than control respectively, significantly reduces the conversion ratio of nicotine.
Description of the drawings
Fig. 1 isCYP82E10Gene mutation capillary electrophoresis detection；
Fig. 2 compares for mutant material M271 sequencing results；
Fig. 3 is the sequencing peak figure of mutant material；
Fig. 4 analyzes for mutant material nicotine conversion ratio.
Specific implementation mode
With reference to embodiment and attached drawing, the present invention is further illustrated, but is not subject in any way to the present invention
Limitation, based on present invention teach that made by it is any transform or replace, all belong to the scope of protection of the present invention.
Reduction nicotine conversion ratio of the present inventionCYP82E10Gene missense mutant M271 is relative to nucleotide
Sequence is shown in SEQ ID NO.1CYP82E10Gene, the reduction nicotine conversion ratioCYP82E10Gene missense
Mutant M271 containsCYP82E10385 C are replaced by T in gene order has occurred point mutation, and the reduction Buddhist nun is ancient
Fourth conversion ratioCYP82E10The nucleotide sequence of gene missense mutant M271 is as shown in SEQ ID NO.2.
The reduction nicotine conversion ratioCYP82E10The amino acid sequence of gene missense mutant M271 codings is such as
Shown in SEQ ID NO.3.
Reduction nicotine conversion ratio of the present inventionCYP82E10The application of gene missense mutant M271 is described
Reduce nicotine conversion ratioCYP82E10Gene missense mutant M271 is in the tobacco plant for obtaining nicotine low-conversion
Application.
Embodiment 1
Flue-cured tobacco mutant library is formulated
One, tobacco seed EMS processing
Flue-cured tobacco（Kind：Cloud and mist 87）It is quickly clear with deionized water after seed is impregnated 12 minutes with 50% commercial goods bleaching liquid
It washes, and impregnates 12 hours in deionized water.Ionized water is discarded, isometric 0.5% EMS is added（Ethylmethane sulfonate）Processing 12
Hour.Treatment fluid is abandoned, deionized water is added and cleans 6-8 times, every time about 1 minute.Seed collection is drained for use in Buchner funnel.
Two, M1 plant field planting
The EMS seeds that are disposed are seeded in floating disc, and per one, cave seed, transplanting is to field, normal agronomic measures pipe after emergence
Reason.Single plant bagging number sowing obtains M2 seeds after buddingging.
Three, mutant gene group DNA extractions and sample mixing
Genomic DNA is extracted using kit, steps are as follows：
Weigh the fresh samples of 0.1g, liquid nitrogen grinding, it is fine crushing after, be transferred in 2.0 ml sample cells, be added immediately 600 μ L AP1 buffer solutions and
4 μ L RNaseA store liquid（100 mg/ml）.Water bath processing 10 minutes in 65 DEG C, during which overturn EP pipes 2-3 times.190 μ L are added
AP2 buffer solutions, mixing are placed in 5 minutes on ice, and 14000 rpm room temperatures centrifuge 5 minutes.Aspirate supernatant is to QIAshredder
Mini columns, 14000 rpm room temperatures centrifuge 2 minutes.It takes in 450-650 μ L filtered fluids to 2.0ml centrifuge tubes, adds 675-900
The buffer solution A P3/E of μ L.In the DNeasy columns for taking 650 μ L mixtures to 2 ml, room temperature is centrifuged 1-2 minutes with >=8000rpm.It will
Above-mentioned DNeasy columns are put into 2 new ml collecting pipes, and 500 μ L AW buffer solutions are added, and are centrifuged 2 minutes with >=8000rpm,
Efflux is abandoned, then primary with AW buffer solution repeated washings.DNeasy columns are placed in 1.5 ml centrifuge tubes, 100 μ L AE are added
Buffer solution is placed at room temperature for 5 minutes, and centrifugation gained filtrate is genomic DNA.
