CN108396064B - Application of reagent for detecting circular RNA circRNF13 in preparation of prognosis preparation for tongue squamous cell carcinoma patient - Google Patents

Abstract

The invention discloses application of a reagent for detecting circular RNA circRNF13 in preparation of a preparation for prognosis of patients with tongue squamous cell carcinoma. In particular to a preparation for the prognosis of tongue squamous carcinoma patients by a real-time fluorescence quantitative analysis method. Survival analysis of circRNF13 expression in tongue squamous carcinoma tissues and patient survival time and status revealed that the average survival time of patients not expressing circRNF13 in tongue squamous carcinoma tissues was significantly shorter than that of patients with higher circRNF13 expression. The circRNF13 is a molecular marker related to the prognosis of tongue squamous cell carcinoma, and the circRNA is low or not expressed, so that the prognosis of patients is poor.

Description

Application of reagent for detecting circular RNA circRNF13 in preparation of prognosis preparation for tongue squamous cell carcinoma patient

Technical Field

The invention belongs to the field of tumor molecular biology, and particularly relates to an application of a reagent for detecting cyclic RNAcircRNF13 in tongue squamous cell carcinoma tissues in preparation of a tongue squamous cell carcinoma prognosis preparation.

Background

The results of human genome Project and its subsequent Encyclopedia Project of DNA elements (ENCODE) study show that protein-encoding gene sequences account for only 1-3% of human genome sequences, while most of The transcribable sequences in The human genome are non-coding RNAs (ncRNAs). Non-coding RNA, although not coding for proteins, has been of great interest in the field of biomedical research due to its widespread involvement in regulation of gene expression in cells. The most studied ncRNA molecules are linear ncRNA molecules, which can be divided into micro RNA (microRNA, miRNA,19-23nt) and long non-coding RNA (long non-coding RNA, lncRNA, >200nt) according to the length of RNA sequence, and play important roles in the occurrence and development of various common human diseases including malignant tumors. Recently, a new class of ncRNA molecules, circular RNA, has become a new frontier and hot spot in the biomedical field due to its unique configuration and important biological functions that are increasingly discovered.

circRNA was once thought to be a wrong product in the post-transcriptional processing of genes. Similar to the processing of linear RNAs such as mRNA and IncRNA, the formation of circRNA is also generated by splicing RNA precursors by a splicing complex, except that in this process, flanking loop sequences are first combined to form a loop, then the splicing complex is spliced, and finally the flanking sequences are cleaved off to form circRNA. In recent years, with the development of sequencing technologies, particularly new-generation sequencing technologies such as RNA-seq, more and more circRNAs are discovered and research has revealed that part of circRNAs play an important role in numerous life activities. In addition, the unique structure of the protein leads the circRNA to be insensitive to nuclease, and the circRNA also has obvious advantages in the development and application of tumor markers, so the protein is very likely to be used as an important molecular marker and a target point for developing new drugs. However, due to the recent rise in the art, most of circRNA has not been discovered or studied yet.

Tongue Squamous Cell Carcinoma (TSCC) is the most common malignant tumor in the oral cavity, and most of the tongue squamous carcinomas are squamous carcinomas, which mostly occur at the tongue margin, and secondly, at the tongue tip, tongue back and tongue root, which are often ulcerated or infiltrative. Generally, the degree of malignancy is high, the growth is fast, the infiltration is strong, and the tongue movement is limited due to the constant wave and the tongue muscle, so that the speaking, eating and swallowing are difficult. Chemotherapy which is mainly performed by cisplatin drugs in the adjuvant mode of surgical treatment is a clinically main treatment scheme for tongue squamous carcinoma. However, the therapeutic effect of patients with tongue squamous cell carcinoma is often not ideal in clinical practice, the 5-year survival rate is only 55-65%, and the reason for this is mainly that the ubiquitous drug resistance of cancer cells (such as circulating tumor cells which have invaded and transferred into blood vessels or lymphatic vessels) remained after surgery, which causes the recurrence and metastasis of tumors and results in treatment failure. Therefore, finding out the resistance mechanism of the tongue squamous carcinoma cells to the chemotherapeutic drugs, screening new drug action targets, and finally improving the survival rate and the survival quality of patients is an important subject worth the research of clinical researchers.

To study the effect and mechanism of circRNAs in resistance of tongue squamous carcinoma cells to cis-platinum drugs, we analyzed the expression of circRNAs in two pairs of tongue squamous carcinoma cell lines (Tca8113 and Cal27) before and after cisplatin treatment using the circRNA gene chip Arraystar Human Circular RNA Microarray V2.0 from Agilent. The expression change of the circRNF13 is the most remarkable, which indicates that the circRNF13 is possibly related to cisplatin resistance of tongue squamous cell carcinoma, and the biological function and action mechanism of the circRNF13 are not reported at all so far.

As the gene chip can only design probes based on the upstream and downstream sequences of the circular splicing sites of the circRNA, the circRNA is captured by the probes specifically, so as to detect the expression abundance of the circRNA in cells or tissues; specifically, for the circRNF13 discovered by the circRNA chip, the technical data provided by the gene chip can find that the probe is 60bp in total, the first segment is the sequence of 30bp at the 3 'end of exon 8 of RNF13 gene, and the second segment is 30bp at the 5' end of exon 2 of RNF13 gene, which suggests that the probe is processed by joining exon 2 and exon 8 of the precursor RNA transcribed from RNF13 gene, but specifically does it not be clear which exons of RNF13 are processed (is it not all the exon 2-8 inclusive?or not that the intron sequence is also included because of the presence of circRNA. Subsequently, we designed primers and succeeded in cloning the full-length sequence of circRNF13 by two nested PCRs, confirming that the circRNF13 is indeed formed by circular splicing of exon 2-8 of RNF13 gene (ring finger protein 13, NM-183381.2) located in the 3q25.1 region of chromosome, with a full-length of 716 bp.

In order to further research the biological function of the circRNF13, the sequence specificity of small interfering RNA (siRNA) aiming at the circRNF13 is designed, so that the expression of the circRNF13 is reduced, and meanwhile, an overexpression vector of the circRNF13 is successfully constructed to overexpress the circRNF13 in tongue squamous cell carcinoma cells. MTT and flow cytometry detection prove that the up-regulation of circRNF13 can obviously inhibit the proliferation of tongue squamous cell carcinoma cells, the mechanism is to block the cell cycle and induce apoptosis, and the opposite result is obtained by knocking down the circRNF 13. Furthermore, a tongue squamous carcinoma chemotherapy drug-resistant cell strain is successfully obtained through induction culture, the expression level of circRNF13 in the cell is detected through real-time quantitative PCR, and the expression of the circRNF13 in the drug-resistant cell strain is found to be remarkably down-regulated compared with that of an original cell strain; however, if we over-express circRNF13 in drug-resistant cells, the drug-resistant phenotype of tongue squamous cell carcinoma cells can be obviously reversed, and the reduction of the expression of circRNF13 in the original cell strain can obviously improve the tolerance of tongue squamous cell carcinoma cells to cis-platinum.

