CN108424909A - A kind of cilium assembly and regulation gene and its coding albumen, acquisition methods and application - Google Patents

A kind of cilium assembly and regulation gene and its coding albumen, acquisition methods and application Download PDF

Info

Publication number
CN108424909A
CN108424909A CN201810210290.0A CN201810210290A CN108424909A CN 108424909 A CN108424909 A CN 108424909A CN 201810210290 A CN201810210290 A CN 201810210290A CN 108424909 A CN108424909 A CN 108424909A
Authority
CN
China
Prior art keywords
cilium
gene
xap5
assembly
regulation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810210290.0A
Other languages
Chinese (zh)
Other versions
CN108424909B (en
Inventor
胡长峰
田广梅
李丽丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Gengtianxia Biotechnology Co ltd
Original Assignee
Jianghan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jianghan University filed Critical Jianghan University
Priority to CN201810210290.0A priority Critical patent/CN108424909B/en
Publication of CN108424909A publication Critical patent/CN108424909A/en
Application granted granted Critical
Publication of CN108424909B publication Critical patent/CN108424909B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/405—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a kind of cilium assembly and regulation gene and its coding albumen, acquisition methods and application, for the gene source in Chlamydomonas reinhardtii, the Gene Name is XAP5, and the gene includes such as SEQ ID NO:CDNA sequence shown in 1；Or include SEQ ID NO:The polynucleotides of coded protein sequence shown in 2；Or comprising with SEQ ID NO:CDNA sequence defined by 1 has 90% or more homology and encodes the nucleotide sequence of identical function albumen.The present invention will be in VIII segment radom insertions to chlamydomonas of aph by electroporated method, obtain cilium assembling deficiency mutation algae strain af1 x, cilium assembly and regulation key gene XAP5 is obtained by identification, build chlamydomonas expression vector, and it imports in af1 x chlamydomonas, research finds that the function of mutation algae strain has obtained complementation, and cilium can be assembled normally.XAP5 genes of the present invention and its coding albumen can be further used for the research of the assembly and regulation mechanism of cilium and the research and treatment etc. of cilium relevant disease.

Description

A kind of cilium assembly and regulation gene and its coding albumen, acquisition methods and application
Technical field
The present invention relates to biotechnologies, and in particular to a kind of cilium assembly and regulation gene and its coding albumen obtain Methods and applications.
Background technology
Cilium is also known as flagellum, is that one kind is widely present in most of eukaryotic cells surface and has polar structure Organelle.Cilium has certain perception effect, it can perceive the variation of extraneous some physics and chemical signal, and By signal transduction to cell interior.Exactly because cilium has the function of more complex structure and signal transduction, therefore once lacks It may result in the generation of cilium relevant disease, such as motionless disease, situs inversus viscerum, hypertension and the obesity of breathing problem, sperm Disease etc..Cilium has very conservative structure.
The usually life of earliest unicellular organism in water, and has cilium.Cilium is mainly by cilium film, axial filament and fibre Hair matrix three parts form.Cilium film is connected to cell membrane, is the extension of cell membrane, but not with the protein component of cell membrane Together, axial filament is made of the cellular microtubules beam and its accessory protein that are assembled since matrix, and cilium matrix is mainly cilium film Filler between axial filament, majority are soluble albumen.The main skeleton of cilium is micro- by 9 duplexes of cilium axial filament Pipe forms, according to whether having motility, and cilium is divided into " 9+2 " sports type cilium and " 9+0 " not ejector half cilium (primary fibre Hair).
It is understood that all having cilium in the puberty of embryo and many cells of adult, cilium is in cell Movement and signal transduction tool play a very important role, and cilium has high complexity, once cilium is in structure or function Defect occurs, then the development that will result in human body is abnormal and numerous diseases, people are by this disease caused by cilium Disease is named " cilium relevant disease ".Cilium is divided into primary cilium, kinocilium, non-motile cilia, perception cilium etc., different types of fibre Hair life defect will cause various " cilium relevant diseases ".
Chlamydomonas reinhardtii is a kind of single celled eucaryote, simple in structure, and breeding is fast.Defect is assembled by screening cilium Chlamydomonas mutant, identification and clone's cilium regulate and control relevant key gene, study the assembly and regulation mechanism of cilium, will be that the mankind exist It was found that, provide important theoretical foundation in terms of research and treatment cilium relevant disease.
Invention content
For the above problem in background technology, one of main object of the present invention is to provide a kind of cilium assembly and regulation Gene derives from Chlamydomonas reinhardtii, can be further used for the research of assembly and regulation mechanism and the grinding for cilium relevant disease of cilium Study carefully and treat etc..
In order to achieve the above object, the present invention adopts the following technical scheme that：A kind of cilium assembly and regulation gene derives from Lay Mattress chlamydomonas, the Gene Name are XAP5 (X-chromosome-associated protein 5), and the gene includes such as SEQ ID NO:CDNA sequence shown in 1；Or include SEQ ID NO:The polynucleotides of coded protein sequence shown in 2； Or comprising with SEQ ID NO:CDNA sequence defined by 1 is with 90% or more homology and encodes identical function egg White nucleotide sequence.
Another object of the present invention is to provide the acquisition methods of above-mentioned cilium assembly and regulation gene, include the following steps：
It will be in the VIII segment radom insertions to chlamydomonas of aph that encode paromomycin resistance by electroporated method；Pass through screening Obtain cilium assembling deficiency mutation algae strain af1-x；It identifies to obtain the gene for cilium assembly and regulation by RESDA-PCR XAP5。
As a further preference, the sequence of VIII segments of the aph such as SEQ ID NO:Shown in 3.
Another object of the present invention also resides in the coding albumen for providing above-mentioned cilium assembly and regulation gene, the coding albumen Contain SEQ ID NO:Amino acid sequence shown in 2, or comprising by SEQ ID NO:Amino acid sequence shown in 2 is by multiple What the the replacing, missing or adding of amino acid to be formed has identical active derived protein.
Another object of the present invention, which also resides in, provides the expression vector containing above-mentioned cilium assembly and regulation gene.
Another object of the present invention, which also resides in, provides the host cell containing above-mentioned cilium assembly and regulation gene.
Another object of the present invention also resides in the acquisition side for providing the expression vector containing above-mentioned cilium assembly and regulation gene Method includes the following steps：
Wild type chlamydomonas RNA is extracted, reverse transcription obtains cDNA；Design primer obtains XAP5 genes by PCR amplification；It will XAP5 genes are connected to intermediate carrier or chlamydomonas expression vector.
Another object of the present invention also resides in the acquisition side for providing the expression vector containing above-mentioned cilium assembly and regulation gene Method includes the following steps：The artificial synthesized cilium assembly and regulation gene order, carrier construction.
In addition, obtain gene order of the present invention by artificial synthesized or other means, carrier construction or it is transferred to host Cell, within protection scope of the present invention.
The beneficial effects of the invention are as follows：Cilium assembly and regulation gene of the present invention derives from Chlamydomonas reinhardtii, the Gene Name Sequence for XAP5, the gene includes such as SEQ ID NO:CDNA sequence shown in 1；Or include SEQ ID NO:Shown in 2 Coded protein sequence polynucleotides；Or comprising with SEQ ID NO:CDNA sequence defined by 1 have 90% with On homology and encode the nucleotide sequence of identical function albumen.What is identified in the present invention is related to cilium assembly and regulation Gene XAP5 after, prove to restore the coding albumen of XAP5 in mutant by complementary assay and expressed, cilium phenotype is restored Normally, it further demonstrates XAP5 and plays crucial effect in terms of regulating and controlling cilium assembling.Thus, it is provided in the present invention XAP5 genes and its coding albumen are the key gene and albumen of cilium assembly and regulation, can be cilium assembly and regulation mechanism Research, cilium defect cause the research of cilium disease and treatment to provide theoretical foundation.
It is lacked in addition, the present invention in VIII segment radom insertions to chlamydomonas of aph, will obtain cilium assembling by electroporated method Swaged is mutated algae strain af1-x, obtains cilium assembly and regulation key gene XAP5 by identification, builds chlamydomonas expression vector, will wrap The expression vector or host cell of the XAP5 containing gene imports the cilium assembling deficiency mutation algae strain (af1-x) that the present invention obtains In, research finds that the function of mutation algae strain has obtained complementation, and cilium can be assembled normally.
Description of the drawings
Fig. 1 is that wild type (21gr), mutant (af1-x) and character restore algae strain (Rescued) comparison diagram.
Fig. 2 is READA-PCR product electrophoretograms.
Fig. 3 is XAP5 gene insertion mutations site schematic diagram.
Fig. 4 is the PCR electrophoretograms of XAP5 gene clonings.
Fig. 5 is XAP5 gene constructed to restriction enzyme digestion and electrophoresis figure after complementary expression vector.
Fig. 6 is the Western Blot detection figures that wild type chlamydomonas, mutant and character restore algae strain.
Specific implementation mode
The present invention passes through sieve by a kind of cilium assembly and regulation gene of offer and its coding albumen, acquisition methods and application The chlamydomonas mutant of cilium assembling defect, identification and clone's cilium is selected to regulate and control relevant key gene, study the group adjustment of cilium Control mechanism provides important theoretical foundation for the mankind in terms of discovery, research and treatment cilium relevant disease.
In order to which be more clear the present invention sets forth, the researcher for being related to this field is allowed to be better understood when this A invention will be illustrated below by several embodiments, but just for the sake of it can be preferably understood, of the invention makes It is not intended to limit herein with range.In following embodiment, specified otherwise is not all conventional method.
Embodiment one：The screening of Chlamydomonas reinhardtii cilium defect mutant
The screening of Chlamydomonas reinhardtii cilium defect mutant, including step in detail below：
The preparation of 1.1 Insert Fragments
VIII carriers of pJMG-aph (are mainly transformed by pSI103, resistance containing paromomycin), enzyme is carried out with I enzymes of EcoR It cuts, different size of DNA fragmentation is detached by DNA agarose gel electrophoresis, gel extraction is carried out to target fragment (aph VIII). Glue recycling carries out glue reclaimer operation to specifications using SanPrep gel extraction kits.
The preparation of 1.2 reinhardtii cells
Wild type algae strain (21gr) on TAP solid plates is inoculated into TAP fluid nutrient mediums, is placed under continuous illumination Culture of blowing can reach 1 × 10 in 3-4 days7Cell/ml.The above-mentioned reinhardtii cells of 10ml are taken to be forwarded to the Liquid Cultures of TAP containing 100ml It is 1 × 10 to make initial concentration in the triangular flask of base6Cell/ml is placed on shaking table (200rpm), is cultivated under the conditions of continuous illumination 20h or so makes reinhardtii cell concentration reach 5 × 106Cell/ml carries out electrotransformation experiment immediately.
1.3 electroporated acquisition transformants
Reinhardtii cell is collected with 50ml centrifuge tubes, the TAP+60mM sorbitol solutions that precooling is added are resuspended, 2500rpm centrifugations 3min, the TAP+60mM sorbierites for adding suitable precooling are resuspended, and make final concentration of 1-2 × 10 of reinhardtii cell8Cell/ Ml places 10min on ice.
In superclean bench wash-in shock by electricity cup, first washed once with absolute ethyl alcohol, then with TAP+60mM sorbierites wash three times, with Precooling electric shock cup afterwards.Precooled 1-2 × 10 250 μ l are added into electric shock cup8The reinhardtii cell of cell/ml, adds 60- VIII segment DNA of 100ng aph is gently inhaled and beats mixing, in placing 10min on ice.Adjust electric shock instrument (model BTX ECM630) Parameter is voltage 800V, 1575 Ω of resistance, 50 μ F of capacitance.The moisture for drying electric shock cup shell makes electric shock cup carry metal strip The electric shock clamping connection of both sides and electric shock instrument touches and clamps electric shock cup, puts down safety guard, and starting electric shock, (the electric shock time should control in 10- 14ms).After electric shock, electric shock cup is placed into 10min on ice.
Reinhardtii cell after electric shock is transferred in the 50ml centrifuge tubes containing 10ml TAP+60mM sorbitol solutions, is placed in 100rpm, dim light reparation are stayed overnight on shaking table.
2500rpm centrifugations 3min collects the reinhardtii cell repaired overnight, and cornstarch (the starch nothing of 1ml 20% is added Water-ethanol is washed 1 time, then is washed 3 times with sterile distilled water, is finally washed 4 times with TAP+60mM sorbierites, TAP+60mM sorbierites are used in combination It is resuspended.), mixing is beaten in suction, is laid on the TAP solid plates containing paromomycin, liquid is dried up in superclean bench, is sealed Mouthful, it is inverted under the photoperiod and cultivates, transformant can be grown within about 7 days or so.
The screening of 1.4 cilium defect mutant
After above-mentioned transformant is grown well (or so about one week), monoclonal is chosen to another new TAP solid On culture medium, and carry out number.It after new transformant is grown well, chooses into 96 orifice plates containing M culture mediums and cultivates, then aobvious The cell of dyskinesia, the as mutant of ciliary movement defect are observed and recorded under micro mirror.
1.5 ciliums assemble the acquisition of defect mutation algae strain af1-x
The embodiment of the present invention obtains a collection of chlamydomonas transformant, into one by electroporated VIII segments of method radom insertion aph The screening for carrying out cilium defect mutant to the transformant of acquisition is walked, cilium assembling defect mutation algae strain af1-x has been obtained. DIC microscopically observations find (shown in Fig. 1)：Compared with wild type chlamydomonas 21gr, af1-x be mutated algae strain in agglomerate state and Atrichia can only grow very short flagellum with the autolysin processing af1-x algaes strain after cell wall that melts away.