About 2200 parts of M2 of field planting acquire blade and extract genome using the above method for EMS mutant plants
All samples DNA concentration is diluted to 40 ng/ μ l by DNA, finally establishes DNA libraries of the M2 for 87 mutant of cloud and mist, every 8 parts of DNA
Sample mixing constitutes 8 times of mixing pits, is stored in 96 orifice plates.
Embodiment 2
CYP82E10Gene mutation body screens
One, Tilling primers
CYP82E10There are two exons for gene, utilize the mutant of first exon region of Tilling technology screenings.According to
Mesh gene genome sequence,
Forward primer isCYP82E10_Tilling_F：GTCAAATACCACCTCTTAATAGTAA,
Reverse primer isCYP82E10_Tilling_R：AAAAGTCCCTATTGGTAGGAAGTGC.
Two, PCR amplification condition
PCR reaction systems are as follows：Total volume is 10 μ L, wherein 20 ng/ μ L DNA samples, 1.0 μ L, 10 × PCR buffer
1.0 0.8 μ L of μ L, dNTPs, 0.1 6.78 μ L of μ L, ddH2O of each 0.16 μ L, Taq DNA enzymatic of primer.
PCR response procedures are as follows：95 DEG C of pre-degenerations 3 minutes；94 DEG C are denaturalized 30 seconds, and 62 DEG C are annealed 30 seconds（Each follow
Ring declines 1 DEG C）, 72 DEG C extend 90 seconds, run 7 cycles；94 DEG C are denaturalized 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 DEG C extend 90
Second, run 40 cycles；Last 72 DEG C extend 5 minutes.PCR amplified productions can be preserved at 4 DEG C.
Three, PCR product digestion and electrophoresis
The characteristic that heteroduplex is cut using CEL I enzyme spcificitys carries out digestion to PCR product, and digestion system is as follows：PCR is produced
41 μ L, CEL I enzymes of μ L, 10 × buffer of object, 0.5 μ L supplement H2O to total volume be 10 μ L.Digestion system utilizes automatic hair
Cons electrophoresis system is detached, and separation condition is as follows：Sample loading voltage is 9KV, the loading electricity of loading 30 sec, Marker
Pressure is 7.5KV, loading 5sec, prerunning voltage 9KV, 9 kv of separation electrophoresis voltage, 80 min of run time, electrophoresis result use
2.0 softwares of Prosize are analyzed.Tilling screenings obtain 11 mutant strains altogether, and M271 single plants occur P129L mutation, as a result see
Table 1 and Fig. 1.
In 1 cloud and mist of table, 87 mutant libraryCYP82E10Gene mutation body is analyzed
Embodiment 3
CYP82E10Gene missense mutation is verified
One, M3 is for mutant gene group DNA extractions and PCR amplification
According to M2 for plant Tilling the selection results, selectionCYP82E10The seed of gene target region mutation single plant（M3
Generation）, sowed in seedlings nursing plate.Seedling leaves genomic DNA is extracted using RNA isolation kit.WithCYP82E10_ Tilling_F andCYP82E10_ Tilling_R primers, using genomic DNA as template amplificationCYP82E10First exon region of gene.PCR
Reaction system is as follows：Total volume is 25 μ L, wherein 20 ng/ μ L DNA samples, 1.0 μ L, 10 × PCR buffer, 2.5 μ L,
2 μ L of dNTPs, primer each 0.5 μ L, Taq DNA enzymatic 0.3 μ L, ddH2O 18.2 μL.PCR response procedures are as follows： 95℃
Pre-degeneration 3 minutes；94 DEG C are denaturalized 30 seconds, and 55 DEG C are annealed 30 seconds（Each cycle declines 1 DEG C）, 72 DEG C extend 90 seconds, operation
30 cycles；72 DEG C extend 5 minutes.PCR amplified productions can be preserved at 4 DEG C.