Finally, the expression condition of the circRNF13 is detected in a tongue squamous carcinoma clinical sample by a real-time fluorescent quantitative PCR and in-situ hybridization method, and the result shows that the expression of the circRNF13 in the tongue squamous carcinoma is obviously reduced, and the survival time of a patient with low circRNF13 expression is shorter than that of a patient with high circRNF13 expression, so that a detection preparation aiming at the lncRNA can also be used for auxiliary diagnosis and prognosis judgment of the tongue squamous carcinoma.

Disclosure of Invention

The invention aims to provide application of a reagent for detecting circular RNA circRNF13 in preparation of a preparation for prognosis of patients with tongue squamous cell carcinoma.

Application of a reagent for detecting circular RNA circRNF13 in preparation of a preparation for prognosis of patients with tongue squamous cell carcinoma, wherein the sequence of the circular RNA circRNF13 is shown as SEQ NO: 1.

The reagent for detecting the circular RNA circRNF13 is a real-time fluorescent quantitative detection reagent.

The real-time fluorescent quantitative detection reagent comprises a primer sequence for real-time fluorescent quantitative detection of circRNF13 expression in tongue squamous carcinoma tissues:

a forward primer: 5-GTCCAGGATAGACATAGAGC-3, and the main components are as follows,

reverse primer: 5-GTGTAGACTTGTGTGGCTGA-3.

The real-time fluorescent quantitative detection preparation is a kit.

The kit also comprises:

internal reference gene GAPDH specific PCR primers:

a forward primer: 5'-ACCACAGTCCATGCCATCAC-3'

Reverse primer: 5'-TCCACCACCCTGTTGCTGTA-3' are provided.

The kit also comprises:

(1) extracting total RNA from tongue squamous carcinoma tissue with RNA stabilizing solution, Trizol reagent, chloroform, isopropanol, and enzyme-free water;

(2) a reagent for reverse transcription of LncRNA circRNF13 into cDNA by using total RNA as a template, which comprises a reverse transcription buffer solution, base triphosphate deoxynucleotides, an RNase inhibitor, MMLV reverse transcriptase and a random primer;

(3) and reagents for real-time quantitative PCR of the cDNA comprise real-time fluorescent quantitative SYBR dye and enzyme-free water.

Survival analysis of circRNF13 expression and patient survival time and status in tongue squamous cell carcinoma tissues revealed that the mean survival time of patients not expressing circRNF13 in tongue squamous cell carcinoma tissues was significantly shorter than that of patients with higher circRNF13 expression. The circRNF13 is a molecular marker related to the prognosis of tongue squamous cell carcinoma, and the circRNA is low or not expressed, so that the prognosis of patients is poor. The invention provides a powerful molecular biology tool for prognosis of tongue squamous carcinoma patients, and has profound clinical significance and important popularization and application prospects.

Drawings

FIG. 1: the circRNF13 was significantly up-regulated after cisplatin treatment as verified by qRT-PCR (left), and sequencing results confirmed that the circRNF13 was indeed detected by qRT-PCR (right). The arrow represents the splicing site, the left side of the arrow is the 3 'end of the RNF 138 exon, and the right side of the arrow is the 5' end sequence of the RNF13 gene No. 2 exon.

FIG. 2: the full-length sequence of the circRNF13 molecule is successfully cloned for the first time through two times of nested PCR-sequencing, and the circRNA is proved to be formed by circularly splicing No. 2-8 exons of RNF13 gene transcript NM-183381.2 positioned on a chromosome 3q25.1 region, and the full length is 716 bp.

FIG. 3: a circRNF13 overexpression vector is designed and successfully constructed, a pcDNA3.1 vector is used as a basic framework, two sections of loop sequences and restriction enzyme sites are added at the downstream of a CMV promoter of the vector, exons 2 to 8 of RNF13 are subjected to enzyme digestion through PCR and are connected into the vector (on the left), then the vector is transfected into a tongue squamous cell carcinoma cell, and the circRNF13 is successfully overexpressed in the tongue squamous cell carcinoma cell (on the right).

FIG. 4: a siRNA sequence (left) specifically targeting the circular RNA is designed aiming at the circular splicing site (the junction of exon 8 and exon 2) of the circRNF13, and then the siRNA sequence is transfected into tongue squamous carcinoma cells, so that the expression of the circRNF13 is successfully knocked down in the tongue squamous carcinoma cells (right).

FIG. 5: MTT proliferation experiments show that compared with a control group (NC), overexpression of circRNF13(OE-circRNF13) can inhibit the proliferation of tongue squamous carcinoma cells, and knocking down the expression of circRNF13 (si-circRNF13) can promote the proliferation of tongue squamous carcinoma cells.

FIG. 6: flow cytometry analysis shows that the distribution ratio of G2/M phases of tongue squamous carcinoma cells is obviously increased after over-expression of circRNF13(OE-circRNF13) compared with that of a control group (NC), indicating that the cell cycle is blocked in the G2/M phase, and after the expression of circRNF13 (si-circRNF13) is knocked down, the distribution of S phases is obviously increased, indicating that the cell cycle process is accelerated.

FIG. 7: analyzing the apoptosis condition by a flow cytometer, and finding that the tongue squamous cell carcinoma cell apoptosis ratio is obviously increased after the over-expression of the circRNF13(OE-circRNF13) compared with a control group (NC), and the tumor cell apoptosis ratio is lower under the normal culture condition, so the expression of the circRNF13 is reduced, and the apoptosis cell ratio is slightly reduced.

FIG. 8: circRNF13 expression was significantly reduced in chemotherapy-resistant Cells (CR) compared to control (NC).

FIG. 9: after knocking down the expression of circRNF13 (si-circRNF13) in primary tongue squamous carcinoma cells (NC) or over-expressing the circRNF13(OE-circRNF13) in drug-resistant Cells (CR), treating the cells with cisplatin at the same concentration, and then detecting the apoptosis condition by a flow cytometer, the fact that the knocking down the expression of the circRNF13 can increase the tolerance of the cells to the cisplatin (apoptosis reduction) is found, while the over-expressing the circRNF13 can obviously reduce the drug resistance of the drug-resistant cells.

