CN114014920B - OsRR22 mutant and screening method and application thereof - Google Patents

Abstract

The invention relates to the technical field of plant biology, in particular to an OsRR22 mutant and a screening method and application thereof. An OsRR22 mutant, wherein the mutant has the following amino acid sequence (1) or (2): (1) an amino acid sequence as shown in SEQ ID NO. 1; (2) the amino acid sequence shown as SEQ ID NO.1 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues and has the amino acid sequence of the protein with the same function. The OsRR22 mutant can obviously improve the salt tolerance of plants. According to the invention, the plant genome variation rate is accelerated by adopting radiation mutagenesis, the variation of OsRR22 allele is detected from a radiation mutagenesis population by applying a high-throughput molecular screening technology in the seedling stage of M2 generation of a mutagenized plant, the defects that the agronomic trait phenotype identification is easily influenced by individual subjective judgment, is difficult to identify by naked eyes, is inaccurate to identify, has high cost, has long period and the like are overcome, and the efficiency and the accuracy of screening the OsRR22 mutant are improved.

Description

OsRR22 mutant and screening method and application thereof

Technical Field

The invention relates to the technical field of plant biology, in particular to an OsRR22 mutant and a screening method and application thereof.

Background

The radiation mutation breeding of crops plays an important role in ensuring the food safety of the world and increasing the nutrition supply. According to the latest statistics of FAO/IAEA mutant variety databases in the United nations, the total number of plant mutant varieties which are bred on 214 plant varieties and are commercially registered reaches 3299 in more than 60 countries, the number of new varieties which are bred directly or indirectly through a mutation breeding technology in China is 1050, the number of the bred mutant varieties accounts for nearly one third of the number of the bred mutant varieties in the world, and the nuclear radiation mutation breeding technology as a traditional biological breeding technology has great social and economic effects by 2019. Under long-term natural environmental conditions, the organism itself interacts with the external environment, and in order to adapt to the change of the environment, the genetic material in the organism undergoes a certain spontaneous mutation, but the frequency is very low, about 10^-5～10^-8Next, the process is carried out.

The lack of plant germplasm resources becomes a bottleneck for restricting plant breeding, and the radiation mutagenesis technology becomes an effective way for creating plant germplasm resources. In recent years, the total physiological damage of high-energy heavy ions to organisms is relatively small, the mutagenesis effect on the organisms is strong, the induced mutation spectrum is wide, and the mutation frequency is high; in addition, compared with the traditional X and gamma ray radiation, the DNA single-strand break generated by the action on organisms is less and is not easy to repair, so the DNA single-strand break has unique mutagenesis advantages as a new mutagenesis source and is continuously concerned by domestic and foreign scientists.

The salinization of soil is one of the main factors restricting the global rice production development. The distribution range of the Chinese saline-alkali soil is wide, the area is large, the types are more, and the total area is about 1 hundred million hm². Followed byWith the increasing population, the available arable area and fresh water resources are reduced, the environmental pressure for human survival will be increased continuously, and the shortage of food crops will be serious increasingly at the same time. Therefore, the method is an effective way for further improving the utilization efficiency of the saline-alkali soil and increasing the total yield of the rice by breeding a new rice variety suitable for being planted in the saline-alkali soil.

Disclosure of Invention

In view of the defects of the prior art, the invention aims to provide the OsRR22 mutant, the screening method and the application thereof, realize accurate identification and high-throughput screening of OsRR22 allelic variation in a mutagenic population, realize a high-throughput screening and identifying method of important target character gene variation, and break through the bottleneck of industrialization of rice gene editing biological products.

To achieve the above objects and other related objects, the present invention is achieved by the following technical solutions.

One of the objects of the present invention is to provide an OsRR22 mutant, which has the following amino acid sequence (1) or (2):

(1) an amino acid sequence shown as SEQ ID NO. 1;

(2) the amino acid sequence shown as SEQ ID NO.1 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues and has the amino acid sequence of the protein with the same function.

The second purpose of the invention is to provide biological materials related to the OsRR22 mutant, which comprises any one of the following:

a) a polynucleotide encoding a mutant as described;

b) a recombinant expression vector comprising the polynucleotide of a);

c) a bioengineering bacterium containing the polynucleotide of a) or a bioengineering bacterium containing the recombinant expression vector of b);

d) a transgenic plant cell comprising the polynucleotide of a), or a transgenic plant comprising the recombinant expression vector of b).

In a preferred embodiment, the nucleotide sequence of said polynucleotide in a) comprises the sequence shown in SEQ ID NO. 2.

The invention also aims to provide the application of the OsRR22 mutant or the biological material in regulating and controlling the stress resistance of plants.

In a preferred embodiment, said modulating plant stress resistance comprises: improve the drought resistance or salt tolerance of the plants.

The fourth purpose of the invention is to provide a method for screening an OsRR22 mutant, which comprises the following steps:

1) after radiation mutagenesis is carried out on plants, genome DNA is extracted, and a DNA library is constructed according to the genome DNA;

2) designing a probe according to the OsRR22 gene of the wild rice; hybridizing the probe to the DNA library;

3) enriching the hybridized product by using magnetic beads to construct an enrichment library;

4) and identifying and analyzing the enrichment library, screening a target gene with a difference with the sequence of the OsRR22 gene of the wild rice, and obtaining the OsRR22 mutant.

According to the technical scheme of the invention, in the step 1), the radiation mutagenesis comprises gamma ray mutagenesis and/or heavy ion mutagenesis.

In a preferred embodiment, the mutagenic source of said gamma-ray mutagenesis is selected from the group consisting of⁶⁰Co-gamma rays.

In a more preferred embodiment, the dose of the gamma rays is 200-500 Gy. Preferably, the dose of the gamma ray is 80-150 Gy. Specifically, the dose of the gamma ray is 300 Gy.

In a more preferred embodiment, the dose rate of the gamma rays is 2-16 Gy/min. Preferably, the dose rate of the gamma rays is 8-12 Gy/min. Specifically, the dose rate of the gamma rays is 8 Gy/min.

In a preferred embodiment, the mutagenesis source for heavy ion mutagenesis is selected from the group consisting of¹²C⁺⁶Heavy ions.

In a more preferred embodiment, the dose of heavy ion mutagenesis is 80-150 Gy. Preferably, the¹²C⁺⁶The dosage of the heavy ions is 100-140 Gy. The above-mentioned¹²C⁺⁶The dose of heavy ions was 120 Gy.

In a more preferred embodiment, the dosage rate of heavy ion mutagenesis is 0.8-2.2 Gy/min. Preferably, the dosage rate of microgravity mutagenesis is 1.2-1.7 Gy/Min. Specifically, the dosage rate of microgravity mutagenesis is 1.5 Gy/min.

According to the technical scheme of the invention, the method in the step 1) comprises the following steps:

a) carrying out radiation mutagenesis on seeds of the plants, and planting to obtain M1 generation seeds;

b) planting the M1 generation seeds to obtain M2 generation seeds;

c) planting the M2 generation seeds, taking leaves on each planted individual plant, and mixing the leaves of each individual plant;

d) extracting the genomic DNA from the mixed leaves;

e) and (2) fragmenting the genome DNA, adding A tail to the fragmented DNA fragment, connecting a sequencing adaptor, and amplifying to obtain the DNA library.

In a preferred embodiment, in step b), after the M1 generation seeds are planted in individual plants, each ear seed of each individual plant is harvested according to the ear harvest method to form the M2 generation seeds.

In a preferred embodiment, in step c), the M2 generation seeds are planted in single plants, each 100-1000 plants are used as a sample group, each sample group is numbered, and the leaves of the plants in each sample group are mixed to extract DNA.

In a preferred embodiment, in step c), when taking the leaves of each planted individual plant, selecting the leaves of different parts of the same individual plant for equal mixing; equal mixing of different individuals.

According to the technical scheme, in the step 2), the probes comprise a plurality of probes designed according to the OsRR22 gene of wild rice.

According to the technical scheme of the invention, in the step 2), the sequence of the probe comprises a sequence shown as SEQ ID NO. 3-SEQ ID NO. 29.