Two, PCR product TOPO clones and sequencing
PTOPO carriers are connected after PCR product recycling（Invitrogen）, system is as follows：PCR product 4 μ L, pCR-BluntII-
1 μ L, salt Solution of TOPO plasmids, 1 μ L.25 DEG C of incubation 30min of reactive component, turn to mix in E.coli. competent cells
It is even, it is immediately placed in 2min in ice bath after ice bath 30min, 42 DEG C of heat shock 90sec, is added the LB liquid medium of 0.35mL, 37
DEG C 210rpm shaken cultivations 1h.Centrifuge 1min（7500rpm）, supernatant is abandoned to about 100 μ l mixings, is spread evenly across the training of Km resistances
It supports on base, 37 DEG C are incubated overnight.Sanger sequencings are carried out after selecting positive colony extraction plasmid, as a result see Fig. 2 and Fig. 3.
Embodiment 4
CYP82E10Gene missense mutant nicotine conversion ratio is analyzed
One, prepared by mutant material sample
It is to be measured to crushed 60 mesh sieve for tobacco growing to maturity period, 60 DEG C of drying of rounding strain tobacco sample.Accurately weigh cigarette sample 0.5
G is added the NaOH solution of 5 mL 10%, shakes up in 50 mL centrifuge tubes, impregnates 15 min, and the extraction of 20 mL containing the internal standards is added
Liquid, 60 min of ultrasound, on centrifuge 5000 r/min centrifuge 5 min, take 2 mL lower layers dichloromethane clear liquids cross equipped with 2 g without
After the millipore filter of aqueous sodium persulfate, analyzed with gas chromatography tandem mass spectrometry instrument.
Two, blade nornicotine content analysis
Nornicotine content in blade is analyzed using GC-MS-MS methods.Transmission line temperature：230 DEG C, ion source temperature：210
℃；Ionization pattern：Electron impact ionization（EI）；Bombarding energy：70 eV；Heater current：50 μ A, electron multiplier voltage 1200
V；Collision gas：Argon gas（Purity >=99.999%）；Collision cell pressure：0.3Pa）；The solvent delay time：4 min；Data acquisition module
Formula：MRM.Retention time（min）：10.48；Quota ion pair：119 ﹥ 92；Impact energy (eV)：15；Qualitative ion pair：119 ﹥
65；Impact energy (eV)： 25；Residence time (s)： 0.15.For M4 in plant, M271 material nicotine conversion ratios are clouds and mists 87
38%.Nicotine conversion ratio=[nornicotine/nornicotine+nicotine] * 100%, concrete outcome is shown in Fig. 4.
SEQUENCE LISTING
<110>Yunnan Academy of Tobacco Agricultural Science
<120>A kind of CYP82E10 gene missense mutant M271 of nicotine conversion ratio and its application
<130> 2018
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 1554
<212> DNA
<213>CYP82E10 genes
<400> 1
atggtttctc ccgtagaagc catcgtagga ctagtaactc ttacacttct cttctacttc 60
atacggacca aaaaatctca aaaaccttca aaaccattac caccgaaaat ccccggaggg 120
tggccggtaa tcggccatct tttctatttc gatgacgaca gcgacgaccg tccattagca 180
cgaaaactcg gagacttagc tgacaaatac ggcccggttt tcacttttcg gctaggcctt 240
ccgcttgtgt tagttgtaag cagttacgaa gctataaaag actgcttctc tacaaatgat 300
gccattttct ccaatcgtcc agcttttctt tatggcgaat accttggcta caataatgcc 360
atgctatttt tgacaaaata cggaccttac tggcgaaaaa atagaaaatt agtcattcag 420