Embodiment two：Chlamydomonas reinhardtii cilium assembles identification and the clone of the mutator of defect mutation algae strain af1-x
2.1 ciliums assemble the identification of defect mutant af1-x mutators
2.1.1 the extraction of af1-x genomic DNAs
(1) af1-x mutant is inoculated into toothpick in fresh R culture mediums, is cultivated to concentration about under the conditions of the photoperiod It is 5 × 106It when cell/ml, collects in 4ml cells to the EP pipes of 1.5ml, supernatant is removed in centrifugation.
(2) the CTAB lysates of 700ul are added, blow and beat mixing cell, are placed on heating cracking 1h in 65 DEG C of water-bath, often It is primary every the 10min mixings that turn upside down, so that cell is fully cracked.
(3) after cell fully cracks, isometric phenol, chloroform, isoamyl alcohol (25 is added:24:1) mixed solution, top The EP of falling mixing pipe 10min, make it mix well, and 14000rpm centrifuges 10min.
(4) it sucts clearly in a new EP pipe, adds isometric chloroform, isoamyl alcohol (24:1) mixed solution, Turn upside down EP pipe 10min, it is made to mix well, and 14000rpm centrifuges 10min.
(5) it draws in the supernatant to a new EP pipe after above-mentioned centrifugation, the isopropanol of 3/4ths volumes is added, mildly Reverse EP pipes 10 times, then place 15-20min for -20 DEG C, until there is floccule precipitation.
(6) 14000rpm centrifuges 10min, discards supernatant, and the ethyl alcohol for being added 75% washs precipitation 3-5 times, every time 14000rpm centrifuges 5min, with pipettor exhaustion residual ethanol, dry DNA 5min after the washing of last time ethyl alcohol.
(7) ddH of 50 μ l is added2O dissolving DNAs, measure DNA concentration after it is spare.
2.1.2 READA-PCR identifies af1-x mutators
According to nucleic acid sequence (the SEQ ID NO of Insert Fragment aph VIII:3) special primer S1 and S2 are designed, according to chlamydomonas base It is formed because of group feature design primer Q0 and by Q0 and AluI, PstI, SacII, TaqI restriction enzyme specific recognition sequence Degenerate primer DegAluI, DegPstI, DegSacII, DegTaqI, primer specifying information are as follows：
Primer 5′—3′
S1 TTTTACCGGCTGTTGGAC
S2 AGTTCTTCTGAGGGACCTG
Q0 CCAGTGAGCAGAGTGACG
DegAluI CCAGTGAGCAGAGTGACGIIIIINNSWCAGCTT
DegPstI CCAGTGAGCAGAGTGACGIIIIINNSCTGCAGW
DegSacII CCAGTGAGCAGAGTGACGIIIIINNSCCGCGGW
DegTaqI CCAGTGAGCAGAGTGACGIIIIINNSWGTCGAA
Different from common PCR, RESDA-PCR points are two-wheeled, specific as follows：
First round PCR system：Using af1-x mutant gene group DNA as template, with forward primer S1 and reverse primer DegAluI, DegPstI, DegSacII, DegTaqI carry out PCR amplification respectively.
Second wheel amplification：Template is used as after first round PCR product is diluted 25 times, with forward primer S2 and reverse primer Q0 Carry out the second wheel PCR amplification.
The system and program of specific RESDA-PCR referring to David et al. research (David Gonz á lez- Ballester,Amaury de Montaigu,Aurora Galván,Emilio Fernández.Restriction enzyme site-directed amplification PCR:A tool to identify regions flanking a marker DNA.Analytical Biochemistry 340(2005)330–335.)。
After second wheel PCR, the second wheel PCR product is subjected to electrophoresis on 1% Ago-Gel, cuts 500bp or more Band sends to sequencing.Fig. 2 is that cilium according to the present invention assembles electrophoretograms of the defect mutant af1-x after RESDA-PCR, Wherein A, P, S, T respectively represent the amplification of the degenerate primer containing AluI, PstI, SacII, TaqI restriction endonuclease recognition sequence Product.
2.1.3 af1-x is mutated insertion mutation gene and the insertion mutation site of algae strain
READA-PCR products sequencing result is compared with chlamydomonas genome, it is found that the cilium in the present invention assembles defect Mutant af1-x is since the last one introne of XAP5 genes on the 7th article of chromosome has been inserted into VIII segments of aph and causes Insertion mutation, schematic diagram is as shown in Figure 3.
The clone of 2.2 XAP5 genes
2.2.1 the RNA extractions of Chlamydomonas reinhardtii (21gr)
Wild type chlamydomonas 21gr is chosen from solid panel to carrying out air blowing culture inside R culture mediums, when concentration 5-6 × 106When cell/ml, culture 2-3 days inside new M culture mediums are transferred to, cell concentration is made to reach 6 × 106Cell/ml is collected The EP of 1ml cells to 1.5ml are managed, and 14000rpm centrifuges 1min, abandons supernatant, liquid nitrogen flash freezer is placed on -80 DEG C and saves backup.
It is carried out using the plant total RNA extraction reagent box (Cat#RP3302) that Wuhan Bo Yue Bioisystech Co., Ltd produces The extraction of RNA, concrete operation step reference reagent box specification.
2.2.2 reverse transcription obtains cDNA
The RNA of above-mentioned acquisition is obtained into cDNA through reverse transcription, the present invention uses the full formula gold biotechnology in Beijing limited The step of reversal agents box (article No. Lot#I20818) of formula, specific reverse transcription, refers to product description.
2.2.3 the cDNA amplifications of XAP5 genes
Using the cDNA of 21gr as template, with XAP5-F, (primer sequence is： CCGCTCGAGATGTATAGCAACGGTTATGTGGGCA, wherein underscore are labeled as I restriction enzyme sites of Xho) and XAP5-R (primers Sequence is：GGAAGATCTGCCGTAGATGGTATACTCGCC, wherein underscore are labeled as II restriction enzyme sites of Bgl), HiFi Taq Enzyme carries out PCR amplification.The agarose gel electrophoresis figure of XAP5 genes is shown in Fig. 4.Glue recycles target fragment, connects carrier T, and conversion is big Enterobacteria competent cell DH5 α, choose positive colony and send to sequencing.Sequencing result and SEQ ID NO:1 is consistent.
Embodiment three：The character complementation test of chlamydomonas cilium defect mutant (af1-x, that is, xap5)
3.1 complementary expression vector establishments
The plasmid of pEV-AR4-Ble2A-HA zero loads and XAP5-T carriers is subjected to double digestion with Bgl II and I enzymes of Xho, electricity Swimming detection digestion effect, glue recycles linear carrier segments and XAP5 segments, T4 DNA ligases are attached.10ul connections are produced Object is transferred to by heat-shock transformed method in competent escherichia coli cell DH5 α, is sieved with the LB solid plates containing AMP resistances Choosing, picking positive colony carry out shaking bacterium, extraction plasmid.The recombinant plasmid for taking 2 μ g carries out double digestion, enzyme with Bgl II and I enzymes of Xho It cuts product and carries out 1% agarose gel electrophoresis detection, as a result show (Fig. 5)：XAP5 genes are successfully building up to chlamydomonas expression vector On, it is named as pEV-AR4-Ble2A-XAP5-HA.
3.2 characters restore the screening of algae strain
3.2.1 the preparation of mutant chlamydomonas af1-x competent cells
The strain of af1-x algaes is inoculated into TAP fluid nutrient mediums, is placed under continuous illumination culture 3-4 days of blowing, then by cell It is forwarded in the triangular flask of the fluid nutrient mediums of TAP containing 100ml, initial concentration is 1 × 106Cell/ml, continuous illumination culture 20h Left and right.Af1-x cells are collected with 50ml centrifuge tubes, the TAP+60mM sorbitol solutions that precooling is added are resuspended, 2500rpm centrifugations 3min, the TAP+60mM sorbierites for adding suitable precooling are resuspended, and make final concentration of 1-2 × 10 of reinhardtii cell8Cell/ Ml places 10min on ice.
3.2.2 recombinant plasmid is linearized
The recombinant plasmid pEV-AR4-Ble2A-XAP5-HA for taking 5 μ g to contain XAP5 genes is stayed overnight, linearly with I digestions of Xba Change product with the SanPrep pillar PCR product purification kits of raw work to be purified.
3.2.3 electroporated
Precooled 1-2 × 10 250 μ l are added into the electric shock cup of precooling8The af1-x competent cells of cell/ml and 10 The recombinant DNA of μ l linearisations, suction beat mixing, place 10min on ice, shocked by electricity with electric shock instrument (BTX ECM630).After electric shock, Electric shock cup is placed into 10min on ice, cell is transferred in the centrifuge tube of the sorbitol solution containing TAP+60mM, dim light on shaking table It repairs overnight.
The cell repaired overnight is collected, the cornstarch of 1ml 20% is added, suction beats mixing, is laid in the resistance containing ble TAP tablets, dry up liquid, and sealing is inverted culture, grows transformant within about 7 days.
3.2.4 the algae strain that screening character is restored
After son to be transformed is long good, monoclonal is chosen on new TAP tablets and numbering.After growth 3-4 days, monoclonal is chosen Extremely cultivated in 96 orifice plates containing M culture mediums.Microscopically observation, record, the possibility for capableing of proper motion are exactly that character is restored Algae strain.
3.3 characters restore further determining that for algae strain
3.3.1 the micro- sem observation characters of DIC restore the flagellum of algae strain
Wild type chlamydomonas (21gr), cilium assembling defect mutant (af1-x) and recovery algae strain are carried out in M culture mediums Activation.It takes 100 μ l cells to be fixed with isopentyl aldehyde respectively, is observed under DIC microscopes.As shown in Figure 1, af1-x is prominent Variant does not have flagellum or has very short flagellum, and the flagellum for restoring algae strain restores normal, does not have difference with wild type.
3.3.2 Western Blot detections
Picking wild type chlamydomonas (21gr), mutant (af1-x) are distinguished from solid plate and restore algae strain (xap5:: XAP5、xap5::XAP5-HA), blow and cultivate 3-4 days in R culture mediums, be forwarded in M culture mediums and continue culture 1-2 days.It receives Collection 1 × 107Cell carries out Western Blot detections with XAP5 antibody, HA antibody and α-Tubulin antibody respectively.Electrophoresis knot Fruit is as shown in Figure 6：By α-Tubulin antibody test Tubulin albumen and coomassie brilliant blue staining as a result, showing each sample Between albumen applied sample amount it is consistent.In addition to mutant (af1-x, that is, xap5), wild type chlamydomonas restores algae strain (xap5::XAP5 and xap5::XAP5-HA the XAP5 albumen in) has expression.With HA antibody tests, restore algae strain (xap5::XAP5-HA) also there is mesh Mark band.Western Blot testing results further demonstrate the cilium of af1-x, and can not normally to assemble be due to XAP5 bases Caused by mutation, XAP5 genes and its coding albumen play an important role in cilium assembly and regulation.
Technical solution in above-mentioned the embodiment of the present application, at least has the following technical effect that or advantage：
Cilium assembly and regulation gene of the present invention, derives from Chlamydomonas reinhardtii, and the Gene Name is XAP5, the sequence of the gene Row are comprising such as SEQ ID NO:CDNA sequence shown in 1；Or include SEQ ID NO:Coded protein sequence shown in 2 it is more Nucleotide；Or comprising with SEQ ID NO:CDNA sequence defined by 1 is with 90% or more homology and encodes phase The nucleotide sequence of congenerous albumen.Identified in the present invention with after the relevant gene XAP5 of cilium assembly and regulation, by mutual Mending experiment proves that the coding albumen for restoring XAP5 in mutant is expressed, and cilium phenotype restores normal, further demonstrates XAP5 plays crucial effect in terms of regulating and controlling cilium assembling.Thus, the XAP5 genes and its coding egg provided in the present invention In vain, it is the key gene and albumen of cilium assembly and regulation, can be research, the cilium defect of cilium assembly and regulation mechanism leads to fibre The research and treatment of hair disease provide theoretical foundation.
It is lacked in addition, the present invention in VIII segment radom insertions to chlamydomonas of aph, will obtain cilium assembling by electroporated method Swaged is mutated algae strain af1-x, obtains cilium assembly and regulation key gene XAP5 by identification, builds chlamydomonas expression vector, will wrap The expression vector or host cell of the XAP5 containing gene imports the cilium assembling deficiency mutation algae strain (af1-x) that the present invention obtains In, research finds that the function of mutation algae strain has obtained complementation, and cilium can be assembled normally.
In addition, cilium defect mutant screening system provided in an embodiment of the present invention is easy to operate quickly, it is applied widely, The screening of mutant can efficiently be carried out.After the mutant M fluid nutrient medium cultures that screening is obtained, directly under the microscope Observation can simply, accurately screen the mutant of movement defect.
Although preferred embodiments of the present invention have been described, it is created once a person skilled in the art knows basic Property concept, then additional changes and modifications may be made to these embodiments.So it includes excellent that the following claims are intended to be interpreted as It selects embodiment and falls into all change and modification of the scope of the invention.Obviously, those skilled in the art can be to the present invention Carry out various modification and variations without departing from the spirit and scope of the present invention.If in this way, these modifications and changes of the present invention Within the scope of the claims of the present invention and its equivalent technology, then the present invention is also intended to exist comprising these modification and variations It is interior.
Sequence table
<110>Jianghan University
<120>A kind of cilium assembly and regulation gene and its coding albumen, acquisition methods and application
<130> 2018
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1155
<212> DNA
<213> artifical sequence
<400> 1
atgtatagca acggttatgt gggcaccggc gaggatgtgc agcgcatccg gcgcatggag 60
aagcagcgcg aggaacagaa gaagaaatat gagcagatgc acaagcagac gaaagaccaa 120
gcggatgcgg cgggactcag gcaattcggc gcatccactg aggaggcgct agagcacgcg 180
ttcaagaacg agacggtggg cctggtcaca aaggcggagt tcatccagaa gcgcactacg 240
ctgcaggagc gtatggagga ggagcagcgg cgaaaggtgg aggcggacga ggacgcggcg 300
aacaaggagc gagagaagcg gaaacgggag aaggagttga gaaagcccaa gctcagcttc 360
tttgctgacg aggagcagga gggcgaggag gacgaggagg atgcccggcc gcctgtgaag 420
ccggccttca agctccctgc gctggcgcgg gtagcggcgg cggcgcagcc acccgagcca 480
gcggcggaca acggcgcggc cgcacggtca ggcagcgagg agccggcggg cagcgagggc 540
ggcaacggca gcgacggcgg caacggtttg tcgaagaagc agcgcaagtt cgggaaattc 600
ggcaaggacc caaccgtgac caccgacttc ctacccgaca aggaccggga gcggctggag 660
ctggagatgc gggcgcagct gcgcaaggag tggcagctgg cgcaggacgt gatcaaggcc 720
gagccgctca ccatcaccta ctcctactgg aacggcacag gacaccgccg caacgtgtcc 780
gtcaagaagg gcgactccat cggcggcttc ctcaaggccg tgcgcgagca gctggcgccc 840
gagttccgcg agctgcggca cgtgggcatc gacaacctca tgtacatcaa ggaagatttg 900
atcatgccgc accaccacac cttctacgag ctcatcatca gcaaggcgcg aggcaagtcg 960
ggcccgctgt ttgacttcac ggtcaaggac gacattcgca ttaccaacga cgccactcag 1020
gagaagcagg acacacacgc cggcaaggtg gtggagcgcc actggtacga caagaacaag 1080
cacatcttcc ccgccagccg ctgggagatt tacgatcccg agaagaagta cggcgagtat 1140
accatctacg gctga 1155
<210> 2
<211> 384
<212> PRT
<213> artifical sequence
<400> 2
Met Tyr Ser Asn Gly Tyr Val Gly Thr Gly Glu Asp Val Gln Arg Ile
1 5 10 15
Arg Arg Met Glu Lys Gln Arg Glu Glu Gln Lys Lys Lys Tyr Glu Gln
20 25 30
Met His Lys Gln Thr Lys Asp Gln Ala Asp Ala Ala Gly Leu Arg Gln
35 40 45
Phe Gly Ala Ser Thr Glu Glu Ala Leu Glu His Ala Phe Lys Asn Glu
50 55 60
Thr Val Gly Leu Val Thr Lys Ala Glu Phe Ile Gln Lys Arg Thr Thr
65 70 75 80
Leu Gln Glu Arg Met Glu Glu Glu Gln Arg Arg Lys Val Glu Ala Asp
85 90 95
Glu Asp Ala Ala Asn Lys Glu Arg Glu Lys Arg Lys Arg Glu Lys Glu
100 105 110
Leu Arg Lys Pro Lys Leu Ser Phe Phe Ala Asp Glu Glu Gln Glu Gly
115 120 125
Glu Glu Asp Glu Glu Asp Ala Arg Pro Pro Val Lys Pro Ala Phe Lys
130 135 140
Leu Pro Ala Leu Ala Arg Val Ala Ala Ala Ala Gln Pro Pro Glu Pro
145 150 155 160
Ala Ala Asp Asn Gly Ala Ala Ala Arg Ser Gly Ser Glu Glu Pro Ala
165 170 175
Gly Ser Glu Gly Gly Asn Gly Ser Asp Gly Gly Asn Gly Leu Ser Lys
180 185 190
Lys Gln Arg Lys Phe Gly Lys Phe Gly Lys Asp Pro Thr Val Thr Thr
195 200 205
Asp Phe Leu Pro Asp Lys Asp Arg Glu Arg Leu Glu Leu Glu Met Arg
210 215 220
Ala Gln Leu Arg Lys Glu Trp Gln Leu Ala Gln Asp Val Ile Lys Ala
225 230 235 240
Glu Pro Leu Thr Ile Thr Tyr Ser Tyr Trp Asn Gly Thr Gly His Arg
245 250 255
Arg Asn Val Ser Val Lys Lys Gly Asp Ser Ile Gly Gly Phe Leu Lys
260 265 270
Ala Val Arg Glu Gln Leu Ala Pro Glu Phe Arg Glu Leu Arg His Val
275 280 285
Gly Ile Asp Asn Leu Met Tyr Ile Lys Glu Asp Leu Ile Met Pro His
290 295 300
His His Thr Phe Tyr Glu Leu Ile Ile Ser Lys Ala Arg Gly Lys Ser
305 310 315 320
Gly Pro Leu Phe Asp Phe Thr Val Lys Asp Asp Ile Arg Ile Thr Asn
325 330 335
Asp Ala Thr Gln Glu Lys Gln Asp Thr His Ala Gly Lys Val Val Glu
340 345 350
Arg His Trp Tyr Asp Lys Asn Lys His Ile Phe Pro Ala Ser Arg Trp
355 360 365
Glu Ile Tyr Asp Pro Glu Lys Lys Tyr Gly Glu Tyr Thr Ile Tyr Gly
370 375 380
<210> 3
<211> 2118
<212> DNA
<213> artifical sequence
<400> 3
aattcgatct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 60
aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 120
atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 180
tacgccaagc gcgcaattaa ccctcactaa agggaacaaa agctggagct ccaccgcggt 240
ggcggccgct ctagaactag tggatccact atagggcgaa ttggagctcc accgcggtgg 300
cggccgctct agagacggcg gggagctcgc tgaggcttga catgattggt gcgtatgttt 360
gtatgaagct acaggactga tttggcgggc tatgagggcg cgggaagctc tggaagggcc 420
gcgatggggc gcgcggcgtc cagaaggcgc catacggccc gctggcggca cccatccggt 480
ataaaagccc gcgaccccga acggtgacct ccactttcag cgacaaacga gcacttatac 540
atacgcgact attctgccgc tatacataac cactcagcta gcttaagatc ccatcaagct 600
tgcatgccgg gcgcgccaga aggagcgcag ccaaaccagg atgatgtttg atggggtatt 660
tgagcacttg caacccttat ccggaagccc cctggcccac aaaggctagg cgccaatgca 720
agcagttcgc atgcagcccc tggagcggtg ccctcctgat aaaccggcca gggggcctat 780
gttctttact tttttacaag agaagtcact caacatctta aaatggccag gtgagtcgac 840
gagcaagccc ggcggatcag gcagcgtgct tgcagatttg acttgcaacg cccgcattgt 900
gtcgacgaag gcttttggct cctctgtcgc tgtctcaagc agcatctaac cctgcgtcgc 960
cgtttccatt tgcaggatgg ccactccgcc ctccccggtg ctgaagaatt tcgaagcatg 1020
gacgatgcgt tgcgtgcact gcggggtcgg tatcccggtt gtgagtgggt tgttgtggag 1080
gatggggcct cgggggctgg tgtttatcgg cttcggggtg gtgggcggga gttgtttgtc 1140
aaggtggcag ctctgggggc cggggtgggc ttgttgggtg aggctgagcg gctggtgtgg 1200
ttggcggagg tggggattcc cgtacctcgt gttgtggagg gtggtgggga cgagagggtc 1260
gcctggttgg tcaccgaagc ggttccgggg cgtccggcca gtgcgcggtg gccgcgggag 1320
cagcggctgg acgtggcggt ggcgctcgcg gggctcgctc gttcgctgca cgcgctggac 1380
tgggagcggt gtccgttcga tcgcagtctc gcggtgacgg tgccgcaggc ggcccgtgct 1440
gtcgctgaag ggagcgtcga cttggaggat ctggacgagg agcggaaggg gtggtcgggg 1500
gagcggcttc tcgccgagct ggagcggact cggcctgcgg acgaggatct ggcggtttgc 1560
cacggtcacc tgtgcccgga caacgtgctg ctcgaccctc gtacctgcga ggtgaccggg 1620
ctgatcgacg tggggcgggt cggccgtgcg gaccggcact ccgatctcgc gctggtgctg 1680
cgcgagctgg cccacgagga ggacccgtgg ttcgggccgg agtgttccgc ggcgttcctg 1740
cgggagtacg ggcgcgggtg ggatggggcg gtatcggagg aaaagctggc gttttaccgg 1800
ctgttggacg agttcttctg agggacctga tggtgttggt ggctgggtag ggttgcgtcg 1860
cgtgggtgac agcacagtgt ggacgttggg atccccgctc cgtgtaaatg gaggcgctcg 1920
ttgatctgag ccttgccccc tgacgaacgg cggtggatgg aagatactgc tctcaagtgc 1980
tgaagcggta gcttagctcc ccgtttcgtg ctgatcagtc tttttcaaca cgtaaaaagc 2040
ggaggagttt tgcaattttg ttggttgtaa cgatcctccg ttgattttgg cctctttctc 2100
catgggcggg ctggaatt 2118

Claims (8)

1. a kind of cilium assembly and regulation gene, it is characterised in that：The gene source is in Chlamydomonas reinhardtii, the Gene Name XAP5, the gene include such as SEQ ID NO:CDNA sequence shown in 1；Or include SEQ ID NO:Egg is encoded shown in 2 The polynucleotides of white matter sequence；Or comprising with SEQ ID NO:CDNA sequence defined by 1 with 90% or more it is homologous Property and the nucleotide sequence for encoding identical function albumen.
2. the acquisition methods of cilium assembly and regulation gene as described in claim 1, it is characterised in that：Include the following steps：
It will be in the VIII segment radom insertions to chlamydomonas of aph that encode paromomycin resistance by electroporated method；It is obtained by screening Cilium assembles deficiency mutation algae strain af1-x；It identifies to obtain the gene XAP5 for cilium assembly and regulation by RESDA-PCR.
3. the acquisition methods of cilium assembly and regulation gene according to claim 2, it is characterised in that：VIII segments of the aph Sequence such as SEQ ID NO:Shown in 3.
4. the coding albumen of cilium assembly and regulation gene as described in claim 1, the coding albumen contains SEQ ID NO:2 institutes The amino acid sequence shown, or comprising by SEQ ID NO:Amino acid sequence shown in 2 passes through the substitution of multiple amino acid, missing Or addition formation has identical active derived protein.
5. the expression vector containing cilium assembly and regulation gene as described in claim 1.
6. the host cell containing cilium assembly and regulation gene as described in claim 1.
7. the expression vector acquisition methods containing cilium assembly and regulation gene as described in claim 1, include the following steps：
Wild type chlamydomonas RNA is extracted, reverse transcription obtains cDNA；Design primer obtains XAP5 genes by PCR amplification；By XAP5 Gene is connected to intermediate carrier or chlamydomonas expression vector.
8. the acquisition methods of the expression vector containing cilium assembly and regulation gene as described in claim 1, include the following steps：
The artificial synthesized cilium assembly and regulation gene order, carrier construction.
CN201810210290.0A 2018-03-14 2018-03-14 Cilium assembly regulatory gene and encoding protein, acquisition method and application thereof Active CN108424909B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810210290.0A CN108424909B (en) 2018-03-14 2018-03-14 Cilium assembly regulatory gene and encoding protein, acquisition method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810210290.0A CN108424909B (en) 2018-03-14 2018-03-14 Cilium assembly regulatory gene and encoding protein, acquisition method and application thereof