FIG. 10: the expression level of circRNF13 was detected by qRT-PCR in 28 pairs of fresh tongue squamous carcinoma biopsy (T) and paracarcinoma control tissue (N), and it was found that the expression of circRNF13 was significantly down-regulated in the tongue squamous carcinoma biopsy.

FIG. 11: the expression of circRNF13 was detected by in situ hybridization techniques in archived tongue squamous carcinoma (right) and paracarcinoma control tissues (left), further confirming that circRNF13 is less or not expressed in tongue squamous carcinoma biopsy tissues.

FIG. 12: we collected 88 tongue squamous carcinoma tissue specimens with clinical follow-up data and tested the expression of circRNF13 by in situ hybridization, of which 21 could not detect the expression of circRNF13 (Negative), and these patients had shorter survival time and worse prognosis than other patients (although circRNF13 was not expressed at a high level, it could be detected, Positive).

Detailed Description

The invention is further illustrated by the following detailed description, but is not to be construed as being limited thereto.

Example 1 PCR sequencing determined the full-Length sequence of circRNF13 in tongue Scale carcinoma cells

1. Materials and methods

1.1 cell lines

Tongue squamous carcinoma cells Tca8113 and Cal27 were purchased from the cell center of university of Central and south China and cultured under conventional conditions.

1.2 reagents and kits

TRIZOL^TMReagent (invitrogen); gel recovery kit (OMEGA); reverse transcription kit (Promega); proteinase K, DNase I, RNAsin, RNase A (GBICOL company); LA

Enzyme (Takara).

1.3 fluorescent quantitative PCR detection of circRNF13 expression in tongue squamous cell carcinoma cells

Total RNA was extracted, and 1. mu.g of RNA was reverse-transcribed to cDNA, followed by real-time fluorescent quantitative PCR. The forward primer of circRNF13 is 5-GTCCAGGATAGACATAGAGC-3 as shown in SEQ NO:2, and the reverse primer is 5-GTGTAGACTTGTGTGGCTGA-3. Shown as SEQ NO. 3.

The GAPDH forward primer used for the control was 5'-ACCACAGTCCATGCCATCAC-3' as shown in SEQ NO. 4 and the reverse primer 5'-TCCACCACCCTGTTGCTGTA-3' as shown in SEQ NO. 5.

Real-time fluorescent quantitative PCR reaction system

Real-time fluorescent quantitative PCR reaction step

After the reaction is finished, an amplification curve and a melting curve of the real-time fluorescence quantitative PCR are confirmed, and the expression intensity of each gene is normalized according to a CT value (threshold cycle values) and an internal reference Gene (GAPDH), and then a group t-test is adopted to calculate a P value.

Finally, sequencing the fragments amplified by the real-time fluorescent quantitative PCR, carrying out sequence alignment on the amplified fragments, confirming that the fragments amplified by the people are the circRNF13, and obtaining the specific sites of circRNF13 circular splicing.

1.4 reverse transcription PCR to obtain circRNF13 full Length

1) The total length circRNF13 sequence was amplified by PCR, which was nested in two overlapping PCR runs, using tongue squamous carcinoma cell Tca8113cDNA as template by designing two pairs of primers (the sequences obtained by primer design and PCR amplification are shown in FIG. 2). The full-length sequence amplification primers for circRNF13 are as follows:

first amplification, upstream primer: 5-GCTAGAAGAAACAGACTTCGTAAA-3; as shown in SEQ NO. 6;

a downstream primer: 5-CTAATGAGGTCATCAGAATCAACA-3 shown in SEQ NO. 7;

second amplification, upstream primer: 5-AATGTTGATTCTGATGACCT-3, as shown in SEQ NO:8,

a downstream primer: 5-AGATTGTGTAGACTTGTGTGG-3 as shown in SEQ NO. 9.

2) PCR amplification, circRNF13 full-length sequence, PCR reaction conditions as follows:

PCR reaction step

3) And recovering the target fragment from the PCR product gel, and then performing sequencing analysis.

2. Results

2.1circRNF13 expression was significantly elevated in cisplatin-treated tongue squamous cell carcinoma cells

After tongue squamous carcinoma cells are treated by cisplatin (P), the expression of circRNF13 in the cells is detected by real-time fluorescent quantitative PCR (polymerase chain reaction), and the expression level of circRNF13 is obviously increased compared with Negative Control (NC) (figure 1, left); in order to confirm that the real-time fluorescent quantitative PCR detection is actually circRNF13, sequencing analysis is carried out on a real-time fluorescent quantitative PCR product, and the amplified fragment is formed by splicing the 3 'end of the No. 8 exon and the 5' end of the No. 2 exon of RNF13 and is actually a novel circRNA molecule.

2.2 our amplification sequencing confirmed the full-length sequence of circRNF13

Since circRNF13 is a novel circular RNA molecule, its specific sequence, particularly the transcript sequence expressed in tongue squamous cell carcinoma, needs further confirmation. We designed two pairs of primers and succeeded in cloning the full-length sequence of circRNF13 by two nested PCRs, confirming that the circRNF13 is indeed formed by the circular splicing of exons 2-8 of the RNF13 gene (ring finger protein 13, NM-183381.2) located in the 3q25.1 region of chromosome (FIG. 2), with a full-length of 716bp (as shown in SEQ NO: 1).

Example 2circRNF13 inhibition of cell cycle arrest and induction of apoptosis in tongue squamous cell carcinoma

1. Materials and methods

1.1 reagents and kits

Restriction enzymes Cla I and Sac II, T4DNA ligase and the like were purchased from Takara; TRIZOL^TMReagent (invitrogen); plasmid extraction kit, gel recovery kit (OMEGA); reverse transcription kit (Promega); proteinase K, DNase I, RNAsin, RNase A (GBICOL company); tetramethylazodicarbonyl blue (MTT, Sigma); antibiotic G418 (Ameresc); cell cycle detection kit (Invitrogen), apoptosis detection kit (Invitrogen).

1.2 Induction culture of drug-resistant cells of tongue squamous carcinoma

In a cell culture medium, low-dose cisplatin is added, the concentration of the cisplatin is gradually increased, and after long-time induction culture, a cisplatin-tolerant drug-resistant cell strain is finally obtained.