gaagttctct gtgctagtcg tctcgaaaaa ttgaagcacg tgagatttgg tgaaattcag 480
acgagcatta agaatttata cactcgaatt gatggaaatt cgagtacgat aaatctaacc 540
gattggttag aagaattgaa ttttggtctg atcgtgaaaa tgatcgctgg gaaaaattat 600
gaatccggta aaggagatga acaagtggag agatttagga aagcgtttaa ggattttata 660
attttatcaa tggagtttgt gttatgggat gcttttccaa ttccattgtt caaatgggtg 720
gattttcaag gccatgttaa ggccatgaaa aggacattta aggatataga ttctgttttt 780
cagaattggt tagaggaaca tgtcaagaaa aaagaaaaaa tggaggttaa tgcagaagga 840
aatgaacaag atttcattga tgtggtgctt tcaaaaatga gtaatgaata tcttgatgaa 900
ggctactctc gtgatactgt cataaaagca acagtgttta gtttagtctt ggatgctgcg 960
gacacagttg ctcttcacat gaattgggga atggcattat tgataaacaa tcaacatgcc 1020
ttgaagaaag cgcaagaaga gatagataaa aaagttggta aggatagatg ggtagaagag 1080
agtgatatta aggatttggt atacctccaa actattgtta aagaagtgtt acgattatat 1140
ccaccgggac ctttattagt accccatgaa aatgtagagg attgtgttgt tagtggatat 1200
cacattccta aagggactag actattcgcg aacgttatga aattacagcg cgatcctaaa 1260
ctctggtcaa atcctgataa gttcgatcca gagagatttt tcgctgctga tattgacttt 1320
cgtggtcaac actatgagtt tatcccattt ggttctggaa gacgatcttg tccggggatg 1380
acttatgcaa tgcaagtgga acacctaaca atcgcacact tgatccaggg tttcaattac 1440
aaaactccaa atgacgagcc cttggatatg aaggaaggtg caggattaac tatacgtaag 1500
gtaaatccta tagaagtggt aattacgcct cgcctgacac ctgagcttta ttaa 1554
<210> 2
<211> 1554
<212> DNA
<213>The nucleotide sequence of mutant M271
<400> 2
atggtttctc ccgtagaagc catcgtagga ctagtaactc ttacacttct cttctacttc 60
atacggacca aaaaatctca aaaaccttca aaaccattac caccgaaaat ccccggaggg 120
tggccggtaa tcggccatct tttctatttc gatgacgaca gcgacgaccg tccattagca 180
cgaaaactcg gagacttagc tgacaaatac ggcccggttt tcacttttcg gctaggcctt 240
ccgcttgtgt tagttgtaag cagttacgaa gctataaaag actgcttctc tacaaatgat 300
gccattttct ccaatcgtcc agcttttctt tatggcgaat accttggcta caataatgcc 360
atgctatttt tgacaaaata cggactttac tggcgaaaaa atagaaaatt agtcattcag 420
gaagttctct gtgctagtcg tctcgaaaaa ttgaagcacg tgagatttgg tgaaattcag 480
acgagcatta agaatttata cactcgaatt gatggaaatt cgagtacgat aaatctaacc 540
gattggttag aagaattgaa ttttggtctg atcgtgaaaa tgatcgctgg gaaaaattat 600
gaatccggta aaggagatga acaagtggag agatttagga aagcgtttaa ggattttata 660
attttatcaa tggagtttgt gttatgggat gcttttccaa ttccattgtt caaatgggtg 720
gattttcaag gccatgttaa ggccatgaaa aggacattta aggatataga ttctgttttt 780
cagaattggt tagaggaaca tgtcaagaaa aaagaaaaaa tggaggttaa tgcagaagga 840
aatgaacaag atttcattga tgtggtgctt tcaaaaatga gtaatgaata tcttgatgaa 900
ggctactctc gtgatactgt cataaaagca acagtgttta gtttagtctt ggatgctgcg 960
gacacagttg ctcttcacat gaattgggga atggcattat tgataaacaa tcaacatgcc 1020
ttgaagaaag cgcaagaaga gatagataaa aaagttggta aggatagatg ggtagaagag 1080
agtgatatta aggatttggt atacctccaa actattgtta aagaagtgtt acgattatat 1140
ccaccgggac ctttattagt accccatgaa aatgtagagg attgtgttgt tagtggatat 1200
cacattccta aagggactag actattcgcg aacgttatga aattacagcg cgatcctaaa 1260
ctctggtcaa atcctgataa gttcgatcca gagagatttt tcgctgctga tattgacttt 1320
cgtggtcaac actatgagtt tatcccattt ggttctggaa gacgatcttg tccggggatg 1380
acttatgcaa tgcaagtgga acacctaaca atcgcacact tgatccaggg tttcaattac 1440
