CN108409838A - Peptide is led for insect expression system secreting, expressing - Google Patents
Peptide is led for insect expression system secreting, expressing Download PDFInfo
- Publication number
- CN108409838A CN108409838A CN201810091875.5A CN201810091875A CN108409838A CN 108409838 A CN108409838 A CN 108409838A CN 201810091875 A CN201810091875 A CN 201810091875A CN 108409838 A CN108409838 A CN 108409838A
- Authority
- CN
- China
- Prior art keywords
- albumen
- peptide
- cell
- protein
- extracellular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/036—Fusion polypeptide containing a localisation/targetting motif targeting to the medium outside of the cell, e.g. type III secretion
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14041—Use of virus, viral particle or viral elements as a vector
- C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of silkworm albumen 30K2 and its encode the albumen lead peptide；The present invention further simultaneously discloses the purposes that above-mentioned silkworm albumen 30K2 leads peptide：Pilot protein is secreted into extracellular in cell (insect cell).Albumen is led into secretory protein approach by the present invention, and then makes protein secretion to extracellular：Its effect is that can lead peptide using silkworm albumen 30K2 to build insect carrier for expression of eukaryon, Baculovirus Vector System and the steady plasmid for turning cell, the albumen built on its carrier is set directly to be secreted into extracellular culture solution after expressing, can surely it be turned by cell and continuous flow culture system, realize the eukaryon continuous expression of albumen, this is led peptide and can cut off itself after secretion is completed simultaneously, to not influence the conformation and function that need to express albumen.The present invention identify 30K2 lead peptide guiding recombinant protein secrete into extracellular culture medium.
Description
Technical field
The invention belongs to biotechnology and field of medicine production, it is related to a bootable expression protein point in bombyx mori cell
Secrete it is extracellular lead peptide, this leads the technical field and production field that peptide can be applied to the research of insect cell secretion activity albumen.
Background technology
Insect cell expression system is current four big expression system (insect cell, bacterium, yeast, mammalian cell tables
One of up to system).Although the prokaryotic expressions protein content such as bacterium is very high, after cannot being translated to the albumen of expression
Processing modification, does not often have bioactivity, eukaryotic expression system expression product posttranslational modification is complete, is widely used in scientific research
With the expression of bio-pharmaceutical industry activated protein.In eukaryotic expression system, the albumen of yeast expression system expression is degradable, and
The albumen of mammalian cell expression system expression is of high cost.Insect cell expression system has as eukaryotic cell expression system
The advantage that other two eukaryotic systems can not be compared：(1) there is complete protein translation post-processing modification system；(2) albumen is rolled over
Folded correct, recombinant protein is structurally and functionally closer to native protein；(3) can express very big allogenic gene (~
The proliferation for 200kD) being unlikely to influence itself；(4) it is safe to vertebrate, the especially mankind, baculoviral belongs to elder brother
Parasitosis poison, to vertebrate no pathogenicity, it is considered to be safe carrier.Current insect cell expression system is mainly rod-shaped
Virus expression systems, transient expression system and cell surely turn expression system, and the albumen of these system expressions is present in cytoplasm,
The albumen for obtaining expression needs to collect cell, therefore its expression quantity is limited to the culture amount of cell, leads to the expression egg of scale
Bai Chengben is still very high, cannot achieve continuous flowing culture and the scale expression of insect expression system.
Invention content
The technical problem to be solved in the present invention is to provide a kind of peptide of leading for insect expression system secreting, expressing, the present invention
Identify 30K2 lead peptide guiding recombinant protein secrete into extracellular culture medium.
Peptide is led (for insect expression system point in order to solve the above technical problem, the present invention provides silkworm albumen 30K2
That secretes expression leads peptide), it is (three sub- forms) it includes the protein amino acid sequence of section：
MKPVIVILCLFVASLYAADSD。
The present invention also provide simultaneously encode above-mentioned protein lead peptide sequence, encode the nucleotide sequence for leading peptide sequence
For：ATGAAGCCCGTCATAGTTATTCTATGTCTTTTCGTGGCATCTCTGTATGCTGCAGATTCCGAC.
The present invention further simultaneously discloses the purposes that above-mentioned silkworm albumen 30K2 leads peptide：Egg is guided in cell (insect cell)
It is secreted into vain extracellular.
That is, albumen is led into secretory protein approach, and then make protein secretion to extracellular.Its effect is can to utilize house
The white 30K2 of silkworm egg leads peptide to build commercialized insect carrier for expression of eukaryon, Baculovirus Vector System and the steady matter for turning cell
Grain enables the albumen built on its carrier to be directly secreted into extracellular culture solution after expressing, can be steady by cell
Turn and continuous flow culture system, realize the eukaryon continuous expression of albumen, at the same this lead peptide can be incited somebody to action after secretion is completed from
Body is cut off, and to not influence the conformation and function that need to express albumen, can be used for weight in scientific research and bio-pharmaceutical industry
Want the scale continuous expression of functional protein and pharmaceutical protein.
Silkworm albumen 30K2 as the present invention leads the improvement of the purposes of peptide：Structure commercialization insect carrier for expression of eukaryon or
Baculovirus Vector System secretes proteins of interest or polypeptide for expressing, and, for building the steady plasmid for turning cell.
The invention discloses using the above-mentioned bombyx mori cell carrier for expression of eukaryon led peptide and build EGFP albumen, EGFP has been carried out
The secreting, expressing of albumen.
The flow of the present invention is broadly divided into two parts：
1. building recombinant vector pIEx-1-Spro-EGFP-myc epitope-6*his；
It builds recombinant vector and mainly passes through EGFP fragment amplifications, digestion and purifying；Build pIEx-1-EGFP-
Mycepitope-6*his recombinant plasmids；Build three portions of pIEx-1-Spro-EGFP-myc epitope-6*his recombinant plasmids
Point.
2. eukaryotic expression identification recombinant protein is secreted into extracellular culture medium.
Insect cell of the present invention leads peptide, and protein sequence has its feature：Including section, cuts off while expression and leads
Peptide sequence does not impact protein structure.
Insect cell of the present invention leads peptide, does not have to smudge cells, and cell can be cultivated constantly.It is expressed in eukaryocyte
And the protein secreted can obtain in the medium a large amount of and actively, that is, directly can easily obtain in the medium
The active protein expressed in eukaryocyte.
Insect cell of the present invention leads peptide, and protein classes are fewer than intracellular in culture medium, secretion it is a large amount of active
Albumen can more easily obtain the activated protein of higher purity.
The present invention introduces insect rush secretion in the N-terminal of expression recombinant protein and leads peptide, and expression protein secretion can be guided to born of the same parents
Outside.The present invention technical advantage be mainly：Without smudge cells, cell can be by way of continuously cultivating, continuous expression mesh
Albumen, and expressed in eukaryocyte and the protein secreted can obtain in the medium a large amount of and actively, due to training
Support base in albumen it is less, the present invention can directly in the medium easily purifying obtain eukaryocyte in express it is active
Protein.
For the above-mentioned prior art, by signal peptide, through the invention " for insect expression system secrete table
What is reached leads peptide ", it can make in the protein secretion to extracellular medium of cell inner expression, it being capable of easily the sense of access out of culture medium
The albumen or polypeptide of interest can obtain fairly large activated protein and prepare by continuously flowing culture.Meanwhile having at present
It is a little lead peptide guiding expression protein secretion to it is extracellular when the sequence for leading peptide itself can not be cut away to (such as gp67 signal peptides), this
Have led to being secreted on extracellular destination protein or polypeptide that there is also lead peptide sequence, it is possible to influence whether the destination protein
Normal conformation and function exercise, but in the present invention, peptide sequence of leading of the invention contains section, can not only be by destination protein
Or polypeptide is secreted into extracellular, and can will not have an impact own excision to the conformation of destination protein or polypeptide.
Description of the drawings
The specific implementation mode of the present invention is described in further detail below in conjunction with the accompanying drawings.
Fig. 1 is that peptide result (SignalP-4.1 prediction (euk networks) are led in SignalP4.1 predictions：
Sequence)；
C-score represents shearing site value.Each amino acid can be there are one C values, and C values are highest at shearing site；
S-score represents each amino acid and corresponds to 1 S value, and there are one curves to show S values in the chart that result is shown
The S values of variation tendency, signal peptide region are higher；
Y-score represents a parameter for considering S values and C values, more accurate than individually considering C values.Because
C values may have the higher site of more than one in one series, but there are one shearing sites；Shearing site at this time just by
Y-score speculates, is precipitous position and site with high C values for S values.
Fig. 2 is vector construction flow chart；
Note：It builds recombinant vector and mainly passes through EGFP fragment amplifications, digestion and purifying；Build pIEx-1-EGFP-
Mycepitope-6*his recombinant plasmids；Build three portions of pIEx-1-Spro-EGFP-myc epitope-6*his recombinant plasmids
Point.
Fig. 3 is pIEx-1-Spro-EGFP-myc epitope-6*his and pIEx-1-EGFP-myc epitope-6*
His double digestion nucleic acid figures；
Note：M is nucleic acid marker DL2000 (TAKARA, 3428A)；Swimming lane 1 is pIEx-1-EGFP-myc epitope-
6*his double digestions；Swimming lane 2 is pIEx-1-SPro-EGFP-myc epitope-6*his double digestions.
Fig. 4 is that Western Blot identify secretory protein figure；
Note：M is albumen pre-dyed marker (Thermo Fisher, 26616)；Swimming lane 1 is transfection pIEx-1-EGFP-
Mycepitope-6*his cell pyrolysis liquids；Swimming lane 2 is transfection pIEx-1-SPro-EGFP-myc epitope-6*his cells
Lysate；Swimming lane 3 is transfection pIEx-1-EGFP-myc epitope-6*his cell culture mediums；Swimming lane 4 is transfection pIEx-1-
SPro-EGFP-myc epitope-6*his cell culture mediums.Marker loading 10ul, albumen loading 5ul.
Specific implementation mode
With reference to specific embodiment, the present invention is described further, and flow is as shown in Fig. 2, but protection of the invention
Range is not limited to that.
Embodiment 1, EGFP fragment amplifications, digestion and purifying
1), EGFP fragment amplifications
Design primer amplification EGFP segments, upstream belt restriction enzyme digestion sites BamH I, downstream belt are restricted interior
Enzyme cutting restriction enzyme site Xho I, primer sequence are as follows：
Fp:CGCGGATCCATGGTGAGCAAGGGCGAGG
Rp:CCGCTCGAGCTTGTACAGCTCGTCCATGCC
Above-mentioned with underscore is restriction enzyme site (the same below).
Primer can entrust Sangon Biotech to synthesize.
Carry out PCR amplification target fragment.From pIEx-1-EGFP, (plasmid is once used for paper to EGFP templates
Construction of the ie1-Bacmid expression system and its use to express EGFP
and BmAGO2 in BmN cells,Applied Biochemistry&Biotechnology,2013,169(8):2237-
2247).PCR uses high-fidelity amplification enzyme KOD-Plus-Neo enzymes (TOYOBO, KOD-401), and PCR system is as follows：
Solution system (50ul)：
Sequentially add following solutions：
Mixing is blown and beaten, 65 DEG C of heating 10min of PCR instrument are inserted into ice, static 5min prevents renaturation at once；Obtain Primed template
Liquid.
During 65 DEG C of heating, PCR mother liquors are configured, to sequentially add following solutions：
It is placed on ice after mixing.
Time system：
PCR mother liquors are added in Primed template liquid, mixing is blown and beaten, not generate bubble.
It is reacted using following time system：
2), EGFP fragment PCR products purify
Manufacturers instruction is pressed in PCR product purification kit (Axygen, the AP-PCR-50G) purifying used, operating process.
Concentration is measured after purification, and -20 DEG C save backup.
3), EGFP double digestions are purified with rubber tapping
Using restriction enzyme BamH I (TAKARA, 1605) and Xho I (TAKARA, 1635) to EGFP after purification
Segment carries out double digestion, generates cohesive end.Band is distinguished by agarose (Biowest) gel electrophoresis after the completion of digestion, is made
Judged with DL 2000Marker (TAKARA, 3427), purpose EGFP segments in 750bp or so, cutting recycling purpose band (that is,
The EGFP segments of amplification).The Ago-Gel block containing purpose band for cutting recycling, uses DNA gel QIAquick Gel Extraction Kit
(Axygen, AP-GX-50G) is purified.
New 0.5ml EP test tubes are taken, following reagent is separately added into：
Double digestion system (50ul)：
Pipe carries out mark, reacts 3h in 37 DEG C of water-baths.
Agarose gel electrophoresis, 120V run 15min.15min is impregnated in EB dye liquors.
According to manufacturers instruction, carries out cohesive end segment in gel and recycle, measure concentration, -20 DEG C save backup.It will be by
For 2 part construction recombination plasmid pIEx-1-EGFP-myc epitope-6*his of embodiment.
Embodiment 2, structure pIEx-1-EGFP-myc epitope-6*his recombinant plasmids
1), pIEx-1 plasmids obtain
By the e. coli tg1 overnight incubation containing pIEx-1, kit (Axygen, AP-MN-P-50G) is then used
Plasmid pIEx-1 is extracted, often pipe takes bacterium solution 3ml, operating process to press manufacturer's explanation.Plasmid purification measures concentration, and -20 DEG C of preservations are standby
With.
2), pIEx-1 double digestions are purified with rubber tapping
Using restriction enzyme BamH I (TAKARA, 1605) and Xho I (TAKARA, 1635) to after purification
PIEx-1 plasmids carry out double digestion, generate cohesive end.Item is distinguished by agarose (Biowest) gel electrophoresis after the completion of digestion
Band, the purpose band after digestion are judged using DL5000Marker (TAKARA, 3428) in 3700bp or so and cut recycling phase
Answer the purpose band (the pIEx-1 linear fragments that i.e. digestion is completed) of size.Cut the Ago-Gel containing purpose band of recycling
Block is purified using DNA gel QIAquick Gel Extraction Kit (Axygen, AP-GX-50G).For pIEx-1-myc epitope-6*his pieces
The preparation of section.
New 0.5ml EP test tubes are taken, following reagent is separately added into：
Double digestion system (50ul)：
Pipe carries out mark, reacts 3h in 37 DEG C of water-baths.
Agarose gel electrophoresis, 120V run 15min.15min is impregnated in EB dye liquors.
According to manufacturers instruction, carries out cohesive end segment in gel and recycle, measure concentration, -20 DEG C save backup.
3), over-lap PCR generates pIEx-1-myc epitope-6*his segments
Using the segment pIEx-1 with cohesive end BamH I and Xho I as template (purify before, -20 DEG C preservation, on
State obtained by step 2)), specific primer is designed, myc epitope-6*his sequences are inserted into using the method for over-lap PCR
pIEx-1.Primer information is as follows：
Fp1：
GATCTGAATAGCGCCGTTGACCATCATCATCATCATCACTAAGTGATTAACCTCAGG
Fp2：
CCGCTCGAGGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTTGAC
Rp：
CGCGGATCCAGCGGTTTCTTTACCAGAAGAGTG。
Primer can entrust Sangon Biotech to synthesize.
PCR is carried out at twice, and it is band cohesive end pIEx-1 (steps to use primers F p1 and Rp, the template used for the first time
2) gained)；Primers F p2 and Rp are used for the second time, the use of template are the segment for purifying of tapping rubber after amplification for the first time.PCR uses high
Fidelity amplification enzyme KOD-Plus-Neo enzymes (TOYOBO, KOD-401), PCR system is as follows：
Solution system (50ul)：
Sequentially add following solutions：
Mixing is blown and beaten, 65 DEG C of heating 10min of PCR instrument are inserted into ice, static 5min prevents renaturation at once.
During 65 DEG C of heating, PCR mother liquors are configured, following solutions are sequentially added：
It is placed on ice after mixing.
Time system：
PCR mother liquors are added in Primed template liquid, mixing is blown and beaten, not generate bubble.
It is reacted using following time system：
4), over-lap PCR first round product rubber tapping purifying
Manufacturers instruction is pressed in DNA gel QIAquick Gel Extraction Kit (Axygen, the AP-GX-50G) purifying used, operating process.It is pure
Concentration is measured after change, -20 DEG C save backup.
5), over-lap PCR second takes turns the purifying of product PCR product
Manufacturers instruction is pressed in PCR product QIAquick Gel Extraction Kit (Axygen, the AP-PCR-50G) purifying used, operating process.
Concentration is measured after purification, and -20 DEG C save backup.
6), pIEx-1-myc epitope-6*his segments double digestion is purified with rubber tapping
Using restriction enzyme BamH I (TAKARA, 1605) and Xho I (TAKARA, 1635) to after purification
Obtained by pIEx-1-myc epitope-6*his segments (above-mentioned steps 5)) double digestion is carried out, generate cohesive end.Digestion is completed
Band is distinguished by agarose (Biowest) gel electrophoresis afterwards, purpose band is judged according to DNA marker sizes and is cut back
Receive purpose band (that is, linearisation pIEx-1-myc epitope-6*his segments that digestion is completed).Cutting recycling contains purpose
The Ago-Gel block of band is purified using DNA gel QIAquick Gel Extraction Kit (Axygen, AP-GX-50G).
New 0.5ml EP test tubes are taken, following reagent is separately added into：
Double digestion system (50ul)：
Pipe carries out mark, reacts 3h in 37 DEG C of water-baths.
Agarose gel electrophoresis, 120V run 15min.15min is impregnated in EB dye liquors.
According to manufacturers instruction, carries out cohesive end segment in gel and recycle, measure concentration, -20 DEG C save backup.
7), construction recombination plasmid pIEx-1-EGFP-myc epitope-6*his
Using T4 ligases (TAKARA, 2011A) by the pIEx-1-myc containing cohesive end BamH I and Xho I
Obtained by epitope-6*his (above-mentioned steps 6)) and EGFP (above-mentioned steps 1) gained) connect into recombinant vector.System is as follows
(20ul)：
Pipe carries out mark, reacts 2h in 16 DEG C of water-baths.
E. coli tg1 competent cell is converted, conversion Escherichia coli take 50ul to be spread evenly across Amp (Sangon
Biotech) the solid-state LB tablets of resistance, 37 DEG C of culture 10h, picking single bacterium colony cultivated in LB culture mediums.
8) pIEx-1-EGFP-myc epitope-6*his are identified
Plasmid is extracted using kit (Axygen, AP-MN-P-50G), often pipe takes 3ml bacterium solutions, extraction plasmid to carry out PCR
Identification and double digestion identification.
PCR identifications are carried out according to example 1 above step 1), as a result consistent with step PCR results, then qualification result is
Correctly.The carrier segments and target fragment size that double digestion obtains compare in the same size with theory according to DNA Marker, then reflect
It is correct to determine result, as shown in Fig. 3 swimming lanes 1.It is that correct bacterium colony is stored in -80 using 25% glycerine of final concentration by qualification result
℃。
Embodiment 3, structure pIEx-1-SPro-EGFP-myc epitope-6*his recombinant plasmids
1) signal peptide sequence (shown in Fig. 1) of 30K2 albumen, is predicted using SignalP4.1 programs, is protein N terminal 21
A amino acid sequence MKPVIVILCLFVASLYAADSD uses the segment pIEx-1-myc with cohesive end BamH I and Xho I
Epitope-6*his (is purified, -20 DEG C of preservations, 2 gained of embodiment) before as template, according to 30K2 gene order (accession number
NM_001279380), obtain and encode the nucleic acid sequence for leading peptide, specific primer is designed according to the nucleic acid sequence, uses overlapping
The peptide sequence of leading of 30K2 is implemented in pIEx-1-myc epitope-6*his by the method for PCR.Primer information is as follows：
Fp：
CCGCTCGAGGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTTGACCATCATC
Rp1：
ACGAAAAGACATAGAATAACTATGACGGGCTTCATAGCGGTTTCTTTACCAGAAGAGTG
Rp2：
CGCGGATCCGTCGGAATCTGCAGCATACAGAGATGCCACGAAAAGACATAGAATAACTATGACGG
Primer is synthesized by Sangon Biotech commissions.
The over-lap PCR first round is Fp and Rp1 using primer, and template uses pIEx-1-myc epitope-6*his segments；
Second wheel is Fp and Rp2 using primer, and template is tapped and recovered segment using the first round.PCR uses high-fidelity amplification enzyme KOD-
Plus-Neo enzymes (TOYOBO, KOD-401), PCR system is as follows：
Solution system (50ul)：
Sequentially add following solutions：
Mixing is blown and beaten, 65 DEG C of heating 10min of PCR instrument are inserted into ice, static 5min prevents renaturation at once.
During 65 DEG C of heating, PCR mother liquors are configured, following solutions are sequentially added：
It is placed on ice after mixing.
Time system：
PCR mother liquors are added in Primed template liquid, mixing is blown and beaten, not generate bubble.
It is reacted using following time system：
2), over-lap PCR first round product rubber tapping purifying
Manufacturers instruction is pressed in DNA gel QIAquick Gel Extraction Kit (Axygen, the AP-GX-50G) purifying used, operating process.It is pure
Concentration is measured after change, -20 DEG C save backup.
3), over-lap PCR second takes turns the purifying of product PCR product
Manufacturers instruction is pressed in PCR product QIAquick Gel Extraction Kit (Axygen, the AP-PCR-50G) purifying used, operating process.
Concentration is measured after purification, and -20 DEG C save backup.
4), pIEx-1-SPro-myc epitope-6*his segments double digestion is purified with rubber tapping
Using restriction enzyme BamH I (TAKARA, 1605) and Xho I (TAKARA, 1635) to after purification
Obtained by pIEx-1-Spro-myc epitope-6*his segments (above-mentioned steps 3)) double digestion is carried out, generate cohesive end.Digestion
Band is distinguished by agarose (Biowest) gel electrophoresis after the completion, and cuts recycling purpose band and (possesses cohesive end
PIEx-1-Spro-myc epitope-6*his segments).The Ago-Gel block containing purpose band for cutting recycling, uses DNA
Gel reclaims kit (Axygen, AP-GX-50G) purifies.
New 0.5ml EP are taken, following reagent is separately added into：
Double digestion system (50ul)：
Pipe carries out mark, reacts 3h in 37 DEG C of water-baths.
Agarose gel electrophoresis, 120V run 15min.15min is impregnated in EB dye liquors.
According to manufacturers instruction, carries out cohesive end segment in gel and recycle, measure concentration, -20 DEG C save backup.
5), construction recombination plasmid pIEx-1-SPro-EGFP-myc epitope-6*his
Using T4 ligases (TAKARA, 2011A) by the pIEx-1- containing cohesive end BamH I and Xho I
Obtained by mycepitope-6*his (above-mentioned steps 4)) and EGFP connect into recombinant vector (obtained by embodiment 1).
System is following (20ul)：
Pipe carries out mark, reacts 2h in 16 DEG C of water-baths.
E. coli tg1 competent cell is converted, conversion Escherichia coli take 50ul to be spread evenly across Amp and (are purchased from Sangon
Biotech) the solid-state LB tablets of resistance, 37 DEG C of culture 10h, picking single bacterium colony cultivated in LB culture mediums.
6), pIEx-1-Spro-EGFP-myc epitope-6*his are identified
Plasmid is extracted using kit (Axygen, AP-MN-P-50G), often pipe takes 3ml bacterium solutions, extraction plasmid to carry out PCR
Identification and double digestion identification.
PCR identifications are carried out according to the step 1) of experiment case study 1 above, it is as a result consistent with step PCR results, then identify knot
Fruit is correct, and the carrier segments that double digestion obtains are compared according to DNA Marker with target fragment size and theory is in the same size,
Then qualification result is correct (as shown in Fig. 3 swimming lanes 2), is that correct bacterium colony is preserved using 25% glycerine of final concentration by qualification result
In -80 DEG C.
Embodiment 4, eukaryotic expression identification
Using insect expression system express express target protein, while identifying that EGFP albumen contains in cell and cell culture medium
Amount.Bombyx mori cell BmN expression systems as this research institute (Biochemistry and Molecular Biology research institute of Institutes Of Technology Of Zhejiang) at
The expression system of ripe eukaryon, so this uses bombyx mori cell as expression cell.
1), plasmid purification
By the e. coli tg1 (embodiment 3 gained) containing pIEx-1-SPro-EGFP-myc epitope-6*his and
E. coli tg1 (2 gained of embodiment) overnight incubation of pIEx-1-EGFP-myc epitope-6*his, uses kit
(Axygen, AP-MN-P-50G) extracts plasmid, and often pipe takes bacterium solution 3ml, operating process to press manufacturer's explanation.Plasmid purification measures dense
Degree, respectively 150ng/ μ l and 170ng/ μ l.- 20 DEG C save backup.
2), bombyx mori cell BmN is cultivated
BmN cell culture mediums use sf-900TMII (gibco, 10902088), fetal calf serum use FBS
The ratio of Premium (PAN-Biotech, P30-3302), serum and culture medium is 1:9 (volume ratios).BmN cell culture is 28
DEG C, CO need not be controlled2Concentration.Cell transfecting the previous day spreads cell to 6 orifice plates (Corning, 3516), transfects within second day
Before, cell density rises to 50-80%.
3), BmN cell transfectings
Entire transfection experiment is completed in cell room super-clean bench.With reference to FuGENE@6Transfection (Promega,
E2691) specification, plasmid use pIEx-1-SPro-EGFP-myc epitope-6*his and pIEx-1-EGFP-myc respectively
Epitope-6*his, plasmid concentration is respectively 150ng/ μ l and 170ng/ μ l, by plasmid pIEx-1-EGFP-myc epitope-
The purpose of 6*his transfections is as control, confirm pIEx-1-SPro-EGFP-myc epitope-6*his whether table
It reaches.It is as follows that solution is added in two single holes of six orifice plates for transfection：
It is transfected using serum-free, is free of fetal calf serum when transfection in hole, concrete operations flow is with reference to manufacturers instruction.
Plasmid refers to pIEx-1-SPro-EGFP-myc epitope-6*his, pIEx-1-EGFP-myc epitope-6*
His selects a use.4), WB identifies EGFP secretions
After cell transfecting 72h, the culture medium in six orifice plates, two single holes is first collected, then after cleaning a cell with 1*PBS
500ul 1*PBS are added, 500ul 2*Loading Buffer, lysis at room temperature 5min is added, collect into 1.5ml EP pipes.Again
With new 1.5ml EP pipes, the culture medium 100ul of collection is taken, 100ul 2*Loading Buffer are added.Sample is in metal
100 DEG C of 10min in bath complete sample preparation.
12%PAGE glue (molecular cloning third volume) is prepared, gel electrophoresis is carried out, is then transferred albumen by half-dried turn
To pvdf membrane (Roche, 03010040001), pass through anti-6*his antibody (protein tech, 66005-1-Ig) and anti alpha-
Tubulin antibody (protein tech, 66031-1-Ig) identifies that (α-Tubulin are interior to 6*his and α-Tubulin in sample
Join albumen).Secondary antibody uses sheep anti mouse (protein tech, SA00001-1).Antibody is 1:10000 are diluted in 1*TBST.
Qualification result is：As shown in Figure 4, comparison albumen pre-dyed marker (Thermo Fisher, 26616) is it is found that can be with
Detect the expression of EGFP albumen and α-Tubulin albumen, but in pIEx-1-EGFP-myc epitope-6*his transfections
In cell, only cell sample detects the expression (Fig. 4 swimming lanes 1) of EGFP albumen, and EGFP albumen is not detected in its culture medium
(Fig. 4 swimming lanes 3), conversely, in the groups of cells of transfection pIEx-1-SPro-EGFP-myc epitope-6*his plasmids, not only thin
Born of the same parents' sample detection equally detects EGFP albumen (Fig. 4 swimming lanes 4) in the medium to EGFP albumen (Fig. 4 swimming lanes 2).Root
According to above-mentioned qualification result, it can be derived that the EGFP of pIEx-1-EGFP-myc epitope-6*his plasmid expressions due to without leading
Peptide can not be transported to except cell (Fig. 4 swimming lanes 3) after expression, and pIEx-1-SPro-EGFP-mycepitope-6*
The EGFP albumen of his plasmid expressions leads peptide sequence due to insert 30K2 albumen in its N-terminal, and the albumen of expression can be made to turn
Cell is transported, is secreted into culture medium (Fig. 4 swimming lanes 4), and albumen size and is not inserted into the EGFP (Fig. 4 swimming lanes 1) for leading peptide
Identical, this illustrates that the 30K2 of the present invention leads peptide and recombinant protein can be guided to secrete into extracellular culture medium, and is recombinated in guiding
Protein secretion to it is extracellular when excision itself automatically, do not influence the conformation itself and function of albumen.
Finally, it should also be noted that it is listed above be only the present invention several specific embodiments.Obviously, this hair
Bright to be not limited to above example, acceptable there are many deformations.Those skilled in the art can be from present disclosure
All deformations for directly exporting or associating, are considered as protection scope of the present invention.
Sequence table
<110>Institutes Of Technology Of Zhejiang
<120>Peptide is led for insect expression system secreting, expressing
<160> 2
<170> SIPOSequenceListing 1.0
<210> 2
<211> 21
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 2
Met Lys Pro Val Ile Val Ile Leu Cys Leu Phe Val Ala Ser Leu Tyr
1 5 10 15
Ala Ala Asp Ser Asp
20
<210> 2
<211> 63
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
atgaagcccg tcatagttat tctatgtctt ttcgtggcat ctctgtatgc tgcagattcc 60
gac 63
Claims (5)
1. silkworm albumen 30K2's leads peptide, it is characterized in that the protein amino acid sequence it includes section is：
MKPVIVILCLFVASLYAADSD。
2. coding protein as described in claim 1 leads peptide, it is classified as it is characterized in that encoding the nucleotides sequence for leading peptide sequence：
ATGAAGCCCGTCATAGTTATTCTATGTCTTTTCGTGGCATCTCTGTATGCTGCAGATTCCGAC。
3. silkworm albumen 30K2 as described in claim 1 leads the purposes of peptide, it is characterized in that：The guiding in cell (insect cell)
Protein secretion is to extracellular.
4. silkworm albumen 30K2 according to claim 3 leads the purposes of peptide, it is characterized in that：Albumen is led into secretion egg
White approach, and then make protein secretion to extracellular：Its effect is can to lead peptide using silkworm albumen 30K2 to build insect eukaryon table
Up to carrier, Baculovirus Vector System and the steady plasmid for turning cell, the albumen built on its carrier is enable to express it
It is directly secreted into extracellular culture solution, can surely be turned by cell and continuous flow culture system afterwards, realize that the eukaryon of albumen is continuous
Expression, while this is led peptide and can cut off itself after secretion is completed, to do not influence the conformation for needing to express albumen and
Function.
5. silkworm albumen 30K2 according to claim 3 or 4 leads the purposes of peptide, it is characterized in that：Structure commercialization insect is true
Nuclear expression carrier or Baculovirus Vector System secrete proteins of interest or polypeptide for expressing, and, it is thin for building steady turn
The plasmid of born of the same parents.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810091875.5A CN108409838B (en) | 2018-01-30 | 2018-01-30 | Peptide for secretory expression of insect expression system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810091875.5A CN108409838B (en) | 2018-01-30 | 2018-01-30 | Peptide for secretory expression of insect expression system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108409838A true CN108409838A (en) | 2018-08-17 |
| CN108409838B CN108409838B (en) | 2020-11-13 |
Family
ID=63126612
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810091875.5A Active CN108409838B (en) | 2018-01-30 | 2018-01-30 | Peptide for secretory expression of insect expression system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108409838B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102453711A (en) * | 2010-10-29 | 2012-05-16 | 中国医学科学院病原生物学研究所 | Establishment of protein secreted expression vector and application of same |
| US9447402B2 (en) * | 2013-03-15 | 2016-09-20 | Sysmex Corporation | Method for producing recombinant prothrombin, vector DNA, and reagent kit |
-
2018
- 2018-01-30 CN CN201810091875.5A patent/CN108409838B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102453711A (en) * | 2010-10-29 | 2012-05-16 | 中国医学科学院病原生物学研究所 | Establishment of protein secreted expression vector and application of same |
| US9447402B2 (en) * | 2013-03-15 | 2016-09-20 | Sysmex Corporation | Method for producing recombinant prothrombin, vector DNA, and reagent kit |
Non-Patent Citations (6)
| Title |
|---|
| XIAO-FENG SHI 等: "Identification and Characterization of 30 K Protein Genes Found in Bombyx mori (Lepidoptera: Bombycidae) Transcriptome", 《JOURNAL OF INSECT SCIENCE》 * |
| 刘国琴: "《生物化学（第2版）》", 30 June 2011, 中国农业大学出版社 * |
| 刘静: "《分子生物学实验指导》", 31 October 2015, 中南大学出版社 * |
| 张闻: "《医学生物学》", 31 October 2016, 中国医药科技出版社 * |
| 朱立成: "纳豆激酶和hGM-CSF在家蚕杆状病毒表达系统中表达纯化及活性研究", 《中国博士学位论文全文数据库基础科学辑》 * |
| 金征宇: "《基因与纳米探针-医学分子成像理论与实践（中卷）》", 30 November 2017, 天津科学技术出版社 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108409838B (en) | 2020-11-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Urao et al. | A transcriptional activation domain of ATMYB2, a drought‐inducible Arabidopsis Myb‐related protein | |
| Hou et al. | Heat shock response improves heterologous protein secretion in Saccharomyces cerevisiae | |
| US9115364B2 (en) | Protein expression system | |
| Pérez-Pérez et al. | An arabinose-inducible expression vector, pAR3, compatible with ColE1-derived plasmids | |
| CN102747097B (en) | I type human collagen and epidermal growth factor dual expression vector, and expression purification method thereof | |
| Nomoto et al. | Cloning‐free template DNA preparation for cell‐free protein synthesis via two‐step PCR using versatile primer designs with short 3′‐UTR | |
| CN108753822A (en) | Deliver the expression vector and its preparation method and application of pattern of fusion rna binding protein | |
| CN104480125B (en) | Trachinotus ovatus thioredoxin gene | |
| CN108409838A (en) | Peptide is led for insect expression system secreting, expressing | |
| WO2021088944A1 (en) | Use of escherichia coli molecular chaperone groel/es in assisting synthesis of plant rubisco | |
| JP6960409B2 (en) | promoter | |
| CN107868799A (en) | Expression vector and its construction method and application | |
| CN109988777A (en) | Glutamine synthetase gene and application | |
| US5804408A (en) | Expression of human SOD in blue green algae | |
| Tamás et al. | Heterologous expression and protein engineering of wheat gluten proteins | |
| CN103088048A (en) | Modified cloning vector and application thereof | |
| CN102190735A (en) | Fusion protein TAT (transactivator of transcription)-OCT4 (octamer-binding transcription factor 4), and coding gene and application thereof | |
| CN110616230B (en) | Method for promoting secretory expression of zearalenone degrading enzyme ZHD protein and application | |
| CN106892969A (en) | Duck circovirus ORF3 albumen nuclear location NLS sequences and its application | |
| CN101333537B (en) | Expression type pre-T vector, preparation thereof and applications | |
| CN107904252A (en) | Plasmid vector and its construction method, application | |
| CN112126645B (en) | Ring RNA (ribonucleic acid) knocking-down method and application thereof | |
| CN106075396B (en) | The application of Cul4 albumen | |
| Manch-Citron et al. | The translational hop junction and the 5′ transcriptional start site for the Prevotella loescheii adhesin encoded by plaA | |
| CN102827858A (en) | Quick clone containing GB1 protein fusing label and expression plasmid vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210512 Address after: 312300 south, 1st floor, building C, science and technology entrepreneurship center, 398 mahuan Road, Lihai street, Yuecheng District, Shaoxing City, Zhejiang Province Patentee after: Zhejiang Angelo Biotechnology Co.,Ltd. Address before: 310018, No. 2, No. 5, Xiasha Higher Education Park, Hangzhou, Zhejiang Patentee before: Zhejiang University of Technology |