1.3 construction of the circRNF13 eukaryotic expression vector

We first inserted upstream and downstream loop-forming sequences, GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTT is shown in SEQ NO:10 and GAAAAGAATTAGGCTCGGCACGGTAGCTCACACCTGTAATCCCAGCA is shown in SEQ NO:11, into pcDNA3.1 vector (from Invitrogen corporation) at the multiple cloning sites to facilitate the transcription and processing of the inserted fragments into circular RNA; this is a circular RNA eukaryotic expression blank expression vector; the specific construction process is as follows:

designing a loop forming sequence suitable for the expression of the circRNA according to a formation mechanism of the circRNA and a basic method of eukaryotic RNA splicing; according to the sequence information of the commercial vector pcDNA3.1, a proper multiple cloning site is designed, so that a complete DNA sequence for realizing the over-expression of the circRNA is obtained:

GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTTCTTAAGCTTGGTACCGAGCTCGG ATCCACATCGATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCGCTCGAGTCTAGAGAAAAGAATTAGGCTCGGCACGGTAGCTCACACCTGTAATCCCAGCA, as shown in SEQ NO. 12;

the middle underlined part is a multiple cloning site, and the two ends are upstream and downstream loop forming sequences respectively;

adding NheI restriction enzyme site sequence at one end of the synthesized DNA sequence for realizing the circRNA overexpression, adding ApaI restriction enzyme site sequence at the other end, carrying out enzyme digestion through NheI and ApaI, constructing into a pcDNA3.1 vector to obtain a pcCirc blank plasmid (the sequence is shown as SEQ NO: 13), and sequencing to confirm that the plasmid is correct.

To construct a circRNF13 overexpression vector. We chose Cla I and Sac II sites for cleavage of pcCirc blank plasmid (i.e., the pcDNA3.1 vector constructed above with inserted upstream and downstream loop-forming sequences), and inserted the circRNF13 sequence between the upstream and downstream loop-forming sequences of the vector (FIG. 3, left).

The construction of the circRNF13 overexpression vector (i.e., eukaryotic expression vector) is as follows:

1) taking tongue squamous carcinoma cell Tca8113cDNA as a template and utilizing TaKaRa LA

The enzyme performs PCR to amplify the full-length circRNF13 sequence. The full-length sequence amplification primers for circRNF13 are as follows:

an upstream primer: 5'-GTGATTTTACAACGAGAT-3' is shown in SEQ NO. 14;

a downstream primer: 5'-CTTTCTTGAATTTATGTA-3' is shown in SEQ NO. 15;

after restriction enzyme Cla I and Sac II recognition sites and protective bases are added to the 5' ends of the upstream and downstream primers respectively, the sequences of the primers are as follows:

upstream: 5' -AGGAATCGATGTGATTTTACAACGAGAT-3' (underlined is the Cla I recognition site) is shown in SEQ NO: 16;

downstream: 5' -ATGCCCGCGGCTTTCTTGAATTTATGTA-3' (the underlined part is the Sac II recognition site) is shown in SEQ NO: 17;

2) PCR amplification, circRNF13 full-length sequence, PCR reaction conditions as follows:

PCR reaction step

3) Performing electrophoresis on the PCR product, performing gel recovery on a target fragment, performing double enzyme digestion on the target fragment by Cla I and Sac II, performing electrophoresis, and performing gel recovery again;

4) carrying out double enzyme digestion on the pcCirc blank plasmid by Cla I and Sac II, and then recovering a target fragment by electrophoresis gel;

5) connecting the products obtained in the steps 3) and 4) by using T4DNA ligase to obtain a vector plasmid for eukaryotic expression of circRNF 13;

6) transforming the eukaryotic expression plasmid containing the full-length sequence of circRNF13 obtained in step 5) into competent Escherichia coli to amplify the plasmid.

1.4circRNF13 Small RNA interference sequences (siRNA)

We designed specific small interfering RNA (siRNA, FIG. 4, position of siRNA shown on left) sequences for the splice sites of circRNF13 as follows:

5-AGAAAGGUGAUUUUACAACGA-3 is shown in SEQ NO:18,

also, the Scramble sequence without target in the human genome sequence was selected as a control for siRNA:

the sequence of Scramble is as follows:

5'-GACACGCGACUUGUACCAC-3' are provided. As shown in SEQ NO. 19, the amino acid sequence of the polypeptide,

this sequence was synthesized by Invitrogen corporation.

1.5 preparation of polylysine-coated silicon nanoparticles

The polylysine coated silicon nanoparticles are synthesized by applying OP-10/cyclohexane/ammonia microemulsion self-assembly technology to silicon nanoparticles (SiNP), and are prepared by utilizing the surface energy of the silicon nanoparticles and the ionic electrostatic action; the nano-particles can be prepared by the following method:

1) mixing OP-10 (nonylphenol polyoxyethylene ether), cyclohexane and ammonia water, stirring uniformly at room temperature, adding Tetraethoxysilane (TEOS), continuously stirring until polymerization is completed, adding acetone with the same volume, performing ultrasonic dispersion, centrifuging, washing with double distilled water for three times, centrifuging, collecting precipitate, drying at 80 ℃, and grinding to obtain silicon nanoparticles (SiNP with the particle size range of 10-50 nm). Wherein H₂O and OP-10 and H₂The molar ratio of O to TEOS is 2-10, the concentration of ammonia water is 1.6-28%, and TEOS is in a ringThe molar concentration in hexane is 0.1 to 3 mol/L.

2) Suspending SiNP in 0.1-10 mg/ml solution in 0.6M NaCO₃In the solution, carrying out ultrasonic dispersion, centrifuging, removing supernatant, then re-suspending the precipitate in PBS (pH 7.4) according to 0.1-10 mg/mL, carrying out ultrasonic dispersion, adding polylysine (the final concentration is 4-15 nmol/mL), fully mixing uniformly, and mixing and shaking at room temperature; centrifuging, discarding the supernatant, and resuspending the precipitate in double distilled water according to 0.1-10 mg/ml to obtain the polylysine modified silicon nanoparticles.

3) Ultrasonically dispersing the modified silicon nanoparticles, adding 10-50 ug of circRNF13 overexpression vector or 10-100pmol of siRNA into each milliliter of nanoparticle suspension, mixing, and standing at room temperature to combine.