According to the technical scheme, the probe is a biotin-labeled probe.

According to the technical scheme of the invention, the magnetic beads are streptavidin-labeled magnetic beads.

According to the technical scheme of the invention, the plants comprise angiosperms and gymnosperm.

In a preferred embodiment, the plant includes dicotyledonous and monocotyledonous plants.

In a preferred embodiment, the plants include herbaceous plants and woody plants.

In a preferred embodiment, the plant arabidopsis thaliana, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rape, cabbage, strawberry. More specifically, the plant is rice.

The fifth purpose of the invention is to provide a plant with stress resistance, which comprises the OsRR22 mutant or the biological material.

The sixth object of the present invention is to provide a method for breeding a plant having high stress resistance by growing the plant under salt stress.

According to the technical scheme of the invention, the concentration of the salt is 0.1-1.0 wt%.

Compared with the prior art, the invention has the following beneficial effects:

according to the invention, the plant genome variation rate is accelerated by adopting radiation mutagenesis, the variation of OsRR22 allele is detected from a radiation mutagenesis population by applying a high-throughput molecular screening technology in the seedling stage of M2 generation of a mutagenized plant, the defects that the agronomic trait phenotype identification is easily influenced by the subjective judgment of breeders, is difficult to identify by naked eyes, is inaccurate in identification, high in cost, long in period and the like are overcome, and the efficiency and the accuracy of screening the OsRR22 mutant are improved.

The OsRR22 mutant obtained by the invention can obviously improve the salt tolerance or drought resistance of plants.

Drawings

FIG. 1 is a schematic diagram showing the alignment of partial sequences of OsRR22 gene and OsRR22 mutant gene in wild-type rice in example 2 of the present invention.

FIG. 2 is a schematic diagram showing the genomic position of the OsRR22 mutant gene in example 2 of the present invention.

FIG. 3 is a graph showing the identification of salt tolerant phenotypes of wild type rice and rice containing the OsRR22 mutant gene at salt concentrations of 0.3 wt% and 0.8 wt% in example 2 of the present invention.

The drawings in FIG. 3 are as follows

W wild type rice

M OsRR22 mutant rice

Detailed Description

The following description of the embodiments of the present invention is provided for illustrative purposes, and other advantages and effects of the present invention will become apparent to those skilled in the art from the present disclosure.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not to be limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, the invention may be practiced using any method, device, and material that is similar or equivalent to the methods, devices, and materials described in examples herein, in addition to those described in prior art practice and the description herein.

In the examples described below in this application, Serapure beads were Invitrogen ™

M-270 Streptavidin beads。

In the following examples of the present application, Tiangen NG301 kit and NG303 kit were purchased from Tiangen Biochemical technology Co.

In the following examples of the present application,

hybridization and Wash Kit, purchased from Integrated DNA Technologies, Inc.

In the examples described below, the KAPA library amplification kit was purchased from Shanghai Jieyi Biotech, Inc.

In the examples described below in this application, KAPA HiFi HotStart ReadyMix PCR Kit, purchased from Roche.

In the examples described below, the MiniSeq sequencing kit was purchased from Illumina.

Example 1

In this embodiment, according to breeding target agronomic traits, a wild rice OsRR22 Gene (accession number is Os06g0183100) is searched in a Gene bank database, and a probe is designed for the Gene by using Oligo6.0 software, wherein the nucleotide sequence of the OsRR22 Gene comprises a sequence shown as SEQ ID No.30, and the amino acid sequence of the OsRR22 Gene comprises a sequence shown as SEQ ID No. 31. The probe labeled with biotin was synthesized by Alberson Biotechnology Ltd.

1. The root OsRR22 gene design probe comprises Os06g 0183100-1-Os 06g0183100-27, and the sequences of the probe respectively comprise the sequences shown in SEQ ID NO. 3-SEQ ID NO. 29.

Os06g0183100-1

CATCAGTCCACTCATCCCCATGCCCCCCTCATTCTGATCCTTTATAAATCAGCCACCCAGCAAGACATTCCTTTCCAACCTCACTCACCTTGCTCTAGCTCAGCTAGCTCTTGCTGCTAG(SEQ ID NO.3)

Os06g0183100-2

TAGCTTCAGCTTTGCTACTGCTACTACCACTACTACTACTACTACTTTCACCTCCAAGAAAGTATAGATTGCAAGAACAATTTCTGCTGCTGTTGTTCTTTCTTGCTGTTCTTTCTCCTT(SEQ ID NO.4)

Os06g0183100-3

GTGTAGTTGTGTGGTGTGGTTGAGCTGAGGTGTAGTTAGGACAGTGGCTGGCTTTGCTTGCTTGATTGGTCACCTGGGAAGGTCGCTGTCTCTGCCTTTTGTTTTCTTTGCCATCTCTTT(SEQ ID NO.5)

Os06g0183100-4

CTTTCTGGGCTGCTTTCACCTTTTGCTTTCCAACCTCTTCTTGCCATCAATAATGATGGAGGAGTAAGATGAGGGCTTGTTCTTGAAGTCTCTCCAATCTAATCTCATTTCATCTTCATC(SEQ ID NO.6)

Os06g0183100-5

ATCTCCACCCGGTCCAAATCCACCTACTACTGTTTTTCTTTTGTCCCTTCTCTTTTTTTTCTTCCTCTGATCTTTTCTTTTTTCAGGTGTTTTGTTTTTGGCAGTAGGTGCTTGCTATCT(SEQ ID NO.7)

Os06g0183100-6

TTTCATTAGGCTTTGGATTTTCCTCTCGTGTTCTTTAGTCTCAGCCTATTAGAGGTTTGAGGAAAGTTTTCCATTTCTTAGCTCTTTTTGCTTCCAGCTTCTTGGGATTGCTCTGTTTCT(SEQ ID NO.8)

Os06g0183100-7

TGCTGAGAATTGGCTCGATTTGGGAGGCCTCATCTTGTGTTAGCTTTCAGGTTTTCTTGCCTGAAATTGAACCGATTGGGTAGGTTTTTAGGTGCTTCAGTTTCAGTTGCTAGCTCGTCA(SEQ ID NO.9)

Os06g0183100-8

GGCTTGTTCTTGGGCTCCTGCCTTGAATTGGGGTCAAATTGGGATGCTTCTGGGTGCTTTGAGGATGGAGGAGAGGAAGGGATTGATGGGGAGGGAGAGGGATCAATTCCCCGTCGGCAT(SEQ ID NO.10)

Os06g0183100-9

GCGGGTCCTCGCCGTCGACGATGACCCGGTGTGCCTCAAGGTTCTTGAGACCCTCCTCCGGCGCTGCCAATACCATGGTCAGTATTTACAGTAACCGCAGCTAATTGTACTTCCATTATC(SEQ ID NO.11)

Os06g0183100-10

CAACCAGGCTATTACTGCGTTGAAGCTGCTCAGGGAGAACAGGGACATGTTTGATCTTGTCATCAGTGATGTCCACATGCCCGACATGGACGGATTTAAGCTCCTTGAGCTTGTGGGGCT(SEQ ID NO.12)

Os06g0183100-11

TGTTATCAGTAAATGGAGAGACAAAGACTGTGATGAAGGGGATAACTCATGGTGCCTGTGACTATCTTCTAAAACCGGTCCGAATCGAAGAACTAAGGAACATATGGCAGCATGTTGTTA(SEQ ID NO.13)

Os06g0183100-12

GGAGGAAGTTCGGTAATCGTGAGCGAAACAATCTTGATTTCTCCAAAGAATGCAATAAGCCGCAAAGCGCGGATACTGATCATGGACCATACCAACCTACCTGTGGTTCTTCTGATCAAA(SEQ ID NO.14)

Os06g0183100-13

ATGGGAGGTCCAGCAGGAAAAGGAAAGAACTACACGGCGAGGACGACGATGAAGGCGATGATAATGATTATCAAGAAAATGATGAGCCCTCAGCTGCAAAGAAGCCCAGAGTTGTATGGT(SEQ ID NO.15)