aaaactccaa atgacgagcc cttggatatg aaggaaggtg caggattaac tatacgtaag 1500
gtaaatccta tagaagtggt aattacgcct cgcctgacac ctgagcttta ttaa 1554
<210> 3
<211> 517
<212> PRT
<213>The amino acid sequence of mutant M271 codings
<400> 3
Met Val Ser Pro Val Glu Ala Ile Val Gly Leu Val Thr Leu Thr Leu
1 5 10 15
Leu Phe Tyr Phe Ile Arg Thr Lys Lys Ser Gln Lys Pro Ser Lys Pro
20 25 30
Leu Pro Pro Lys Ile Pro Gly Gly Trp Pro Val Ile Gly His Leu Phe
35 40 45
Tyr Phe Asp Asp Asp Ser Asp Asp Arg Pro Leu Ala Arg Lys Leu Gly
50 55 60
Asp Leu Ala Asp Lys Tyr Gly Pro Val Phe Thr Phe Arg Leu Gly Leu
65 70 75 80
Pro Leu Val Leu Val Val Ser Ser Tyr Glu Ala Ile Lys Asp Cys Phe
85 90 95
Ser Thr Asn Asp Ala Ile Phe Ser Asn Arg Pro Ala Phe Leu Tyr Gly
100 105 110
Glu Tyr Leu Gly Tyr Asn Asn Ala Met Leu Phe Leu Thr Lys Tyr Gly
115 120 125
Leu Tyr Trp Arg Lys Asn Arg Lys Leu Val Ile Gln Glu Val Leu Cys
130 135 140
Ala Ser Arg Leu Glu Lys Leu Lys His Val Arg Phe Gly Glu Ile Gln
145 150 155 160
Thr Ser Ile Lys Asn Leu Tyr Thr Arg Ile Asp Gly Asn Ser Ser Thr
165 170 175
Ile Asn Leu Thr Asp Trp Leu Glu Glu Leu Asn Phe Gly Leu Ile Val
180 185 190
Lys Met Ile Ala Gly Lys Asn Tyr Glu Ser Gly Lys Gly Asp Glu Gln
195 200 205
Val Glu Arg Phe Arg Lys Ala Phe Lys Asp Phe Ile Ile Leu Ser Met
210 215 220
Glu Phe Val Leu Trp Asp Ala Phe Pro Ile Pro Leu Phe Lys Trp Val
225 230 235 240
Asp Phe Gln Gly His Val Lys Ala Met Lys Arg Thr Phe Lys Asp Ile
245 250 255
Asp Ser Val Phe Gln Asn Trp Leu Glu Glu His Val Lys Lys Lys Glu
260 265 270
Lys Met Glu Val Asn Ala Glu Gly Asn Glu Gln Asp Phe Ile Asp Val
275 280 285
Val Leu Ser Lys Met Ser Asn Glu Tyr Leu Asp Glu Gly Tyr Ser Arg
290 295 300
Asp Thr Val Ile Lys Ala Thr Val Phe Ser Leu Val Leu Asp Ala Ala
305 310 315 320
Asp Thr Val Ala Leu His Met Asn Trp Gly Met Ala Leu Leu Ile Asn
325 330 335
Asn Gln His Ala Leu Lys Lys Ala Gln Glu Glu Ile Asp Lys Lys Val
340 345 350
Gly Lys Asp Arg Trp Val Glu Glu Ser Asp Ile Lys Asp Leu Val Tyr
355 360 365
Leu Gln Thr Ile Val Lys Glu Val Leu Arg Leu Tyr Pro Pro Gly Pro
370 375 380
Leu Leu Val Pro His Glu Asn Val Glu Asp Cys Val Val Ser Gly Tyr
385 390 395 400
His Ile Pro Lys Gly Thr Arg Leu Phe Ala Asn Val Met Lys Leu Gln
405 410 415
Arg Asp Pro Lys Leu Trp Ser Asn Pro Asp Lys Phe Asp Pro Glu Arg
420 425 430
Phe Phe Ala Ala Asp Ile Asp Phe Arg Gly Gln His Tyr Glu Phe Ile
435 440 445
Pro Phe Gly Ser Gly Arg Arg Ser Cys Pro Gly Met Thr Tyr Ala Met
450 455 460
Gln Val Glu His Leu Thr Ile Ala His Leu Ile Gln Gly Phe Asn Tyr
465 470 475 480
Lys Thr Pro Asn Asp Glu Pro Leu Asp Met Lys Glu Gly Ala Gly Leu
485 490 495
Thr Ile Arg Lys Val Asn Pro Ile Glu Val Val Ile Thr Pro Arg Leu
500 505 510
Thr Pro Glu Leu Tyr
515
<210> 4
<211> 25
<212> DNA
<213> CYP82E10_Tilling_F
<400> 4
gtcaaatacc acctcttaat agtaa 25
<210> 5
<211> 25
<212> DNA
<213> CYP82E10_Tilling_R
<400> 5
aaaagtccct attggtagga agtgc 25
Claims (3)
1. a kind of reduction nicotine conversion ratioCYP82E10Gene missense mutant M271, it is characterised in that the reduction Buddhist nun
Ancient fourth conversion ratioCYP82E10Gene missense mutant M271 is classified as relative to nucleotides sequence shown in SEQ ID NO.1CYP82E10Gene, the reduction nicotine conversion ratioCYP82E10Gene missense mutant M271 containsCYP82E10