1.6 cell culture and transfection

The tongue squamous carcinoma cells Tca8113 and Cal27 or drug-resistant cells with good growth state are expressed in a 2x 10 mode⁵The cells/well were seeded in 6-well plates, and the 6-well plates were placed at 37 ℃ with 5% CO₂In the incubator, when the cultured cells grow to 50-70% of the density, the transfection of the circRNF13 overexpression vector or siRNA can be started; the transfection procedure was as follows:

adding 100 mul of prepared polylysine modified silicon nanoparticle suspension carrying the circRNF13 eukaryotic expression plasmid or siRNA into a sterile EP tube, and gently and uniformly mixing with 100 mul of serum-free culture medium; washing the cells 3 times with D-Hank's solution; adding 800 μ l of serum-free medium (without antibiotics) into the mixture, gently mixing, and adding into 1 well of 6-well plate; place 6 well plate in CO₂The cells were incubated at 37 ℃ for 6 hours in an incubator, and then the supernatant was discarded and the cells were further incubated overnight with complete medium. Polylysine-modified silicon nanoparticles with empty vector or scarmble sequence were used as experimental controls.

1.7 real-time fluorescent quantitative PCR detection of intracellular expression level of circRNF13

After cell processing, cells were collected at appropriate time points, total RNA was extracted, and after reverse transcription of 1. mu.g of RNA into cDNA, real-time fluorescent quantitative PCR was performed. The forward primer of circRNF13 is 5-GTCCAGGATAGACATAGAGC-3 as shown in SEQ NO:2, and the reverse primer is 5-GTGTAGACTTGTGTGGCTGA-3. Shown as SEQ NO. 3.

The GAPDH forward primer used for the control was 5'-ACCACAGTCCATGCCATCAC-3' as shown in SEQ NO. 4 and the reverse primer 5'-TCCACCACCCTGTTGCTGTA-3' as shown in SEQ NO. 5.

Real-time fluorescent quantitative PCR reaction system

Real-time fluorescent quantitative PCR reaction step

After the reaction is finished, an amplification curve and a melting curve of the real-time fluorescence quantitative PCR are confirmed, and the expression intensity of each gene is normalized according to a CT value (threshold cycle values) and an internal reference Gene (GAPDH), and then a group t-test is adopted to calculate a P value.

1.8MTT cell proliferation assay

1) The cells obtained in the previous step were digested, counted by a cell counter, and the cells transfected with the empty vector of circRNF13 and pcdna3.1 were seeded in a 96-well plate with 1000 cells per well and 5 wells per cell, and the results were averaged.

2)37℃，5％CO₂The culture box is used for culturing for 6 hours, and after the cells are attached to the wall, 20 mu l of MTT solution (5mg/ml) is added into each hole. Incubation was continued for 4 hours, the culture was terminated, and the culture medium was discarded. Additional 150. mu.l DMSO was added to each well and the crystals were dissolved by shaking for 10 minutes.

3) The 490nm wavelength was selected, while setting the zero setting wells, and the absorbance values of each well were measured and recorded on an enzyme linked immunosorbent assay.

4) The procedure was repeated every 24 hours for a total of 6 days. And drawing an MTT curve by taking the absorbance value as a vertical coordinate and the interval time as a horizontal coordinate.

5) The experiment was repeated three times. And drawing a cell growth curve by taking each time point as an abscissa and the absorbance value as an ordinate.

1.9 flow cytometry analysis of cell cycle

1) When the cultured cells reach 85% fusion, the cells are digested by pancreatin, centrifuged at 1200rpm/min for 5min, and the cell precipitate is collected.

2)1xPBS resuspends the cells, 1200rpm/min, centrifuge for 5min, collect the cells. This step was repeated 2 times.

3)1xPBS resuspended cells and pre-cooled 70% ethanol was added to fix cells overnight.

4)1000rcf/min, 5min centrifugation, cell pellet collection.

5) PH7.4PBS cells were washed 1 time, centrifuged, and PBS was added to resuspend the cells and adjust the cell concentration to Ix 10⁶/ml。

6) Adding Propidium Iodide (PI) staining solution (containing 50mg/L PI,1g/L Triton X-100, 100g/L RNase), mixing, and incubating at 4 deg.C in dark for 30 min.

7) Flow cytometry FACStar (BD Co., USA) detection. The received signal was processed by Cellquest software to analyze the fluorescence intensity of the test cells. The experiment was repeated 3 times.

1.10 flow cytometry analysis of apoptosis Rate

1) When the cultured cells reached 85% confluence, each group of cells was digested with trypsin and collected in a centrifuge tube, and simultaneously each group of supernatant suspension cells was collected. Care was taken to blow the cells gently to avoid excessive digestion by pancreatin.

2) The cells of each group were pooled and transferred to a centrifuge tube, centrifuged at 1000rpm for 5min, the supernatant was discarded and the cells were collected, resuspended in PBS and counted.

3) Taking 5-10 ten thousand of resuspended cells, centrifuging for 5min at 1000rpm, discarding the supernatant, and adding 195ul annexin V-FITC binding solution to gently resuspend the cells.

4) Add 5ul Annexin V and mix gently. Incubate for 10min at room temperature in the dark.

5) Centrifuging at 1000rpm for 5min, discarding the supernatant, and adding 190ul Annexin V-FITC binding solution to gently resuspend the cells.

6) Add 10ul of PI staining solution, mix gently, ice-bath and avoid light.

7) Then, the detection is carried out by a flow cytometer, Annexin V-FITC is green fluorescence, and PI is red fluorescence.

2. Results

2.1circRNF13 inhibition of growth of tongue squamous cell carcinoma cells

After transfecting a circRNF13 eukaryotic expression vector, the expression of the circRNF13 in cells is detected by real-time fluorescent quantitative PCR (polymerase chain reaction), and the expression level of the circRNF13 is obviously increased (figure 3); after transfection of small interfering rna (sirna) targeting circRNF13, the expression level of intracellular circRNF13 was significantly down-regulated (fig. 4);

compared with cells transfected with an empty vector, the growth rate of the tongue squamous carcinoma cells Tca8113 and Cal27 overexpressing circRNF13 is remarkably reduced, while the growth rate of the cells is increased after the expression of circRNF13 is knocked down by using siRNA interference sequences (FIG. 5).

2.2circRNF13 inhibits growth of tongue squamous carcinoma cells by arresting the cell cycle, inducing apoptosis.

Flow cytometry analysis shows that the proportion of G2/M cells is remarkably increased and the proportion of S cells is reduced after circRNF13 is transfected in tongue squamous cell carcinoma cells, which shows that the circRNF13 can block the tongue squamous cell carcinoma cells in the G2/M stage, and the cell division is slowed down (figure 6). Meanwhile, the proportion of apoptotic cells was significantly increased after transfection of circRNF13 in tongue squamous cell carcinoma cells (fig. 7), which is also one of the reasons why circRNF13 inhibits growth of tongue squamous cell carcinoma cells. The opposite result was obtained by knocking down circRNF 13.