Os06g0183100-14

CAGTTGAGCTGCACCGAAAATTTGTTGCCGCTGTCAACCAGCTTGGAATTGACAGTAAGAAAGCACCCCCCCCCCCCACCCCACTTTTTTGCCTTTCTGTAAATGTCCTTGCAGGTTTGC(SEQ ID NO.16)

Os06g0183100-15

TTTACCTCACTGTTGATGCAGAAGCTGTACCAAAAAGAATTCTTGAGCTTATGAATGTGGAGAAACTCACCAGGGAAAATGTTGCAAGTCATCTACAGGTATAGCATTTACTTCCATGAC(SEQ ID NO.17)

Os06g0183100-16

AAGTACAGGCTTTACCTCAAGAGACTAGGTGCTGTAGCATCACAACAAGCCAGCATTGTTGCTGCCTTTGGAGGCAGAGATCCCTCCTTCTTGCATATTGGAGCATTTGAAGGACTCCAG(SEQ ID NO.18)

Os06g0183100-17

AGCTATCAACCTTTTGCACCTTCTGCTGCTCTTCCATCTTTCAATCCACATGGCCTGCTAACCCGAACTAGCGCCGCCGCGGCTTTCGGACTTCAGGAGCTTGCTGCCCCCTCCAGCACA(SEQ ID NO.19)

Os06g0183100-18

ATTCAGACTTCTACAGGAAATGTCACAGTTGGCCATTGCTTGGAAGAAAACCAGCAGGCAAATCTAGCACAAGGCTTGACCGCGGCGATCGGGCAACCTCAGCTTCAACAGAACTGGATT(SEQ ID NO.20)

Os06g0183100-19

CATCAAGAAGGTAATGGTCTGTCTGATGTTTTTTCTGGGAGTTCTCTGACCAACACTTTGTCCAGCACACTCCAAAGAGTTCCAAGCAGTTCATTGCCACCACAAGAACTCTTGGAGTGC(SEQ ID NO.21)

Os06g0183100-20

AAACAAGCCAAAGTTAGCATGCCGCCATCGATACGGATACCGCCTTCTAGTTCAGCACTTCTTGAGAGGACTCTTGGGGTTTCCACCAATTTGGGAGATTCTAGTATATCCCAGCAGGGT(SEQ ID NO.22)

Os06g0183100-21

GCTCTTCCAATAGATGGTGGATTTTCTGCTGACAGGTTACCATTGCACAGTTCATTTGATGGCGCTGTTGCAACAAAGCTAGATACTAGTTTGGCAGCTTCACAGAGAGAGATTGGCCAG(SEQ ID NO.23)

Os06g0183100-22

CAGGGGAAATTTTCAGTTAGCATGCTTGTCTCCCCTTCTGACAATCTTGCATTAGCCAAAAATGCCAAAACTGGAGCTAGTTCTTCTGGCAGTACTATAATTCTCCCTCTTGATACTGCA(SEQ ID NO.24)

Os06g0183100-23

AGACATTCAGACTACTTGCAGTTCGGAGGTGCAAGCAATTCTTTGCAGAAAATGGATGGACAGAAACAAGATCATATACAGAGCTCAAACATTATATGGAGTTCAATGCCAAGCACTCAA(SEQ ID NO.25)

Os06g0183100-24

CTGCCAAGTGATACCCAAATTCATAATACTCAAAACCAAAGATTGGACAGCGGAAGTTTTAACCATAATATTGGTGCCCATTTGGCTGACCAAACAAATGCAAGTGCGTCAATACTTCCG(SEQ ID NO.26)

Os06g0183100-25

CAAATGAAGTTTGACACAAGAATATCAGAAGAGAAAATGAAGCAGAAGAATACATATGACTTGGGTAGTTCAAAGCTGCAGGGTGGATTTAATTCTAGTGGCTGCAATTTTGATGGCCTT(SEQ ID NO.27)

Os06g0183100-26

GAGAAGGATGATCTCCCATTCATGGACAATGAATTGGGCTGTGACCTTTTTCCACTTGGTGCCTGCATATGAATCCATCATTTCGGACACCAAAGATTTTGCATAATCTAAAAGAGTCAG(SEQ ID NO.28)

Os06g0183100-27

CTGTGCTGCCTGATCTGTGCTACTTCATCCAGGCTTTGTGTATACTAGGATCTAGGGACAGTAGTGGCTTGTAATCTTGCTTTATCTCTTCTCTAGGGTTGGCTATGGAAGTATGGTTAG(SEQ ID NO.29)

Example 2

In this example, OsRR22 mutants were screened, including the following:

1. subjecting plants to radiation mutagenesis treatment comprising:

1) 2000 dry rice seeds of XF1822, using heavy ions¹²C⁺⁶The plants were subjected to radiation mutagenesis treatment at a dose of 120Gy and a dose rate of 1.5Gy/Min to obtain M1 generations.

2) The plants of M1 generation are planted in individual plants, M1 generation is strictly self-bred and fructified, and each ear seed of each individual plant is harvested according to an ear harvest method to obtain the M2 generation of plants.

3) Dividing the plants of M2 generation into single plants for planting, and planting 14000 groups, each group having 100 plants, numbering each group; taking each sample group as a unit, when the seedlings grow to have two leaves and one heart, taking equal amount of leaves of each individual plant by adopting a perforator with the diameter of 6mm, mixing the leaves of the individual plants in equal amount, and mixing different plants in equal amount to obtain 140 sample groups.

2. Extracting the genomic DNA of the sample group, fragmenting the extracted genomic DNA, adding A tail to the fragmented DNA fragment, connecting a sequencing adaptor, purifying and amplifying to obtain a DNA library, wherein the DNA library comprises the following steps:

2.1 extraction of DNA from the group of samples by the CTAB method

Numbering the 140 sample groups obtained in the step 1, and sequentially numbering the 140 sample groups as POOL NO.1-POOLNO. 140; each individual plant in each sample group is also numbered, taking the sample group POOL NO.1 as an example, and the numbers are POOL NO.1-1 to POOL NO.1-100 in sequence.

After DNA is extracted from each sample group by CTAB, the concentration is more than or equal to 20 ng/mu L and the total amount is more than or equal to 1 mu g by Qubit fluorescence quantification; the purity of the sample is as follows: OD260/280 is 1.7-2.0, and OD260/230 is more than or equal to 1.8; agarose gel electrophoresis is used for detecting the integrity of genome DNA, and the electrophoresis main band is required to be more than 2000 bp. In this example, the DNA content of less than 2000bp actually detected was less than 50%.

2.2 DNA fragmentation/DNA fragment plus A Tail

DNA fragmentation, end repair, DNA fragment plus a tail were performed using the tiangen NG301 kit.

Respectively mixing 140 sample groups obtained in the step 2.1 with 10 XFEAREACTION Buffer and 5 XFEA enzyme in the kit, preparing DNA fragmentation/end repair/DNA fragment adding A tail according to the table 1, putting on ice, melting, reversing, uniformly mixing, centrifuging, and then reacting according to the table 2.

TABLE 1

Components	Per reaction volume (μ L)
		Step 2.1 sample group DNA	X
10×FEA Reaction Buffer	5
		5×FEA enzyme Mix	10
ddH2O	35-X

TABLE 2

2.3 Joint connection

Linker ligation was performed using the Tiangen NG303 kit. The linker-linked reaction system was prepared according to table 3 below, centrifuged, and subjected to linking reaction according to table 4 to obtain a linked product.

TABLE 3

Components	Per reaction volume (. mu.L)
		Reaction product obtained in step 2.2	50
5×Ligase buffer	20
		TIANSeq DNA Ligase	10
DNA Adapter X	2.5
		ddH2O	17.5

TABLE 4

Temperature of	Time
		Hot lid	Off
20℃	15min
		4℃	Hold

2.4 DNA purification

1) Placing 100 μ L of the Ligation product (Adapter Ligation) obtained in step 2.3 and 130 μ L of Serapure magnetic beads in a PCR tube, mixing well, and standing at room temperature for 2 min;

2) placing the PCR tube on a magnetic frame, carrying out magnetic bead adsorption, standing for 5min, and discarding the supernatant;

3) then 200. mu.L of 75% ethanol is added, and the supernatant is discarded;

4) repeating the step 3) in the step 2.4 once, discarding the supernatant as much as possible, and standing at room temperature for 5min until the residual ethanol is completely volatilized;

5) adding 23 μ L of eluent (10mM Tris-HCl, pH 8.0-pH 8.5) for elution, fully mixing, standing at room temperature for 5min, standing in a magnetic frame for 2min, taking 23 μ L of supernatant, and storing in a new PCR tube to obtain a purified DNA library, namely a purified ligation product.

2.5 amplification of DNA libraries

2.5.1 amplification of DNA libraries

And (3) taking the purified ligation product obtained in the step 2.4 as a template, preparing a reaction system according to the table 5, mixing uniformly in a vortex manner, centrifuging, and performing PCR amplification according to the table 6 to obtain a DNA library amplification product. The amplification was performed using a KAPA library amplification kit.

TABLE 5

Components	Reaction volume (. mu.L)
		KAPA HiFi HotStart ReadyMix(2X)	25
TruSeq Primer 1.0	1.5
		TruSeq Primer 2.0	1.5
Step 2.4 purification of the ligation product	22
		Total amount:	50

TABLE 6

2.5.2 purification after amplification of DNA library

(1) Mixing 50 μ L of the DNA library amplification product obtained in step 2.5.1 and 55 μ L of Serapure magnetic beads in a PCR tube, and standing at room temperature for 2 min;

(2) placing the PCR tube on a magnetic frame, standing for 5min, and discarding the supernatant;

(3) then adding 200 mu L of 75% ethanol, standing for half a minute, and removing the supernatant;

(4) repeating the step (3) in the step 2.5.2 once, discarding the supernatant as much as possible, and standing at room temperature for 5min until the residual ethanol is completely volatilized;

(5) and adding 27 mu L of ultrapure water for elution, fully and uniformly mixing, standing at room temperature for 5min, then placing on a magnetic rack for standing for 2min, and storing the supernatant meeting the standard requirements of the library into a new PCR tube for probe capture.

After purification, quantification was performed using the Qubit HS. The DNA library met the criteria of: the bands were concentrated at 200-400bp, at a concentration greater than 5 ng/. mu.L. And (4) the qualified DNA library enters a hybridization capture link.

3. Hybridization of probes and libraries

Use of

Hybridization and Wash Kit Hybridization of probes and libraries.

Concentrating, drying and centrifuging the qualified DNA library purified in the step 2.5.2 by using a vacuum concentrator, wherein the vacuum concentrator is set to be 65 ℃; the reaction system was then prepared as in Table 7 and placed in a PCR tube.

TABLE 7

Adding the components in the following table 8 into the reaction system in the table 7, blowing and beating the components up and down by using a gun head, uniformly mixing the components, flushing the pipe wall, and incubating the mixture at room temperature for 5-10 min; centrifuging, and incubating at 95 deg.C for 10 min; then adding the probe constructed in the embodiment 1 and mixing uniformly; then incubation was carried out overnight at 65 deg.C (instrument lid temperature set at 75 deg.C) for no more than 15 h.

TABLE 8

Reagent	Volume (μ L)
		Nuclease-Free Water	1.8
Hybridization Buffer Enhancer	2.7
		2×Hybridization Buffer	8.5

4. Enriching the hybridized product by magnetic beads

During enrichment, 1 × Bead Wash Buffer was prepared according to Table 9, and 10 × Wash Buffer I and Stringent Wash Buffer were prepared according to Table 10.

TABLE 9

	Concentrated buffer(μL)	Nuclease-Free Water(μL)
			2×Bead Wash Buffer	250	250
10×Wash Buffer I	30	270
			10×Wash BufferⅡ	20	180
10×Wash BufferⅢ	20	180
			10×Stringent Wash Buffer	40	360

Watch 10

4.1 enrichment of hybridized product from step 3 with magnetic beads

1) And cleaning the streptavidin-labeled magnetic beads by using 1 multiplied by Bead Wash Buffer to obtain pure magnetic beads.

2) And (4) transferring the hybridization product obtained in the step (3) to a PCR tube containing magnetic beads, uniformly mixing, placing in a shaking instrument, and incubating for 45min at 65 ℃ to enable the DNA to be combined on the magnetic beads. In the incubation process, shaking for 3s after 5min to mix evenly; vortex every 8min for 3s to ensure that the beads are still in suspension, and the rotation speed of the oscillation instrument is adjusted to 1500.

4.2 washing the beads to remove non-hybridized products

And (4) transferring the mixture obtained by enriching and hybridizing the magnetic beads in the step 4.1 into a centrifuge tube, placing the centrifuge tube on a magnetic frame, separating the magnetic beads from the supernatant, and removing the supernatant.

Then 200. mu.L of preheated 1 XStingent Wash Buffer was added, the mixture was pipetted up and down 10 times and mixed, incubated in a water bath at 65 ℃ for 3min, placed on a magnetic rack to separate the magnetic beads from the supernatant, and the supernatant was removed.

Then adding 200 mu L of 1 × Wash Buffer I at room temperature, blowing for 10 times, uniformly mixing, and then carrying out vortex oscillation for 1 min; placing on a magnetic frame to completely separate the magnetic beads from the supernatant, and removing the supernatant; adding 200 μ L of room temperature 1 × Wash Buffer II (1 × Wash Buffer II is obtained by diluting 10 times of 10 × Wash Buffer II in Table 9), and vortex shaking for 1 min; placing the centrifugal tube on a magnetic frame to completely separate the magnetic beads from the supernatant, and removing the supernatant; 200. mu.L of room temperature 1 XWash Buffer III (1 XWash Buffer III is obtained by diluting 10 times 10 XWash Buffer III in Table 9 with water), pipette-pipetting and mixing or vortex-shaking for 30 seconds, placing the centrifuge tube on a magnetic frame to completely separate the magnetic beads from the supernatant, and removing the supernatant.

The centrifuge tube was removed from the magnetic holder, 22. mu.L of Nuclear-Free Water was added to the centrifuge tube, and the tube was pipetted 10 times up and down to resuspend the magnetic beads.

4.3 obtaining the target gene and carrying out PCR amplification on the target gene

4.3.1 prepare PCR mixtures as in Table 11 below, shake briefly to mix, ensure that the beads are suspended in solution. The sample was then placed in a PCR instrument (BioRad T100) and amplification was performed according to the reaction protocol in Table 12, maintaining the instrument lid temperature at 105 ℃. The Kit used for amplification was KAPAHiFi HotStart ReadyMix PCR Kit, purchased from Roche.

TABLE 11

Components	Reaction volume (μ L)
		KAPA HiFi HotStart ReadyMix(2X)	25
TruSeq Primer 1.0	1.5
		TruSeq Primer 2.0	1.5
Step 4.2 magnetic beads enriched with hybridization products	22
		Total amount:	50

TABLE 12

Experimental stoppable point: the PCR reaction solution can be stored at 4 ℃ overnight.

After the reaction, the amount of the Qubit HS was determined, and the band of the captured DNA was confirmed by electrophoresis. The total amount is more than 125 ng/. mu.L.

4.3.2 post amplification purification

1) Adding 65 mu L of Serapure magnetic beads into 50 mu L of PCR reaction product obtained in the step 4.3.1, fully and uniformly mixing, and standing for 2min at room temperature;

2) placing the PCR tube on a magnetic frame, standing for 5min, and discarding the supernatant;

3) adding 200 mu L of 75% ethanol into each tube on a magnetic frame, standing for half a minute, and removing the supernatant;

4) repeating the step 3) in the step 4.3.2 once, discarding the supernatant as much as possible, and standing at room temperature for 5min until the residual ethanol is completely volatilized;

5) adding 25 μ L EB for elution, mixing, standing at room temperature for 5min, standing on magnetic frame for 2min, and collecting supernatant.

After purification, quantification was performed using Qubit HS. The concentration is required to be more than 5 ng/mu L, and the band is concentrated at 200-400bp for subsequent sequencing.

5. Sequencing the product enriched by the magnetic beads in the step 4, performing bioinformatics analysis on the sequencing result, and screening out target genes with variation with the OsRR22 gene sequence of the wild rice, wherein the variation conditions comprise point mutation, gene fragment insertion and gene fragment deletion.

And (3) finishing sequencing on a MiniSeq 500 sequencer platform by adopting a MiniSeq sequencing kit, wherein the specific flow refers to the standard flow of the specification.

Table 13 shows the detected gene mutation. The difference in sequence between the gene with POOL NO.32 sample group and OsRR22 gene of wild-type rice was observed, and a deletion of TTTGG base fragment was observed between 4139729 and 4139733 of the gene with POOL NO.32 sample group.

TABLE 13 genetic variation

6. According to the sequencing data result in the step 5, the sequence of the gene with the differential site utilizes Primer Premier 5.0 software to design molecular primers, the genomic DNA of 100M 2 generation individual samples in the sample group POOL NO.32 is respectively subjected to PCR amplification, and the PCR amplification products are directly sequenced.

The gene sequence of sample No. 47 in the POOL NO.32 was found to be different from that of OsRR22 gene in wild-type rice.

Designing a molecular primer according to the gene of the OsRR22 mutant:

a forward primer: 5'-TGTGACATGCAGAAGTACAGG-3' (SEQ ID NO.32)

Reverse primer: 5'-AAGGTTGATAGCTCTGGAGTC-3' (SEQ ID NO.33)

PCR was performed according to Table 14.

TABLE 14 PCR amplification System

Through sequencing, the nucleotide sequence of the OsRR22 mutant comprises a sequence shown as SEQ ID NO.2, and the amino acid sequence comprises a sequence shown as SEQ ID NO. 1.

7. Salt resistance test

And (4) harvesting seeds of the M2 single plant with the genome sequence different from the OsRR22 gene of the rice in the step 5, planting the seeds in a field, strictly selfing to propagate offspring, and respectively taking each tillered leaf blade at the tillering peak stage for mutation verification again. Finally, the mutant which has stable heredity and excellent comprehensive character and accords with the breeding target character is selected.

Respectively selecting full-grain wild type and rice seeds containing OsRR22 mutant, placing the wild type and the rice seeds in a culture dish, adding clear water to germinate in an incubator at 34 ℃, after the seeds break the breast, respectively transferring the seeds after the breast is broken to a culture solution (pH5.5) containing 0.3 wt% and 0.8 wt% of sodium chloride for salt stress resistance treatment, and observing the salt resistance after the seeds grow for 2 weeks. The culture solution is 800 Xyoshida rice nutrient solution of Ku Laibop technology Limited in Beijing.

FIG. 1 is a schematic diagram showing the alignment of the OsRR22 gene and OsRR22 mutant gene of wild type rice in example 2.

FIG. 2 is a schematic diagram showing the genomic position of the OsRR22 mutant gene in example 2.

As can be seen from FIGS. 1 and 2, compared with the OsRR22 gene of wild-type rice, there is 5 bp [ TTTGG ] deletion between 4139729 and 4139733 of mutant OsRR22, and the deletion is located in the 5 th exon region.

FIG. 3 is a graph showing the identification of salt-tolerant phenotype of wild-type rice and rice containing OsRR22 mutant gene in example 2 by hydroponics under the condition of sodium chloride concentration of 0.3% and 0.8%. Wherein W represents a wild type; m represents a mutant.

As can be seen from FIG. 3, at 0.3 wt% sodium chloride, growth of wild type rice was inhibited and the leaves became yellow, whereas rice containing the OsRR22 mutant gene grew vigorously and the leaves did not wither and yellow. While the growth of wild rice was inhibited and died at 0.8 wt% sodium chloride, the growth of rice containing OsRR22 mutant gene was inhibited but no death occurred.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Those skilled in the art can modify or change the above-described embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Sequence listing

<110> research institute of nuclear agriculture and space breeding in Hunan province

<120> OsRR22 mutant and screening method and application thereof

<160> 33

<170> SIPOSequenceListing 1.0

<210> 1

<211> 694

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Leu Leu Gly Ala Leu Arg Met Glu Glu Arg Lys Gly Leu Met Gly

1 5 10 15

Arg Glu Arg Asp Gln Phe Pro Val Gly Met Arg Val Leu Ala Val Asp

20 25 30

Asp Asp Pro Val Cys Leu Lys Val Leu Glu Thr Leu Leu Arg Arg Cys

35 40 45

Gln Tyr His Val Thr Ser Thr Asn Gln Ala Ile Thr Ala Leu Lys Leu

50 55 60

Leu Arg Glu Asn Arg Asp Met Phe Asp Leu Val Ile Ser Asp Val His

65 70 75 80

Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu Leu Val Gly Leu Glu

85 90 95

Met Asp Leu Pro Val Ile Met Leu Ser Val Asn Gly Glu Thr Lys Thr

100 105 110

Val Met Lys Gly Ile Thr His Gly Ala Cys Asp Tyr Leu Leu Lys Pro

115 120 125

Val Arg Ile Glu Glu Leu Arg Asn Ile Trp Gln His Val Val Arg Arg

130 135 140

Lys Phe Gly Asn Arg Glu Arg Asn Asn Leu Asp Phe Ser Lys Glu Cys

145 150 155 160

Asn Lys Pro Gln Ser Ala Asp Thr Asp His Gly Pro Tyr Gln Pro Thr

165 170 175

Cys Gly Ser Ser Asp Gln Asn Gly Arg Ser Ser Arg Lys Arg Lys Glu

180 185 190

Leu His Gly Glu Asp Asp Asp Glu Gly Asp Asp Asn Asp Tyr Gln Glu

195 200 205

Asn Asp Glu Pro Ser Ala Ala Lys Lys Pro Arg Val Val Trp Ser Val

210 215 220

Glu Leu His Arg Lys Phe Val Ala Ala Val Asn Gln Leu Gly Ile Asp

225 230 235 240

Lys Ala Val Pro Lys Arg Ile Leu Glu Leu Met Asn Val Glu Lys Leu

245 250 255

Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr Arg Leu Tyr Leu

260 265 270

Lys Arg Leu Gly Ala Val Ala Ser Gln Gln Ala Ser Ile Val Ala Ala

275 280 285

Gly Arg Asp Pro Ser Phe Leu His Ile Gly Ala Phe Glu Gly Leu Gln

290 295 300

Ser Tyr Gln Pro Phe Ala Pro Ser Ala Ala Leu Pro Ser Phe Asn Pro

305 310 315 320

His Gly Leu Leu Thr Arg Thr Ser Ala Ala Ala Ala Phe Gly Leu Gln

325 330 335

Glu Leu Ala Ala Pro Ser Ser Thr Ile Gln Thr Ser Thr Gly Asn Val

340 345 350

Thr Val Gly His Cys Leu Glu Glu Asn Gln Gln Ala Asn Leu Ala Gln

355 360 365

Gly Leu Thr Ala Ala Ile Gly Gln Pro Gln Leu Gln Gln Asn Trp Ile

370 375 380

His Gln Glu Gly Asn Gly Leu Ser Asp Val Phe Ser Gly Ser Ser Leu

385 390 395 400

Thr Asn Thr Leu Ser Ser Thr Leu Gln Arg Val Pro Ser Ser Ser Leu

405 410 415

Pro Pro Gln Glu Leu Leu Glu Cys Lys Gln Ala Lys Val Ser Met Pro

420 425 430

Pro Ser Ile Arg Ile Pro Pro Ser Ser Ser Ala Leu Leu Glu Arg Thr

435 440 445

Leu Gly Val Ser Thr Asn Leu Gly Asp Ser Ser Ile Ser Gln Gln Gly

450 455 460

Ala Leu Pro Ile Asp Gly Gly Phe Ser Ala Asp Arg Leu Pro Leu His

465 470 475 480

Ser Ser Phe Asp Gly Ala Val Ala Thr Lys Leu Asp Thr Ser Leu Ala

485 490 495

Ala Ser Gln Arg Glu Ile Gly Gln Gln Gly Lys Phe Ser Val Ser Met

500 505 510

Leu Val Ser Pro Ser Asp Asn Leu Ala Leu Ala Lys Asn Ala Lys Thr

515 520 525

Gly Ala Ser Ser Ser Gly Ser Thr Ile Ile Leu Pro Leu Asp Thr Ala

530 535 540

Arg His Ser Asp Tyr Leu Gln Phe Gly Gly Ala Ser Asn Ser Leu Gln

545 550 555 560

Lys Met Asp Gly Gln Lys Gln Asp His Ile Gln Ser Ser Asn Ile Ile

565 570 575

Trp Ser Ser Met Pro Ser Thr Gln Leu Pro Ser Asp Thr Gln Ile His

580 585 590

Asn Thr Gln Asn Gln Arg Leu Asp Ser Gly Ser Phe Asn His Asn Ile

595 600 605

Gly Ala His Leu Ala Asp Gln Thr Asn Ala Ser Ala Ser Ile Leu Pro

610 615 620

Gln Met Lys Phe Asp Thr Arg Ile Ser Glu Glu Lys Met Lys Gln Lys

625 630 635 640

Asn Thr Tyr Asp Leu Gly Ser Ser Lys Leu Gln Gly Gly Phe Asn Ser

645 650 655

Ser Gly Cys Asn Phe Asp Gly Leu Leu Asn Ser Ile Ile Lys Val Glu

660 665 670

Lys Asp Asp Leu Pro Phe Met Asp Asn Glu Leu Gly Cys Asp Leu Phe

675 680 685

Pro Leu Gly Ala Cys Ile

690

<210> 2

<211> 2086

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgcttctgg gtgctttgag gatggaggag aggaagggat tgatggggag ggagagggat 60

caattccccg tcggcatgcg ggtcctcgcc gtcgacgatg acccggtgtg cctcaaggtt 120

cttgagaccc tcctccggcg ctgccaatac catgtaacat caaccaacca ggctattact 180

gcgttgaagc tgctcaggga gaacagggac atgtttgatc ttgtcatcag tgatgtccac 240

atgcccgaca tggacggatt taagctcctt gagcttgtgg ggcttgaaat ggatctccca 300

gtcatcatgt tatcagtaaa tggagagaca aagactgtga tgaaggggat aactcatggt 360

gcctgtgact atcttctaaa accggtccga atcgaagaac taaggaacat atggcagcat 420

gttgttagga ggaagttcgg taatcgtgag cgaaacaatc ttgatttctc caaagaatgc 480

aataagccgc aaagcgcgga tactgatcat ggaccatacc aacctacctg tggttcttct 540

gatcaaaatg ggaggtccag caggaaaagg aaagaactac acggcgagga cgacgatgaa 600

ggcgatgata atgattatca agaaaatgat gagccctcag ctgcaaagaa gcccagagtt 660

gtatggtcag ttgagctgca ccgaaaattt gttgccgctg tcaaccagct tggaattgac 720

aaagctgtac caaaaagaat tcttgagctt atgaatgtgg agaaactcac cagggaaaat 780

gttgcaagtc atctacagaa gtacaggctt tacctcaaga gactaggtgc tgtagcatca 840

caacaagcca gcattgttgc tgccaggcag agatccctcc ttcttgcata ttggagcatt 900

tgaaggactc cagagctatc aaccttttgc accttctgct gctcttccat ctttcaatcc 960

acatggcctg ctaacccgaa ctagcgccgc cgcggctttc ggacttcagg agcttgctgc 1020

cccctccagc acaattcaga cttctacagg aaatgtcaca gttggccatt gcttggaaga 1080

aaaccagcag gcaaatctag cacaaggctt gaccgcggcg atcgggcaac ctcagcttca 1140

acagaactgg attcatcaag aaggtaatgg tctgtctgat gttttttctg ggagttctct 1200

gaccaacact ttgtccagca cactccaaag agttccaagc agttcattgc caccacaaga 1260

actcttggag tgcaaacaag ccaaagttag catgccgcca tcgatacgga taccgccttc 1320

tagttcagca cttcttgaga ggactcttgg ggtttccacc aatttgggag attctagtat 1380

atcccagcag ggtgctcttc caatagatgg tggattttct gctgacaggt taccattgca 1440

cagttcattt gatggcgctg ttgcaacaaa gctagatact agtttggcag cttcacagag 1500

agagattggc cagcagggga aattttcagt tagcatgctt gtctcccctt ctgacaatct 1560

tgcattagcc aaaaatgcca aaactggagc tagttcttct ggcagtacta taattctccc 1620

tcttgatact gcaagacatt cagactactt gcagttcgga ggtgcaagca attctttgca 1680

gaaaatggat ggacagaaac aagatcatat acagagctca aacattatat ggagttcaat 1740

gccaagcact caactgccaa gtgataccca aattcataat actcaaaacc aaagattgga 1800

cagcggaagt tttaaccata atattggtgc ccatttggct gaccaaacaa atgcaagtgc 1860

gtcaatactt ccgcaaatga agtttgacac aagaatatca gaagagaaaa tgaagcagaa 1920

gaatacatat gacttgggta gttcaaagct gcagggtgga tttaattcta gtggctgcaa 1980

ttttgatggc cttctcaatt ccataatcaa agtggagaag gatgatctcc cattcatgga 2040

caatgaattg ggctgtgacc tttttccact tggtgcctgc atatga 2086

<210> 3

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

catcagtcca ctcatcccca tgcccccctc attctgatcc tttataaatc agccacccag 60

caagacattc ctttccaacc tcactcacct tgctctagct cagctagctc ttgctgctag 120

<210> 4

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tagcttcagc tttgctactg ctactaccac tactactact actactttca cctccaagaa 60

agtatagatt gcaagaacaa tttctgctgc tgttgttctt tcttgctgtt ctttctcctt 120

<210> 5

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtgtagttgt gtggtgtggt tgagctgagg tgtagttagg acagtggctg gctttgcttg 60

cttgattggt cacctgggaa ggtcgctgtc tctgcctttt gttttctttg ccatctcttt 120

<210> 6

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctttctgggc tgctttcacc ttttgctttc caacctcttc ttgccatcaa taatgatgga 60

ggagtaagat gagggcttgt tcttgaagtc tctccaatct aatctcattt catcttcatc 120

<210> 7

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atctccaccc ggtccaaatc cacctactac tgtttttctt ttgtcccttc tctttttttt 60

cttcctctga tcttttcttt tttcaggtgt tttgtttttg gcagtaggtg cttgctatct 120

<210> 8

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tttcattagg ctttggattt tcctctcgtg ttctttagtc tcagcctatt agaggtttga 60

ggaaagtttt ccatttctta gctctttttg cttccagctt cttgggattg ctctgtttct 120

<210> 9

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgctgagaat tggctcgatt tgggaggcct catcttgtgt tagctttcag gttttcttgc 60

ctgaaattga accgattggg taggttttta ggtgcttcag tttcagttgc tagctcgtca 120

<210> 10

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ggcttgttct tgggctcctg ccttgaattg gggtcaaatt gggatgcttc tgggtgcttt 60

gaggatggag gagaggaagg gattgatggg gagggagagg gatcaattcc ccgtcggcat 120

<210> 11

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcgggtcctc gccgtcgacg atgacccggt gtgcctcaag gttcttgaga ccctcctccg 60

gcgctgccaa taccatggtc agtatttaca gtaaccgcag ctaattgtac ttccattatc 120

<210> 12

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

caaccaggct attactgcgt tgaagctgct cagggagaac agggacatgt ttgatcttgt 60

catcagtgat gtccacatgc ccgacatgga cggatttaag ctccttgagc ttgtggggct 120

<210> 13

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tgttatcagt aaatggagag acaaagactg tgatgaaggg gataactcat ggtgcctgtg 60

actatcttct aaaaccggtc cgaatcgaag aactaaggaa catatggcag catgttgtta 120

<210> 14

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggaggaagtt cggtaatcgt gagcgaaaca atcttgattt ctccaaagaa tgcaataagc 60

cgcaaagcgc ggatactgat catggaccat accaacctac ctgtggttct tctgatcaaa 120

<210> 15

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

atgggaggtc cagcaggaaa aggaaagaac tacacggcga ggacgacgat gaaggcgatg 60

ataatgatta tcaagaaaat gatgagccct cagctgcaaa gaagcccaga gttgtatggt 120

<210> 16

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cagttgagct gcaccgaaaa tttgttgccg ctgtcaacca gcttggaatt gacagtaaga 60

aagcaccccc cccccccacc ccactttttt gcctttctgt aaatgtcctt gcaggtttgc 120

<210> 17

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tttacctcac tgttgatgca gaagctgtac caaaaagaat tcttgagctt atgaatgtgg 60

agaaactcac cagggaaaat gttgcaagtc atctacaggt atagcattta cttccatgac 120

<210> 18

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aagtacaggc tttacctcaa gagactaggt gctgtagcat cacaacaagc cagcattgtt 60

gctgcctttg gaggcagaga tccctccttc ttgcatattg gagcatttga aggactccag 120

<210> 19

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

agctatcaac cttttgcacc ttctgctgct cttccatctt tcaatccaca tggcctgcta 60

acccgaacta gcgccgccgc ggctttcgga cttcaggagc ttgctgcccc ctccagcaca 120

<210> 20

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

attcagactt ctacaggaaa tgtcacagtt ggccattgct tggaagaaaa ccagcaggca 60

aatctagcac aaggcttgac cgcggcgatc gggcaacctc agcttcaaca gaactggatt 120

<210> 21

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

catcaagaag gtaatggtct gtctgatgtt ttttctggga gttctctgac caacactttg 60

tccagcacac tccaaagagt tccaagcagt tcattgccac cacaagaact cttggagtgc 120

<210> 22

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

aaacaagcca aagttagcat gccgccatcg atacggatac cgccttctag ttcagcactt 60

cttgagagga ctcttggggt ttccaccaat ttgggagatt ctagtatatc ccagcagggt 120

<210> 23

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gctcttccaa tagatggtgg attttctgct gacaggttac cattgcacag ttcatttgat 60

ggcgctgttg caacaaagct agatactagt ttggcagctt cacagagaga gattggccag 120

<210> 24

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

caggggaaat tttcagttag catgcttgtc tccccttctg acaatcttgc attagccaaa 60

aatgccaaaa ctggagctag ttcttctggc agtactataa ttctccctct tgatactgca 120

<210> 25

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

agacattcag actacttgca gttcggaggt gcaagcaatt ctttgcagaa aatggatgga 60

cagaaacaag atcatataca gagctcaaac attatatgga gttcaatgcc aagcactcaa 120

<210> 26

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

ctgccaagtg atacccaaat tcataatact caaaaccaaa gattggacag cggaagtttt 60

aaccataata ttggtgccca tttggctgac caaacaaatg caagtgcgtc aatacttccg 120

<210> 27

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

caaatgaagt ttgacacaag aatatcagaa gagaaaatga agcagaagaa tacatatgac 60

ttgggtagtt caaagctgca gggtggattt aattctagtg gctgcaattt tgatggcctt 120

<210> 28

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

gagaaggatg atctcccatt catggacaat gaattgggct gtgacctttt tccacttggt 60

gcctgcatat gaatccatca tttcggacac caaagatttt gcataatcta aaagagtcag 120

<210> 29

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ctgtgctgcc tgatctgtgc tacttcatcc aggctttgtg tatactagga tctagggaca 60

gtagtggctt gtaatcttgc tttatctctt ctctagggtt ggctatggaa gtatggttag 120

<210> 30

<211> 2091

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

atgcttctgg gtgctttgag gatggaggag aggaagggat tgatggggag ggagagggat 60

caattccccg tcggcatgcg ggtcctcgcc gtcgacgatg acccggtgtg cctcaaggtt 120

cttgagaccc tcctccggcg ctgccaatac catgtaacat caaccaacca ggctattact 180

gcgttgaagc tgctcaggga gaacagggac atgtttgatc ttgtcatcag tgatgtccac 240

atgcccgaca tggacggatt taagctcctt gagcttgtgg ggcttgaaat ggatctccca 300

gtcatcatgt tatcagtaaa tggagagaca aagactgtga tgaaggggat aactcatggt 360

gcctgtgact atcttctaaa accggtccga atcgaagaac taaggaacat atggcagcat 420

gttgttagga ggaagttcgg taatcgtgag cgaaacaatc ttgatttctc caaagaatgc 480

aataagccgc aaagcgcgga tactgatcat ggaccatacc aacctacctg tggttcttct 540

gatcaaaatg ggaggtccag caggaaaagg aaagaactac acggcgagga cgacgatgaa 600

ggcgatgata atgattatca agaaaatgat gagccctcag ctgcaaagaa gcccagagtt 660

gtatggtcag ttgagctgca ccgaaaattt gttgccgctg tcaaccagct tggaattgac 720

aaagctgtac caaaaagaat tcttgagctt atgaatgtgg agaaactcac cagggaaaat 780

gttgcaagtc atctacagaa gtacaggctt tacctcaaga gactaggtgc tgtagcatca 840

caacaagcca gcattgttgc tgcctttgga ggcagagatc cctccttctt gcatattgga 900

gcatttgaag gactccagag ctatcaacct tttgcacctt ctgctgctct tccatctttc 960

aatccacatg gcctgctaac ccgaactagc gccgccgcgg ctttcggact tcaggagctt 1020

gctgccccct ccagcacaat tcagacttct acaggaaatg tcacagttgg ccattgcttg 1080

gaagaaaacc agcaggcaaa tctagcacaa ggcttgaccg cggcgatcgg gcaacctcag 1140

cttcaacaga actggattca tcaagaaggt aatggtctgt ctgatgtttt ttctgggagt 1200

tctctgacca acactttgtc cagcacactc caaagagttc caagcagttc attgccacca 1260

caagaactct tggagtgcaa acaagccaaa gttagcatgc cgccatcgat acggataccg 1320

ccttctagtt cagcacttct tgagaggact cttggggttt ccaccaattt gggagattct 1380

agtatatccc agcagggtgc tcttccaata gatggtggat tttctgctga caggttacca 1440

ttgcacagtt catttgatgg cgctgttgca acaaagctag atactagttt ggcagcttca 1500

cagagagaga ttggccagca ggggaaattt tcagttagca tgcttgtctc cccttctgac 1560

aatcttgcat tagccaaaaa tgccaaaact ggagctagtt cttctggcag tactataatt 1620

ctccctcttg atactgcaag acattcagac tacttgcagt tcggaggtgc aagcaattct 1680

ttgcagaaaa tggatggaca gaaacaagat catatacaga gctcaaacat tatatggagt 1740

tcaatgccaa gcactcaact gccaagtgat acccaaattc ataatactca aaaccaaaga 1800

ttggacagcg gaagttttaa ccataatatt ggtgcccatt tggctgacca aacaaatgca 1860

agtgcgtcaa tacttccgca aatgaagttt gacacaagaa tatcagaaga gaaaatgaag 1920

cagaagaata catatgactt gggtagttca aagctgcagg gtggatttaa ttctagtggc 1980

tgcaattttg atggccttct caattccata atcaaagtgg agaaggatga tctcccattc 2040

atggacaatg aattgggctg tgaccttttt ccacttggtg cctgcatatg a 2091

<210> 31

<211> 696

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 31

Met Leu Leu Gly Ala Leu Arg Met Glu Glu Arg Lys Gly Leu Met Gly

1 5 10 15

Arg Glu Arg Asp Gln Phe Pro Val Gly Met Arg Val Leu Ala Val Asp

20 25 30

Asp Asp Pro Val Cys Leu Lys Val Leu Glu Thr Leu Leu Arg Arg Cys

35 40 45

Gln Tyr His Val Thr Ser Thr Asn Gln Ala Ile Thr Ala Leu Lys Leu

50 55 60

Leu Arg Glu Asn Arg Asp Met Phe Asp Leu Val Ile Ser Asp Val His

65 70 75 80

Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu Leu Val Gly Leu Glu

85 90 95

Met Asp Leu Pro Val Ile Met Leu Ser Val Asn Gly Glu Thr Lys Thr

100 105 110

Val Met Lys Gly Ile Thr His Gly Ala Cys Asp Tyr Leu Leu Lys Pro

115 120 125

Val Arg Ile Glu Glu Leu Arg Asn Ile Trp Gln His Val Val Arg Arg

130 135 140

Lys Phe Gly Asn Arg Glu Arg Asn Asn Leu Asp Phe Ser Lys Glu Cys

145 150 155 160

Asn Lys Pro Gln Ser Ala Asp Thr Asp His Gly Pro Tyr Gln Pro Thr

165 170 175

Cys Gly Ser Ser Asp Gln Asn Gly Arg Ser Ser Arg Lys Arg Lys Glu

180 185 190

Leu His Gly Glu Asp Asp Asp Glu Gly Asp Asp Asn Asp Tyr Gln Glu

195 200 205

Asn Asp Glu Pro Ser Ala Ala Lys Lys Pro Arg Val Val Trp Ser Val

210 215 220

Glu Leu His Arg Lys Phe Val Ala Ala Val Asn Gln Leu Gly Ile Asp

225 230 235 240

Lys Ala Val Pro Lys Arg Ile Leu Glu Leu Met Asn Val Glu Lys Leu

245 250 255

Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr Arg Leu Tyr Leu

260 265 270

Lys Arg Leu Gly Ala Val Ala Ser Gln Gln Ala Ser Ile Val Ala Ala

275 280 285

Phe Gly Gly Arg Asp Pro Ser Phe Leu His Ile Gly Ala Phe Glu Gly

290 295 300

Leu Gln Ser Tyr Gln Pro Phe Ala Pro Ser Ala Ala Leu Pro Ser Phe

305 310 315 320

Asn Pro His Gly Leu Leu Thr Arg Thr Ser Ala Ala Ala Ala Phe Gly

325 330 335

Leu Gln Glu Leu Ala Ala Pro Ser Ser Thr Ile Gln Thr Ser Thr Gly

340 345 350

Asn Val Thr Val Gly His Cys Leu Glu Glu Asn Gln Gln Ala Asn Leu

355 360 365

Ala Gln Gly Leu Thr Ala Ala Ile Gly Gln Pro Gln Leu Gln Gln Asn

370 375 380

Trp Ile His Gln Glu Gly Asn Gly Leu Ser Asp Val Phe Ser Gly Ser

385 390 395 400

Ser Leu Thr Asn Thr Leu Ser Ser Thr Leu Gln Arg Val Pro Ser Ser

405 410 415

Ser Leu Pro Pro Gln Glu Leu Leu Glu Cys Lys Gln Ala Lys Val Ser

420 425 430

Met Pro Pro Ser Ile Arg Ile Pro Pro Ser Ser Ser Ala Leu Leu Glu

435 440 445

Arg Thr Leu Gly Val Ser Thr Asn Leu Gly Asp Ser Ser Ile Ser Gln

450 455 460

Gln Gly Ala Leu Pro Ile Asp Gly Gly Phe Ser Ala Asp Arg Leu Pro

465 470 475 480

Leu His Ser Ser Phe Asp Gly Ala Val Ala Thr Lys Leu Asp Thr Ser

485 490 495

Leu Ala Ala Ser Gln Arg Glu Ile Gly Gln Gln Gly Lys Phe Ser Val

500 505 510

Ser Met Leu Val Ser Pro Ser Asp Asn Leu Ala Leu Ala Lys Asn Ala

515 520 525

Lys Thr Gly Ala Ser Ser Ser Gly Ser Thr Ile Ile Leu Pro Leu Asp

530 535 540

Thr Ala Arg His Ser Asp Tyr Leu Gln Phe Gly Gly Ala Ser Asn Ser

545 550 555 560

Leu Gln Lys Met Asp Gly Gln Lys Gln Asp His Ile Gln Ser Ser Asn

565 570 575

Ile Ile Trp Ser Ser Met Pro Ser Thr Gln Leu Pro Ser Asp Thr Gln

580 585 590

Ile His Asn Thr Gln Asn Gln Arg Leu Asp Ser Gly Ser Phe Asn His

595 600 605

Asn Ile Gly Ala His Leu Ala Asp Gln Thr Asn Ala Ser Ala Ser Ile

610 615 620

Leu Pro Gln Met Lys Phe Asp Thr Arg Ile Ser Glu Glu Lys Met Lys

625 630 635 640

Gln Lys Asn Thr Tyr Asp Leu Gly Ser Ser Lys Leu Gln Gly Gly Phe

645 650 655

Asn Ser Ser Gly Cys Asn Phe Asp Gly Leu Leu Asn Ser Ile Ile Lys

660 665 670

Val Glu Lys Asp Asp Leu Pro Phe Met Asp Asn Glu Leu Gly Cys Asp

675 680 685

Leu Phe Pro Leu Gly Ala Cys Ile

690 695

<210> 32

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tgtgacatgc agaagtacag g 21

<210> 33

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

aaggttgata gctctggagt c 21

Claims (8)

1. OsRR22 mutant characterized in thatOsRR22 the amino acid sequence of the mutant is shown in SEQ ID NO. 1.

2. The method of claim 1OsRR22 mutant characterized in thatOsRR22 a method for identifying a mutant comprising the steps of:

1) after radiation mutagenesis is carried out on the plant, extracting genome DNA, and constructing a DNA library according to the genome DNA;

2) according to wild type riceOsRR22, designing a probe by using a gene; hybridizing the probe to the DNA library;

3) enriching the hybridized product by using magnetic beads to construct an enriched library;

4) subjecting said enriched library to an identification analysis to identify the presence or absence of saidOsRR22 mutant.

3. The method of claim 2OsRR22 mutant characterized in that it comprises at least one of the following technical features:

1) the radiation mutagenesis comprises gamma ray mutagenesis and/or heavy ion mutagenesis;

2) the sequence of the probe is shown as SEQ ID NO. 3-SEQ ID NO. 29;

3) the probe is a biotin-labeled probe;

4) the magnetic beads are streptavidin marked magnetic beads.

4. The method of claim 2OsRR22 mutant, characterized in that the method in step 1) is as follows:

a) carrying out radiation mutagenesis on seeds of the plants to obtain M1 generation seeds;

b) planting the M1 generation seeds to obtain M2 generation seeds;

c) planting the M2 generation seeds, taking leaves on each planted individual plant, and mixing the leaves of each individual plant;

d) extracting the genomic DNA from the mixed leaves;

e) and (2) fragmenting the genome DNA, adding A tail to the fragmented DNA fragment, connecting a sequencing adaptor, and amplifying to obtain the DNA library.

5. And as claimed in any one of claims 1 to 4OsRR22 mutant-related biomaterial, comprising any of:

a) a polynucleotide encoding the mutant of claim 1;

b) a recombinant expression vector comprising the polynucleotide of a);

c) a bioengineering bacterium containing the polynucleotide of a) or a bioengineering bacterium containing the recombinant expression vector of b).

6. The biomaterial of claim 5, wherein in a), the nucleotide sequence of the polynucleotide is as shown in SEQ ID No. 2.

7. The method of any one of claims 1 to 4OsRR2Use of a mutant of 2 or a biomaterial as claimed in any one of claims 5 to 6 for modulating plant stress resistance; the regulation and control of the stress resistance of the plants are to improve the salt tolerance of the plants; the plant is rice.

8. A method for producing a plant having high stress resistance, comprising introducing the mutant according to claim 1 into a plant under salt stress, and producing the plant; the plant is rice; the stress resistance is to improve the salt tolerance of the plant.

Images