385 C are replaced by T in gene order has occurred point mutation, the reduction nicotine conversion ratioCYP82E10Gene is wrong
The nucleotide sequence of adopted mutant M271 is as shown in SEQ ID NO.2.
2. reduction nicotine conversion ratio according to claim 1CYP82E10Gene missense mutant M271, feature
It is the reduction nicotine conversion ratioCYP82E10The amino acid sequence such as SEQ of gene missense mutant M271 codings
Shown in ID NO.3.
3. reducing nicotine conversion ratio described in a kind of claims 1 or 2CYP82E10The application of gene missense mutant M271,
It is characterized in that the reduction nicotine conversion ratioCYP82E10Gene missense mutant M271 is obtaining low turn of nicotine
Application in the tobacco plant of rate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810360474.5A CN108424922B (en) | 2018-04-20 | 2018-04-20 | CYP82E10 gene missense mutant M271 capable of reducing nicotine conversion rate and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810360474.5A CN108424922B (en) | 2018-04-20 | 2018-04-20 | CYP82E10 gene missense mutant M271 capable of reducing nicotine conversion rate and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108424922A true CN108424922A (en) | 2018-08-21 |
| CN108424922B CN108424922B (en) | 2021-04-16 |
Family
ID=63161491
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810360474.5A Active CN108424922B (en) | 2018-04-20 | 2018-04-20 | CYP82E10 gene missense mutant M271 capable of reducing nicotine conversion rate and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108424922B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102858983A (en) * | 2010-01-15 | 2013-01-02 | 北卡罗来纳州立大学 | Compositions And Methods For Minimizing Nornicotine Synthesis In Tobacco |
| CN106636146A (en) * | 2017-02-16 | 2017-05-10 | 云南省烟草农业科学研究院 | CYP82E5 gene mutant for reducing nicotine conversion rate and application thereof |
| CN106998787A (en) * | 2014-09-26 | 2017-08-01 | 菲利普莫里斯生产公司 | Tobacco-specific nitrosamines are reduced by changing nitrate assimilation path |
| WO2018067985A1 (en) * | 2016-10-07 | 2018-04-12 | Altria Client Services Llc | Composition and methods for producing tobacco plants and products having reduced tobacco-specific nitrosamines (tsnas) |
-
2018
- 2018-04-20 CN CN201810360474.5A patent/CN108424922B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102858983A (en) * | 2010-01-15 | 2013-01-02 | 北卡罗来纳州立大学 | Compositions And Methods For Minimizing Nornicotine Synthesis In Tobacco |
| CN106998787A (en) * | 2014-09-26 | 2017-08-01 | 菲利普莫里斯生产公司 | Tobacco-specific nitrosamines are reduced by changing nitrate assimilation path |
| WO2018067985A1 (en) * | 2016-10-07 | 2018-04-12 | Altria Client Services Llc | Composition and methods for producing tobacco plants and products having reduced tobacco-specific nitrosamines (tsnas) |