2.3circRNF13 Down-regulated expression in drug-resistant cells of tongue squamous cell carcinoma

We successfully induced cells that were cis-platin resistant to Tca8113 and Cal27 by increasing cis-platin concentration in the culture medium step by step over several months of culture, and detected the expression level of circRNF13 in the cells by real-time quantitative PCR, and found that the expression of circRNF13 in the resistant cell strain was significantly down-regulated compared to the original cell strain (FIG. 8).

2.4 overexpression of circRNF13 reverses the drug-resistant phenotype of tongue squamous cell carcinoma cells

After knocking down the expression of circRNF13 (si-circRNF13) in primary tongue squamous carcinoma cells (NC) or over-expressing the circRNF13(OE-circRNF13) in drug-resistant Cells (CR), the cells were treated with the same concentration of cisplatin, and then the apoptosis was examined by flow cytometry, it was found that knocking down the expression of circRNF13 could increase the resistance of the cells to cisplatin (apoptosis reduction), while over-expressing circRNF13 could significantly reduce the drug resistance of the drug-resistant cells (fig. 9).

Example 3 real-time fluorescent quantitative PCR assay confirming that circRNF13 is down-regulated in tongue squamous cell carcinoma

1. The material and the method are as follows:

28 tongue squamous carcinoma tissues and 28 tongue squamous carcinoma tissues are collected, total RNA is extracted, and after 1 mu g of RNA is subjected to reverse transcription to form cDNA, real-time fluorescence quantitative PCR is carried out. The forward primer of circRNF13 is 5-GTCCAGGATAGACATAGAGC-3 as shown in SEQ NO:2, and the reverse primer is 5-GTGTAGACTTGTGTGGCTGA-3. Shown as SEQ NO. 3.

The GAPDH forward primer used for the control was 5'-ACCACAGTCCATGCCATCAC-3' as shown in SEQ NO. 4 and the reverse primer 5'-TCCACCACCCTGTTGCTGTA-3' as shown in SEQ NO. 5.

Real-time fluorescent quantitative PCR reaction system

Real-time fluorescent quantitative PCR reaction step

After the reaction is finished, an amplification curve and a melting curve of the real-time fluorescence quantitative PCR are confirmed, and the expression intensity of each gene is normalized according to a CT value (threshold cycle values) and an internal reference Gene (GAPDH), and then a group t-test is adopted to calculate a P value.

2. Results

circRNF13 expression was higher in the paracarcinoma control tissue, while expression was significantly reduced in the tongue squamous carcinoma tissue by P <0.01 (fig. 10).

Example 4 in situ hybridization assays to find that low expression of circRNF13 in tongue squamous cell carcinoma correlates with poor patient prognosis

1. Material method

1.1 design and Synthesis of hybridization probes

In order to detect the expression of the circRNF13 by using an in situ hybridization method, 1 oligonucleotide probe and 3 oligonucleotide probes for in situ hybridization are designed for the circRNF13 circularization splicing sites (namely splicing positions of No. 2 exon and No. 8 exon of RNF13 gene).

Oligonucleotide probes for in situ hybridization detection of circRNF13 expression: TCGTTGTAAAATCACCTTTCTTGAATTTAT is as follows: shown in SEQ NO. 20, and has the sequence,

positive control probe (detection housekeeping gene GAPDH):

GAPDH probe 1: 5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3', as shown in SEQ NO:21,

GAPDH probe 2: 5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3', as shown in SEQ NO:22,

GAPDH probe 3: 5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3', as shown in SEQ NO: 23.

The designed gene-specific oligonucleotide probe sequences are synthesized by a chemical synthesis method.

1.2 oligonucleotide Probe labeling kit and in situ hybridization detection reagent

Digoxin oligonucleotide Tailing reagent (Dig oligonucleotide Tailing Kit 2)^ndGeneration, Roche corporation), Anti-Digoxigenin-POD (Anti-Digoxigenin-POD, Fabfragments, Roche corporation), TSA signal amplification system (TSA) for enhancing in situ expression detection signals^TMBiotin System, NEL700 kit, PerkinElmer company), DAB staining kit (Beijing Zhongshan company), 20 Xsodium citrate Buffer solution (SSC), Dextran sulfate (Dextran sulfate), Deionized Formamide (Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), polydeoxyadenylic acid (polydeoxyadenylic acid, Poly dA), denatured and sheared frog sperm DNA (denatured and sheared sperm DNA, ssDNA), yeast transport RNA (yeast-RNA, tRNA), Dithiothreitol (DTT), 50 Xdants Buffer solution (Denhardts's Buffer), phosphate Buffer solution (Buffer), pepsin K, bovine serum albumin (Tris), Triethanolamine (TEA), TNB Buffer (0.1M-HCl, 7.5, 0.15.5, 0.5% pH 1.5, 0.5% Na-5 CL, 0.5% Na-5, 0.5% HCl, 0.05% Na-20M-5, 0.05% HCl, blocking reagent (Blocking reagent agent, Roche).

1.3 other major reagents and materials

Absolute ethyl alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turpentine, double distilled water, PBS buffer solution (pH7.2-7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na₂HPO₄4.3mmol/L，KH₂PO₄1.4 mmol/L); 3% methanol-hydrogen peroxide solution (prepared by 80% methanol and 30% hydrogen peroxide); 0.01mol/L citrate buffer (citrate buffer, CB, pH6.0 + -0.1, 9ml of 0.1M citric acid solution and 41ml of 0.1M sodium citrate solution are added to 450ml of distilled water for temporary configuration and then the pH value of the working solution is corrected); 0.1% trypsin; hematoxylin; 1% hydrochloric acid alcohol (1ml concentrated hydrochloric acid +99ml 70% alcohol); mounting glue (PTS Cure Mount II); special cover glass (480 is multiplied by 240 mm)²) Customized to Zhengzhou glass instrument factories. Leica low melting point (58 ℃) paraffin, domestic beeswax, absolute alcohol, xylene, 10% neutral paraformaldehyde (0.01mol/L, pH7.4, prepared from DEPC double distilled water and PBS buffer), hematoxylin, eosin, neutral mounting gum, a cover slip and a glass slide.

1.4 labeling of probes

The 3-labeling DIG Olignucleutide Kit is used for carrying out oligonucleotide probe labeling, and the reaction system is as follows.

100pmol oligonucleotide+ddH₂O＝9μl(control:control oligonucleutide 5μl+ddH₂O4μl)

Mix well and centrifuge slightly. The reaction was carried out in a water bath at 37 ℃ for 30min, and stopped by adding 2. mu.l of EDTA (0.2M, pH 8.0).

1.5 purification after labeling of oligonucleotide probes

In order to increase the purity of the labeled probe, the labeled probe needs to be purified, and the specific operations are as follows:

1) probe reaction mixture (22. mu.l) + 2.5. mu.l 4M LiCl + 75. mu.l 100% cold ethanol (-20 ℃).

2) Precipitating at-70 deg.C for 60min, or-20 deg.C for 2 h.

3) Centrifuge at 13.000Xg for 15min at 4 ℃.

4) The supernatant was discarded and washed with 50. mu.l of ice-cold 70% (V/V) ethanol.

5) Centrifuge at 13.000Xg 4 ℃ for 5 min.

6) The supernatant was discarded and dried under vacuum at 4 ℃.

7) The probe was reconstituted with sterile double distilled water.

1.6 in situ hybridization detection of expression of circRNF13 in archived paraffin sections

Pretreatment of paraffin section hybridization

1) The paraffin sections preserved at 4 ℃ are placed in a baking oven at 58 ℃ for 30min, and the paraffin on the surface is melted.

2) The xylenes were dewaxed for 3X5min in sequence.

3) Stepwise alcohol washing, 100% alcohol 2 × 2min → 95% alcohol 1 × 5min → 70% alcohol 1 × 5min → 50% alcohol 1 × 5min → DEPC water washing 2 × 3min → DEPC-PBS washing 2 × 5 min.

4) Mu.l pepsin K (10. mu.g/ml) was added dropwise to the sections and digested at 37 ℃ for 20 min.

5) The sections were washed in PBS (0.1M PBS +2mg/ml glutamic acid) for 1min and the reaction was stopped.

6) Slicing into 0.2N HCl, reacting at 37 deg.C for 20-30min to increase tissue permeability.

7) Sections were fixed with 4% paraformaldehyde (0.1M in PBS) for 10min at room temperature.

8) To increase the intensity of positive hybridization of the tissue, the sections were treated with acetyl. The sections were taken in 0.25% acetic anhydride Buffer I (0.1M triethanolamine) at room temperature for 10 min.

9) Wash 2X 5min in 1M PBS.

Prehybridization and hybridization

Pre-hybridization: pre-hybridization solution stored at-20 ℃ is incubated at 37 ℃ for 60min, the dosage of the pre-hybridization solution is 50 mu l, the parafilm covered slice is pre-hybridized for 2 hours in a wet box at 37 ℃. (the prehybridization solution components included 2XSSC, 10% dextran sulfate, 1 XDenhardt's solution, 50mM phospate Buffer (pH 7.0), 50mM DTT, 250. mu.l, 100. mu.g/ml poly A, 5. mu.g/ml poly dA, 250. mu.g/ml yeast-RNA, 500. mu.g/ml ssDNA, 47% Deionized formamide).

1) The parafilm was removed, the prehybridization solution was spun off, and the sections were placed in 2XSSC for 5 min.

2) And (3) hybridization reaction: hybridization was carried out at 37 ℃ overnight (18-20 h). Mu.l of hybridization solution was added to each section and covered with parafilm. Adding corresponding probes into the pre-hybridization solution to obtain a hybridization solution. The hybridization solution is prepared during pre-hybridization, and is placed at 37 ℃ for incubation, so that the probes are fully dissolved in the hybridization solution, a plurality of oligonucleotide probes are mixed in the experiment, and the probe hybridization solution is prepared according to the concentration of 500ng/ml of each probe. The concentration of the labeled probe of the digoxin tailing labeling kit is calculated according to the following steps: the concentration of each probe is compared according to the color development of the probe during the detection reaction when the probe is positively quantified, and the concentration of the labeled probe is comprehensively calculated according to two standards of the theoretical probe yield of 900ng of the naked probe labeling reaction with 100pmol of 30 basic groups.

3) After hybridization, the sections were washed, immersed in 2XSSC for 10min, and the parafilm was removed. Washed sequentially in a shaker with shaking, 2XSSC (0.5% SDS), 2X 15min → 0.25 XSSC (0.5% SDS), 2X 15 min.

Post-hybridization chromogenic detection reaction

1) Detecting a digoxin probe and mRNA binding complex by adopting Anti-Digoxigenin-POD; the TSA amplification system enhances a positive signal of in-situ hybridization reaction chromogenic reaction, and DAB chromogenic reaction is carried out.

2) The sections were transferred to TNT buffer for 3X5 min.

3) TNB blocking buffer, 300. mu.l/TMAs, was added dropwise at room temperature for 30 min.

4) Excess blocking agent was aspirated, and Anti-Digoxigenin-POD (TBS + 0.1% Triton X-100+ 1% blocking agent) diluted 1:100 was allowed to stand at room temperature for 4 hours.

5) TNT Buffer (0.1M Tris-CL, pH7.5, 0.15M NaCL, 0.05% Tween 20) wash, 3X5 min.

6) The signal amplification reagent Biotinyl Tyamid, 300. mu.l/TMAs, (Biotinyl Tyramid stock solution: biotinyl tyramide was dissolved in 0.2ml DMSO, Biotinyl tyramide working solution: 1 XDilute, 1:50 Biotinyl Tyramid stock), 10 minutes at room temperature.

7) TNT wash, 3X5 min.

8) The sections were added dropwise with SA-HRP (streptavidin-horseradish peroxidase), 300. mu.l/TMAs, at room temperature for 30 min.

9) TNT wash, 3X5 min.

10) Distilled water for washing, 1 × 1 min.

11) DAB color development, and color development reaction is controlled under a microscope.

12) The hematoxylin is counterstained by the hematoxylin,

13) dehydrating with alcohol step, slicing and drying.

14) And (4) dropwise adding a mounting adhesive, covering a cover glass with a corresponding specification, and crosslinking and slicing for 1min under an ultraviolet lamp.

1.7 results determination and Standard

Observing under a low-power microscope and a high-power microscope respectively, and firstly, observing the positioning of a positive expression signal of target RNA in an observation target cell: located in the nucleus, cytoplasm or cell membrane.