Publications (2)

Publication Number Publication Date
CN108424909A true CN108424909A (en) 2018-08-21
CN108424909B CN108424909B (en) 2021-11-30

Family

ID=63158381

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810210290.0A Active CN108424909B (en) 2018-03-14 2018-03-14 Cilium assembly regulatory gene and encoding protein, acquisition method and application thereof

Country Status (1)

Country Link
CN (1) CN108424909B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112062827A (en) * 2020-09-16 2020-12-11 军事科学院军事医学研究院生物医学分析中心 Application of CEP55 protein in regulation of cilia de-assembly and preparation of cilia-related disease model

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1137772A1 (en) * 1998-12-10 2001-10-04 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Spermatogenesis protein
CN106520756A (en) * 2016-11-16 2017-03-22 江汉大学 Screening method of chlamydomonas reinhardtii selenium-rich mutant

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1137772A1 (en) * 1998-12-10 2001-10-04 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Spermatogenesis protein
CN106520756A (en) * 2016-11-16 2017-03-22 江汉大学 Screening method of chlamydomonas reinhardtii selenium-rich mutant

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HU,Z.等: "KU361202.1", 《GENBANK》 *
LILI LI等: "New class of transcription factors controls flagellar assembly by recruiting RNA polymerase II in Chlamydomonas", 《PNAS》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112062827A (en) * 2020-09-16 2020-12-11 军事科学院军事医学研究院生物医学分析中心 Application of CEP55 protein in regulation of cilia de-assembly and preparation of cilia-related disease model
CN112062827B (en) * 2020-09-16 2022-10-21 中国人民解放军军事科学院军事医学研究院 Application of CEP55 protein in regulation of cilia de-assembly and preparation of cilia-related disease model

Also Published As

Publication number Publication date
CN108424909B (en) 2021-11-30

Similar Documents

Publication Publication Date Title
CN105646684B (en) A kind of rice grain shape GAP-associated protein GAP GLW2 and its encoding gene and application
CN111235180A (en) Method for shortening flowering phase of corn
CN112538492A (en) SpCas9n variant capable of recognizing NRTH (Polyacrylamide) as PAM (Polyacrylamide) sequence and corresponding base editing system
CN107099544A (en) The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice
CN107142271A (en) The PL LbCpf1 RR genes with high mutation efficiency and its application in gene targeting
CN107353332A (en) A kind of rice chloroplast developmental regulation Gene A HS1 and its coding protein and application
CN108424909A (en) A kind of cilium assembly and regulation gene and its coding albumen, acquisition methods and application
CN101935342A (en) Moth orchid development B gene-PhAP3 coded sequence and application thereof
CN109929857A (en) A kind of high editorial efficiency SaCas9 gene and its application
CN109293752A (en) Yersinia pestis virulence-associated protein sORF17 and its encoding gene and application
CN112646820B (en) Gene and method for changing flowering period of corn
CN112813079A (en) Danbo black soybean GmFER84 gene and application thereof in soybean aluminum stress improvement
CN105399806B (en) A kind of relevant albumen of rice male and female fertility, its encoding gene and its application
CN106397562B (en) Application of the protein G mGATA44 in regulation plant grain weight
CN114539389B (en) Recombinant collagen and application thereof
CN112724215B (en) Gene and method for changing flowering period of corn
CN112626050B (en) SpCas9-NRCH mutant for recognizing specific sites in rice gene targeting and application thereof
CN112646014B (en) Gene and method for changing flowering period of corn
CN112724216B (en) Gene and method for changing flowering period of corn
CN112646015B (en) Gene and method for changing flowering period of corn
CN106754995A (en) Apis cerana AccCDK5 genes and AccCDK5r1 genes and its application
CN108707574A (en) One plant of yielding lipase engineering bacteria, its construction method and application
CN112661823B (en) Gene and method for changing flowering period of corn
CN114292943B (en) Application of tomato SlC H39 gene as negative regulatory factor in improving low temperature resistance of tomato
CN110699363B (en) Rice retrotransposon gene LOC _ Os11g45295, and coding protein and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20240407

Address after: 4-23, unit 1, 4 / F, 2 Zhengda Road, Shijingshan District, Beijing

Patentee after: Beijing gengtianxia Biotechnology Co.,Ltd.

Country or region after: China

Address before: 430056 No. 8 Xinjiang road, Zhuankou economic and Technological Development Zone, Wuhan, Hubei

Patentee before: JIANGHAN University

Country or region before: China