| CN106636146A (en) * | 2017-02-16 | 2017-05-10 | 云南省烟草农业科学研究院 | CYP82E5 gene mutant for reducing nicotine conversion rate and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| LI等: "Development of CAPS and dCAPS markers for CYP82E4,CYP82E5v2 and CYP82E10 gene mutants reducing nicotine to nornicotine conversion in tobacco", 《MOL BREEDING》 * |
| 宋中邦等: "烟草尼古丁去甲基化酶基因及其在育种中的应用", 《广西植物》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108424922B (en) | 2021-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2537939B1 (en) | Tobacco plants having reduced nicotine demethylase activity | |
| US20130074858A1 (en) | Tobacco plants having reduced nicotine demethylase activity | |
| CN109097387A (en) | A kind of methods and applications with CRISPR/Cas9 gene editing system initiative purple fruit Tomato mutants | |
| CN108463103B (en) | Targeted mutagenesis of tobacco berberine bridge enzyme-like nucleic acids | |
| CN108822194B (en) | Plant starch synthesis related protein OsFLO10, and coding gene and application thereof | |
| CN106636146B (en) | It is a kind of reduce nicotine conversion ratio CYP82E5 gene mutation body and its application | |
| CN107058335A (en) | A kind of gene mutation bodies of NteIF4E 1 of generation PVY resistances and its application | |
| CN107759676A (en) | A kind of plant amylose synthesis associated protein Du15 and its encoding gene and application | |
| CN113271768A (en) | Modulating nitrate levels in plants via mutation of nitrate reductase | |
| KR102272557B1 (en) | Method for producing potato plant suppressing browning using CRISPR/Cas9 system | |
| CN108424922A (en) | It is a kind of reduce nicotine conversion ratio CYP82E10 gene missense mutant M271 and its application | |
| CN108424921A (en) | It is a kind of reduce nicotine conversion ratio CYP82E10 gene missense mutant M594 and its application | |
| JP2023164339A (en) | Use of rice osckx3 gene in regulation of rice leaf angle | |
| EP2992756B1 (en) | Onion with reduced pungency that does not generate lachrymatory component | |
| CN113061619B (en) | Mutant gene TyrA related to phenol release amount of smoke | |
| Yang et al. | Characterization and fine mapping of an early senescence mutant (es-t) in Oryza sativa L. | |
| CN113174395B (en) | Mutant gene DHQ-SDH1 related to smoke phenol release amount | |
| CN117487850A (en) | Preparation and application of humidity-sensitive male sterile rice material S14119 | |
| CN110923231B (en) | Method for preparing tomato material with high fruit solid content | |
| CN111187775B (en) | Rice humidity-sensitive sterile gene and application thereof and sterile line cultivation method | |
| US20200277615A1 (en) | Tobacco Plants Having Reduced Nicotine Demethylase Activity | |
| CN109517836B (en) | Application of short N import segment in tobacco and screening and estimating method thereof | |
| CN114014920B (en) | OsRR22 mutant and screening method and application thereof | |
| KR20190139756A (en) | Method for regenerating modified plant from cell having modified gene involved in flavonoid biosynthesis using CRISPR/Cas9 system in Petunia protoplast | |
| CN111518181B (en) | Method for increasing rice yield and protein used by same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |