CN108409838B

CN108409838B - Peptide for secretory expression of insect expression system

Info

Publication number: CN108409838B
Application number: CN201810091875.5A
Authority: CN
Inventors: 聂作明; 斯洪强; 盛清
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang Angelo Biotechnology Co.,Ltd.
Priority date: 2018-01-30
Filing date: 2018-01-30
Publication date: 2020-11-13
Anticipated expiration: 2038-01-30
Also published as: CN108409838A

Abstract

The invention discloses a silkworm protein 30K2 and a peptide for coding the protein; the invention also discloses the application of the bombyx mori protein 30K2 peptide: in cells (insect cells) the secretion of proteins is guided extracellularly. The invention leads the protein to enter a protein secretion pathway, and further secretes the protein to the outside of cells: the function of the method is that silkworm protein 30K2 peptide can be used for constructing insect eukaryotic expression vectors, baculovirus vector systems and plasmids for stably transforming cells, so that the protein constructed on the vector can be directly secreted into extracellular culture solution after being expressed, the eukaryotic continuous expression of the protein can be realized through the cell stable transformation and continuous flow culture system, and meanwhile, the peptide can be sheared off after the secretion is finished, so that the conformation and the function of the protein to be expressed are not influenced. The present invention identifies that the 30K2 leader peptide directs secretion of recombinant proteins into extracellular medium.

Description

Peptide for secretory expression of insect expression system

Technical Field

The invention belongs to the field of biotechnology and medicine production, and relates to a guide peptide capable of guiding an expressed protein to be secreted to the outside of a silkworm cell, wherein the guide peptide can be applied to the technical field and the production field of research on active protein secretion of insect cells.

Background

Insect cell expression systems are one of the four major expression systems (insect cell, bacterial, yeast, mammalian cell expression systems) at present. Although the amount of the protein expressed by prokaryotic expression systems such as bacteria and the like is high, the expressed protein can not be subjected to post-translational processing modification, and often does not have biological activity, and the post-translational modification of the expression product of the eukaryotic expression system is complete, so that the eukaryotic expression system is widely applied to scientific research and the expression of active protein in the biopharmaceutical industry. In eukaryotic expression systems, proteins expressed by yeast expression systems are susceptible to degradation, whereas proteins expressed by mammalian cell expression systems are costly. Insect cell expression systems as eukaryotic cell expression systems have two other advantages over eukaryotic systems: (1) has an intact protein post-translational processing modification system; (2) the protein is folded correctly, and the recombinant protein is closer to the natural protein in structure and function; (3) can express a very large exogenous gene (200 kD) without influencing the self proliferation; (4) is safe to vertebrates, especially humans, and baculovirus belongs to insect virus, is nonpathogenic to vertebrates, and is considered as a safe vector. The existing insect cell expression systems are mainly baculovirus expression systems, transient expression systems and cell stable expression systems, proteins expressed by the systems exist in cytoplasm, and the cells need to be collected to obtain the expressed proteins, so the expression quantity is limited by the culture quantity of the cells, the cost of large-scale expressed proteins is still high, and the continuous flow culture and large-scale expression of the insect expression systems cannot be realized.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a leader peptide for secretory expression of an insect expression system, and the invention identifies that the 30K2 leader peptide leads recombinant protein to be secreted into an extracellular medium.

In order to solve the technical problem, the invention provides a peptide guide of silkworm protein 30K2 (peptide guide for secretory expression of insect expression system), which comprises a truncated protein amino acid sequence as follows (in a triplet form): MKPVIVILCLFVASLYAADSD are provided.

The invention also provides a leader peptide sequence for coding the protein, and the nucleotide sequence for coding the leader peptide sequence is as follows: ATGAAGCCCGTCATAGTTATTCTATGTCTTTTCGTGGCATCTCTGTATGCTGCAGATTCCGAC are provided.

The invention also discloses the application of the bombyx mori protein 30K2 peptide: in cells (insect cells) the secretion of proteins is guided extracellularly.

That is, the protein is directed into the secretory protein pathway, which in turn causes the protein to be secreted extracellularly. The method has the effects that silkworm protein 30K2 peptide can be used for constructing a commercial insect eukaryotic expression vector, a baculovirus vector system and a plasmid for stably transforming cells, so that the protein constructed on the vector can be directly secreted into an extracellular culture solution after being expressed, the eukaryotic continuous expression of the protein can be realized through a cell stable transformation and continuous flow culture system, and meanwhile, the peptide can be sheared off after the secretion is finished, so that the conformation and the function of the protein to be expressed are not influenced, and the method can be used for large-scale continuous expression of important functional proteins and medicinal proteins in scientific research and the biopharmaceutical industry.

The invention is used as the improvement of the application of the domestic silkworm protein 30K2 peptide: construction of commercial insect eukaryotic expression vectors or baculovirus vector systems for expression and secretion of proteins or polypeptides of interest, and for construction of cell-stable plasmids.

The invention discloses a bombyx mori cell eukaryotic expression vector for constructing EGFP protein by using the guide peptide, and performs secretory expression of the EGFP protein.

The process of the invention is mainly divided into two parts:

1. constructing a recombinant vector pEx-1-Spro-EGFP-myc epitope-6-his;

constructing a recombinant vector, and mainly performing EGFP fragment amplification, enzyme digestion and purification; constructing pIEX-1-EGFP-mycepitape-6-his recombinant plasmid; three parts of pIEX-1-Spro-EGFP-myc epitope-6-his recombinant plasmid were constructed.

2. Eukaryotic expression identifies secretion of the recombinant protein into extracellular medium.

The protein sequence of the insect cell peptide of the invention has the following characteristics: contains a cut-off point, cuts off the leader peptide sequence at the same time of expression, and does not influence the protein structure.

The insect cell peptide of the invention does not need to break cells, and the cells can be continuously cultured. The protein expressed and secreted in the eukaryotic cell can be obtained in a large amount and actively in the culture medium, namely, the active protein expressed in the eukaryotic cell can be directly obtained in the culture medium easily.

The insect cell peptide of the invention has less protein types in the culture medium than those in cells, and a large amount of active protein secreted can more easily obtain the active protein with higher purity.

The invention introduces insect secretion promoting peptide into the N end of the expression recombinant protein, and can guide the expression protein to be secreted to the outside of cells. The technical advantages of the invention are mainly as follows: the cells can continuously express the target protein without breaking the cells in a continuous culture mode, the protein expressed and secreted in the eukaryotic cells can be obtained in a large amount and in an active state in a culture medium, and the protein expressed in the eukaryotic cells and having the activity can be directly obtained by easily purifying the culture medium due to less protein in the culture medium.

Compared with the prior art, the signal peptide can be used for secreting and expressing the leader peptide for the insect expression system, so that the protein expressed in cells can be secreted into an extracellular culture medium, the protein or polypeptide of interest can be easily obtained from the culture medium, and large-scale active protein preparation can be obtained through continuous flow culture. Meanwhile, some existing peptide leads the expressed protein to be secreted to the extracellular direction, the sequence of the peptide cannot be cut off (such as gp67 signal peptide), which results in that the peptide sequence also exists on the target protein or polypeptide secreted to the extracellular direction, which may affect the normal conformation and function of the target protein.

Drawings

The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 shows the predicted leader results for SignalP4.1 (SignalP-4.1 prediction (euk networks): Sequence);

c-score represents the shear site value. There will be one C-value per amino acid, the C-value being highest at the cleavage site;

s-score represents 1S value corresponding to each amino acid, and a curve in a graph displayed by the result shows the change trend of the S values, and the S value of a signal peptide region is higher;

y-score represents a parameter that considers both the S and C values more accurately than the C value alone. Since there may be more than one higher site for the C value in a series, but only one cleavage site; the cleavage site at this time is presumed to be a site where the S value is steep and a site having a high C value by Y-score.

FIG. 2 is a flow chart of vector construction;

note: constructing a recombinant vector, and mainly performing EGFP fragment amplification, enzyme digestion and purification; constructing pIEX-1-EGFP-mycepitape-6-his recombinant plasmid; three parts of pIEX-1-Spro-EGFP-myc epitope-6-his recombinant plasmid were constructed.

FIG. 3 is a diagram of a double restriction endonuclease cut nucleic acid sequence of pEx-1-Spro-EGFP-myc epitope-6. sup. his and pEx-1-EGFP-myc epitope-6. sup. his;

note: m is nucleic acid marker DL2000(TAKARA, 3428A); lane 1 is a double restriction with pEx-1-EGFP-myc epitope-6. sup. his; lane 2 is a double restriction with pEx-1-SPro-EGFP-myc epitope-6. sup. his.

FIG. 4 is a diagram of Western Blot for identifying secreted proteins;

note: m is protein prestained marker (Thermo Fisher, 26616); lane 1 is transfected pEx-1-EGFP-mycepitape-6. sup. his cell lysate; lane 2 is transfected pEx-1-SPro-EGFP-myc epitope-6. sup. his cell lysates; lane 3 is transfected pEx-1-EGFP-myc epitope-6. sup. his cell culture medium; lane 4 is the transfected pEx-1-SPro-EGFP-myc epitope-6. sup. his cell culture medium. Marker was loaded at 10ul and protein was loaded at 5 ul.

Detailed Description

The invention is further described below with reference to specific examples, which are illustrated in fig. 2, but the scope of the invention is not limited thereto.

Example 1 EGFP fragment amplification, cleavage and purification

1) EGFP fragment amplification

Designing a primer to amplify an EGFP fragment, wherein the upstream of the EGFP fragment is provided with a restriction enzyme cutting site BamH I, and the downstream of the EGFP fragment is provided with a restriction enzyme cutting site Xho I, and the sequence of the primer is as follows:

Fp:CGCGGATCCATGGTGAGCAAGGGCGAGG

Rp:CCGCTCGAGCTTGTACAGCTCGTCCATGCC

the underlined sites are the cleavage sites (the same applies below).

Primers can be assigned to Sangon Biotech synthesis.

PCR is performed to amplify the fragment of interest. EGFP templates were derived from pIEX-1-EGFP (this plasmid was used in the paper Construction of the ie1-Bacmid expression system and its use to expression EGFP and BmAGO2 in BmN cells, Applied Biochemistry & Biotechnology,2013,169(8): 2237-2247). PCR used the high fidelity amplification enzyme KOD-Plus-Neo enzyme (TOYOBO, KOD-401) in the following PCR system:

solution system (50 ul):

the following solutions were added in order:

blowing, beating, mixing, heating with PCR instrument at 65 deg.C for 10min, immediately inserting into ice, standing for 5min to prevent renaturation; obtaining primer template solution.

During the heating period at 65 ℃, preparing a PCR mother solution, and adding the following solutions in sequence:

mixing, and standing on ice.

Time system:

and adding the PCR mother solution into the primer template solution, and uniformly mixing by blowing without generating bubbles.

The reaction was carried out using the following time system:

2) EGFP fragment PCR product purification

The PCR product purification kit (Axygen, AP-PCR-50G) was used for purification, the procedure was as per the manufacturer's instructions. After purification, the concentration was measured and stored at-20 ℃ for further use.

3) EGFP double enzyme digestion and tapping purification

The purified EGFP fragment was double digested with restriction enzymes BamH I (TAKARA, 1605) and Xho I (TAKARA, 1635) to generate sticky ends. After completion of the cleavage, the band was separated by agarose (Biowest) gel electrophoresis, and the desired EGFP fragment was cut and recovered at about 750bp as judged by DL2000 Marker (TAKARA, 3427) (i.e., amplified EGFP fragment). The collected agarose gel block containing the target band was cut and purified using a DNA gel recovery kit (Axygen, AP-GX-50G).

A new 0.5ml EP tube was taken and the following reagents were added:

double enzyme system (50 ul):

the tube is marked and reacted in a water bath at 37 ℃ for 3 h.

Agarose gel electrophoresis, 120V run for 15 min. Soaking in EB dye liquor for 15 min.

The recovery of the sticky end fragments from the gel was carried out according to the manufacturer's instructions and the concentration was measured and stored at-20 ℃ until use. The recombinant plasmid pEx-1-EGFP-myc epitope-6. sup. his was constructed as part of example 2.

Example 2 construction of pEx-1-EGFP-myc epitope-6. sup. his recombinant plasmid

1) pEx-1 plasmid obtained

Coli TG1 containing pEx-1 was cultured overnight, and then plasmid pEx-1 was extracted using a kit (Axygen, AP-MN-P-50G), 3ml of the bacterial solution was taken from each tube, and the procedure was as described by the manufacturer. The purified plasmid was measured for concentration and stored at-20 ℃ for further use.

2) pIEx-1 double enzyme digestion and rubber tapping purification

The purified pEx-1 plasmid was double digested with restriction enzymes BamH I (TAKARA, 1605) and Xho I (TAKARA, 1635) to generate sticky ends. After the enzyme digestion, bands are distinguished through agarose (Biowest) gel electrophoresis, the band of interest after the enzyme digestion is about 3700bp, and a DL5000Marker (TAKARA, 3428) is used for judging, cutting and recovering the band of interest with a corresponding size (namely the pEx-1 linear fragment after the enzyme digestion). The collected agarose gel block containing the target band was cut and purified using a DNA gel recovery kit (Axygen, AP-GX-50G). Used for the preparation of pIEX-1-myc epitope-6-his fragments.

A new 0.5ml EP tube was taken and the following reagents were added:

double enzyme system (50 ul):

the tube is marked and reacted in a water bath at 37 ℃ for 3 h.

The recovery of the sticky end fragments from the gel was carried out according to the manufacturer's instructions and the concentration was measured and stored at-20 ℃ until use.

3) Overlapping PCR generated pEx-1-myc epitope-6 his fragment

Using the fragment pEx-1 with sticky ends BamH I and Xho I as template (previously purified, -20 ℃ storage, step 2 above), specific primers were designed and the myc epsilon-6. multidot. his sequence was inserted into pEx-1 using the overlap PCR method. The primer information is as follows:

Fp1：

GATCTGAATAGCGCCGTTGACCATCATCATCATCATCACTAAGTGATTAACCTCAGG

Fp2：

CCGCTCGAGGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTTGAC

Rp：

CGCGGATCCAGCGGTTTCTTTACCAGAAGAGTG。

primers can be assigned to Sangon Biotech synthesis.

PCR was performed in two runs, the first run using primers Fp1 and Rp, and the template used was a sticky-ended pIEx-1 (step 2); the second use of primers Fp2 and Rp, the use of template for the first amplification after tapping purified fragment. PCR used the high fidelity amplification enzyme KOD-Plus-Neo enzyme (TOYOBO, KOD-401) in the following PCR system:

solution system (50 ul):

the following solutions were added in order:

blowing, beating, mixing, heating with PCR instrument at 65 deg.C for 10min, immediately inserting into ice, standing for 5min, and preventing renaturation.

Preparing a PCR mother solution during heating at 65 ℃, and sequentially adding the following solutions:

mixing, and standing on ice.

Time system:

The reaction was carried out using the following time system:

4) and rubber tapping purification of the first round product of the overlapped PCR

The DNA gel recovery kit (Axygen, AP-GX-50G) was used for purification, the procedure was as per the manufacturer's instructions. After purification, the concentration was measured and stored at-20 ℃ for further use.

5) Second round of product PCR product purification by overlap PCR

The PCR product recovery kit (Axygen, AP-PCR-50G) was used for purification, and the procedure was as specified by the manufacturer. After purification, the concentration was measured and stored at-20 ℃ for further use.

6) pEx-1-myc epitope-6 his fragment double enzyme digestion and gel cutting purification

The purified pEx-1-myc epitope-6. sup. his fragment (obtained in step 5 above) was digested simultaneously with restriction enzymes BamH I (TAKARA, 1605) and Xho I (TAKARA, 1635) to generate sticky ends. After the completion of the digestion, the bands were distinguished by agarose (Biowest) gel electrophoresis, and the band of interest was judged according to the size of DNA marker and cleaved and recovered (i.e., the linearized pEx-1-myc epitope-6. sup. his fragment which was completed by digestion). The collected agarose gel block containing the target band was cut and purified using a DNA gel recovery kit (Axygen, AP-GX-50G).

A new 0.5ml EP tube was taken and the following reagents were added:

double enzyme system (50 ul):

the tube is marked and reacted in a water bath at 37 ℃ for 3 h.

7) Construction of recombinant plasmid pEx-1-EGFP-myc epsilon-6. multidot. his

pEx-1-myc epitope-6. sup. his (obtained in step 6 above) containing cohesive ends BamH I and Xho I and EGFP (obtained in step 1 above) were ligated into recombinant vectors using T4 ligase (TAKARA, 2011A). The system is as follows (20 ul):

the tube is marked and reacted in a water bath at 16 ℃ for 2 h.

Transformed E.coli TG1 competent cells, 50ul of the transformed E.coli were spread evenly on Amp (Sangon Biotech) resistant solid LB plates, cultured at 37 ℃ for 10 hours, and single colonies were picked and cultured in LB medium.

8) pIEX-1-EGFP-myc epitope-6. sup. his identification

Extracting plasmids by using a kit (Axygen, AP-MN-P-50G), taking 3ml of bacterial liquid from each tube, and extracting plasmids to perform PCR identification and double enzyme digestion identification.

The PCR identification was performed according to step 1) of example 1 above, and the result was identical to the PCR result of this step, and the identification result was correct. The sizes of the vector fragment and the target fragment obtained by double digestion are consistent with the theoretical size according to the comparison of DNA Marker, and the identification result is correct, as shown in Lane 1 of FIG. 3. Colonies identified as correct were stored at-80 ℃ using 25% glycerol final concentration.

Example 3 construction of pIEX-1-SPro-EGFP-myc epitope-6. sup. his recombinant plasmid

1) The signal peptide sequence of 30K2 protein was predicted using the SignalP4.1 program (shown in FIG. 1), the N-terminal 21 amino acid sequence MKPVIVILCLFVASLYAADSD of the protein was used, the fragment pEx-1-myc epitope-6-his with sticky ends BamH I and Xho I was used as template (previously purified, -20 ℃ storage, obtained in example 2), the nucleic acid sequence encoding the leader peptide was obtained from the 30K2 gene sequence (accession No. NM-001279380), specific primers were designed from the nucleic acid sequence, and the 30K2 leader peptide sequence was constructed from pEx-1-myc epitop-6-his by overlap PCR. The primer information is as follows:

Fp：

CCGCTCGAGGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTTGACCATCATC

Rp1：

ACGAAAAGACATAGAATAACTATGACGGGCTTCATAGCGGTTTCTTTACCAGAAGAGTG

Rp2：

CGCGGATCCGTCGGAATCTGCAGCATACAGAGATGCCACGAAAAGACATAGAATAACTATGACGG

primers were synthesized as mandated by Sangon Biotech.

Overlapping PCR the first round used primers Fp and Rp1, and the template used pIEx-1-myc epitope-6. sup. his fragment; the second round used primers for Fp and Rp2, and the template recovered fragments using the first round of tapping. PCR used the high fidelity amplification enzyme KOD-Plus-Neo enzyme (TOYOBO, KOD-401) in the following PCR system:

solution system (50 ul):

the following solutions were added in order:

mixing, and standing on ice.

Time system:

The reaction was carried out using the following time system:

2) and rubber tapping purification of the first round product of the overlapped PCR

3) Second round of product PCR product purification by overlap PCR

4) pEx-1-SPro-myc epitope-6 his fragment double digestion and tapping purification

The purified pEx-1-Spro-myc epitope-6. sup. his fragment (obtained in step 3 above) was double-digested with restriction enzymes BamH I (TAKARA, 1605) and Xho I (TAKARA, 1635) to generate sticky ends. After completion of the cleavage, the bands were distinguished by agarose (Biowest) gel electrophoresis, and the band of interest (i.e., pEx-1-Spro-myc epitope-6. sup. his fragment with sticky ends) was recovered by cleavage. The collected agarose gel block containing the target band was cut and purified using a DNA gel recovery kit (Axygen, AP-GX-50G).

A new 0.5ml of EP was taken and the following reagents were added:

double enzyme system (50 ul):

the tube is marked and reacted in a water bath at 37 ℃ for 3 h.

5) Construction of recombinant plasmid pEx-1-SPro-EGFP-myc epitope-6. multidot. his

pEx-1-mycepitip-6. multidot. his (obtained in step 4 above) containing cohesive ends BamH I and Xho I and EGFP (obtained in example 1) were ligated into recombinant vectors using T4 ligase (TAKARA, 2011A).

The system is as follows (20 ul):

the tube is marked and reacted in a water bath at 16 ℃ for 2 h.

Transformed E.coli TG1 competent cells, 50ul of transformed E.coli were spread evenly on Amp (available from Sangon Biotech) resistant solid LB plates, cultured at 37 ℃ for 10h, and single colonies were picked and cultured in LB medium.

6) pIEX-1-Spro-EGFP-myc epitope-6. sup. his identification

The PCR identification was performed according to the step 1) of the above experimental example 1, and the result was identical to the PCR result of this step, and the identification result was correct, and the size of the vector fragment obtained by the double digestion and the size of the target fragment were identical to the theoretical size based on the comparison with the DNA Marker (as shown in lane 2 of FIG. 3), and the colony having the correct identification result was stored at-80 ℃ using 25% glycerol at the final concentration.

Example 4 eukaryotic expression identification

An insect expression system is used for expressing the target protein, and the EGFP protein content is identified in cells and cell culture media. The bombyx mori cell BmN expression system is used as an expression system of a mature eukaryon of the institute (biochemistry and molecular biology research institute of Zhejiang university of science and technology), so the bombyx mori cell is used as the expression cell.

1) Plasmid purification

Escherichia coli TG1 (from example 3) containing pEx-1-SPro-EGFP-myc epitope-6-his and Escherichia coli TG1 (from example 2) containing pEx-1-EGFP-myc epitope-6-his were cultured overnight, plasmids were extracted using a kit (Axygen, AP-MN-P-50G), 3ml of each tube was taken, and the procedures were as described by the manufacturer. The concentration of purified plasmid was measured and was 150 ng/. mu.l and 170 ng/. mu.l, respectively. Storing at-20 deg.C for use.

2) And culturing silkworm cells BmN

BmN cell culture medium used is sf-900^TMII (gibco, 10902088), fetal bovine serum using FBS Premium (PAN-Biotech, P30-3302), serum and medium ratio 1:9 (volume ratio). BmN cells were cultured at 28 ℃ without controlling CO₂And (4) concentration. Cells were plated in 6-well plates one day before cell transfection (Corning, 3516) and the cell density rose to 50-80% the following day before transfection.

3) BmN cell transfection

The whole transfection experiment is completed in a cell room superclean bench. Reference FuGENE^@6Transfection (Promega, E2691) Specification, plasmid pEx-1-SPro-EGFP-myc epitope-6. mu.his and pEx-1-EGFP-myc epitope-6. mu.his were used respectively at plasmid concentrations of 150 ng/. mu.l and 170 ng/. mu.l, and the plasmid pEx-1-EGFP-myc epitope-6. mu.his was transfected for the purpose of using it as a Transfection reagentAs a control, it was confirmed whether pEx-1-SPro-EGFP-myc epitope-6-his was expressed. Two single well addition solutions of six well plates for transfection were as follows:

serum-free transfection was used, the wells were devoid of fetal bovine serum, and the specific procedures were as per the manufacturer's instructions.

The plasmid refers to pEx-1-SPro-EGFP-myc epitope-6-his, or pEx-1-EGFP-myc epitope-6-his. 4) WB identification of EGFP secretion

After 72h of cell transfection, the medium in two single wells of the six-well plate was collected, the cells were washed once with 1 × PBS, 500ul 1 × PBS was added, 500ul 2 × Loading Buffer was added, lysed for 5min at room temperature, and collected into 1.5ml EP tubes. Then, 100ul of the collected medium was collected in a new 1.5ml EP tube, and 100ul of 2-by-load Buffer was added. The sample is put in a metal bath for 10min at 100 ℃ to finish the sample preparation.

12% PAGE gels (third copy of molecular clones) were prepared, subjected to gel electrophoresis, and then the proteins were transferred to PVDF membrane (Roche, 03010040001) by semi-dry transfer, and 6 his and α -Tubulin (α -Tubulin is an internal control protein) in the samples were identified by anti-6 his antibody (protein tech, 66005-1-Ig) and anti- α -Tubulin antibody (protein tech, 66031-1-Ig). Goat anti-mouse (protein tech, SA00001-1) was used as the secondary antibody. Antibodies were all 1:10000 diluted in 1 × TBST.

The identification result is as follows: as can be seen in FIG. 4, the expression of EGFP protein and α -Tubulin protein could be detected by comparing the protein pre-staining of the marker (Thermo Fisher, 26616), but in pIEX-1-EGFP-myc epitope-6. sup. his transfected cells, only the expression of EGFP protein was detected in the cell sample (lane 1 of FIG. 4), and no EGFP protein was detected in the culture medium thereof (lane 3 of FIG. 4), whereas in the group of cells transfected with pIEX-1-SPro-EGFP-myc epitope-6. sup. his plasmid, EGFP protein was detected not only in the cell sample (lane 2 of FIG. 4) but also in the culture medium (lane 4). According to the above identification results, it can be seen that the EGFP expressed by the pIEx-1-EGFP-myc epitope-6. sup. his plasmid cannot be transported out of the cell after being expressed without a leader peptide (fig. 4 lane 3), while the EGFP protein expressed by the pIEx-1-SPro-EGFP-mycepitop-6. sup. his plasmid can transport the expressed protein out of the cell and secrete it into a culture medium (fig. 4 lane 4) due to the insertion of a leader peptide sequence of 30K2 protein at its N-terminal, and the protein size is the same as that of the EGFP without the insertion of a leader peptide (fig. 4 lane 1), which indicates that the 30K2 leader peptide of the present invention can guide the secretion of the recombinant protein into an extracellular culture medium, and automatically excise itself when guiding the secretion of the recombinant protein out of the cell, without affecting the conformation and function of the protein.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Zhejiang university of science and engineering

<120> peptide for secretory expression in insect expression system

<160> 2

<170> SIPOSequenceListing 1.0

<210> 2

<211> 21

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Lys Pro Val Ile Val Ile Leu Cys Leu Phe Val Ala Ser Leu Tyr

1 5 10 15

Ala Ala Asp Ser Asp

20

<210> 2

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaagcccg tcatagttat tctatgtctt ttcgtggcat ctctgtatgc tgcagattcc 60

gac 63

Claims

1. The peptide of silkworm protein 30K2 is characterized in that the amino acid sequence of the peptide is as follows:

MKPVIVILCLFVASLYAADSD；

in insect cells, the secretion of proteins is guided extracellularly.

2. A nucleotide sequence encoding the leader peptide of claim 1 which is: ATGAAGCCCGTCATAGTTATTCTATGTCTTTTCGTGGCATCTCTGTATGCTGCAGATTCCGAC are provided.

3. The use of silkworm protein 30K2 peptide according to claim 1, wherein the peptide comprises:

the protein is directed into the secretory protein pathway, which in turn causes the protein to be secreted extracellularly: the method has the effects that silkworm protein 30K2 peptide is utilized to construct an insect eukaryotic expression vector, a baculovirus vector system and a plasmid for stably transforming cells, so that the protein constructed on the vector is directly secreted into an extracellular culture solution after being expressed, the eukaryotic continuous expression of the protein can be realized through a cell stable transformation and continuous flow culture system, and the peptide is sheared after the secretion is completed, so that the conformation and the function of the protein to be expressed are not influenced.

4. The use of silkworm protein 30K2 peptide according to claim 3, wherein the peptide comprises: commercial insect eukaryotic expression vectors or baculovirus vector systems were constructed for expression and secretion of the protein or polypeptide of interest.