And then carrying out comprehensive scoring by respectively using two standards of the strength of the positive signal of the RNA expression part and the number of the positive expressed cells, wherein the judgment standard is as follows: (1) judging according to the staining intensity of the positive cells: a. the cells were not stained, score 0; b. staining the cells to light brown as weak positive, and scoring 1; c. cells stained brown with no background staining, or cells stained dark brown with light brown background as medium positive, scoring 2 points; d. cells stained dark brown and strongly positive with no background staining, scored 3. (2) Scoring by positive cell expression number: a. no positive cell expression, score 0; b. the number of positive expression cells is less than or equal to 25 percent, and the score is 1; c.25% < number of positive cells < 50%, score 2; d. the number of positive expression cells is more than or equal to 50%, and 3 points are taken.

In order to reduce subjective factors of scoring results as much as possible, two pathology experts respectively judge and score according to one of the standards, and then the two scores are multiplied, wherein the result is that ① 0 scores are finally counted as 0 and considered as negative expression, ② 1 scores and 2 scores are finally counted as 1 and considered as weak positive expression, ③ 3 scores and 4 scores are finally counted as 2 and considered as medium positive expression, and ④ 6 scores to 9 scores are finally counted as 3 and considered as strong positive expression.

1.8 analytical and statistical software

Statistical analysis is carried out on the experimental results by using SPSS13.0 statistical software, and Chi is used for pairwise comparison²test or Fisherexact test, and the correlation analysis adopts a Spearmen correlation method; if P is less than 0.05, the difference is statistically significant. The survival curve analysis adopts Kaplan-Meier method and log-rank test; adopting Cox' sporadic hazards model for multivariate analysis; if P is less than 0.05, the difference is statistically significant.

2 results

2.1 expression of circRNF13 in tongue squamous cell carcinoma was significantly elevated compared to normal control tissue

circRNF13 was not expressed or was expressed at a low level in the tongue squamous carcinoma tissues, but was expressed in the paratongue squamous carcinoma normal control tissues (fig. 11), with a clear statistical difference between the two. This is consistent with real-time fluorescent quantitative PCR detection.

2.2 patients with squamous cell carcinoma of the tongue with low circRNF13 expression had a worse prognosis

The 88 patients with squamous cell carcinoma were followed by telephone, and their first-onset time, treatment condition, presence or absence of recurrence, presence or absence of other diseases, recurrence and death time were inquired in detail, and the survival time and status were registered, and by analyzing the expression of circRNF13 in the squamous cell carcinoma tissue and the survival time and status of the patients, it was found that the average survival time of the patients not expressing circRNF13 in the squamous cell carcinoma tissue was significantly shorter than that of the patients with higher expression of circRNF13 (fig. 12). The circRNF13 is a molecular marker related to the prognosis of tongue squamous cell carcinoma, and the circRNA is low or not expressed, so that the prognosis of patients is poor.

Sequence listing

<110> university of south-middle school

<120> application of reagent for detecting circular RNA circRNF13 in preparation of prognosis preparation for tongue squamous cell carcinoma patient

<160>23

<170>SIPOSequenceListing 1.0

<210>1

<211>716

<212>RNA

<213> Intelligent (Homo sapiens)

<400>1

gugauuuuac aacgagaugc ugcucuccau agggaugcuc augcugucag ccacacaagu 60

cuacaccauc uugacugucc agcucuuugc auucuuaaac cuacugccug uagaagcaga 120

cauuuuagca uauaacuuug aaaaugcauc ucagacauuu gaugaccucc cugcaagauu 180

ugguuauaga cuuccagcug aagguuuaaa ggguuuuuug auuaacucaa aaccagagaa 240

ugccugugaa cccauagugc cuccaccagu aaaagacaau ucaucuggca cuuucaucgu 300

guuaauuaga agacuugauu guaauuuuga uauaaagguu uuaaaugcac agagagcagg 360

auacaaggca gccauaguuc acaauguuga uucugaugac cucauuagca ugggauccaa 420

cgacauugag guacuaaaga aaauugacau uccaucuguc uuuauuggug aaucaucagc 480

uaauucucug aaagaugaau ucacauauga aaaagggggc caccuuaucu uaguuccaga 540

auuuagucuu ccuuuggaau acuaccuaau ucccuuccuu aucauagugg gcaucugucu 600

caucuugaua gucauuuuca ugaucacaaa auuuguccag gauagacaua gagcuagaag 660

aaacagacuu cguaaagauc aacuuaagaa acuuccugua cauaaauuca agaaag 716

<210>2

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>2

gtccaggata gacatagagc 20

<210>3

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>3

gtgtagactt gtgtggctga20

<210>4

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>4

accacagtcc atgccatcac 20

<210>5

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>5

tccaccaccc tgttgctgta 20

<210>6

<211>24

<212>DNA

<213> Unknown (Unknown)

<400>6

gctagaagaa acagacttcg taaa 24

<210>8

<211>24

<212>DNA

<213> Unknown (Unknown)

<400>8

ctaatgaggt catcagaatc aaca 24

<210>8

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>8

aatgttgatt ctgatgacct20

<210>9

<211>21

<212>DNA

<213> Unknown (Unknown)

<400>9

agattgtgta gacttgtgtg g 21

<210>10

<211>45

<212>DNA

<213> Unknown (Unknown)

<400>10

gtgctgggat tacaggtgtg agctaccacc cccggcccac ttttt 45

<210>11

<211>47

<212>DNA

<213> Unknown (Unknown)

<400>11

gaaaagaatt aggctcggca cggtagctca cacctgtaat cccagca 47

<210>12

<211>177

<212>DNA

<213> Unknown (Unknown)

<400>12

gtgctgggat tacaggtgtg agctaccacc cccggcccac tttttcttaa gcttggtacc 60

gagctcggat ccacatcgat tggtggaatt ctgcagatat ccaccgcggt ggcggccgct 120

cgagtctaga gaaaagaatt aggctcggca cggtagctca cacctgtaat cccagca 177

<210>13

<211>5515

<212>DNA

<213> Unknown (Unknown)

<400>13

gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60

ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120

cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180

ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240

gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300

tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360

cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540

atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600

tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660

actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720

aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780

gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840

ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900

gtgctgggat tacaggtgtg agctaccacc cccggcccac ttttttttaa acttaagctt 960

ggtaccgagc tcggatccac atcgattggt ggaattctgc agatatccac cgcggtggcg1020

gccgctcgag tctagagaaa agaattaggc tcggcacggt agctcacacc tgtaatccca 1080

gcagggcccg tttaaacccg ctgatcagcc tcgactgtgc cttctagttg ccagccatct 1140

gttgtttgcc cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt 1200

tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg 1260

ggtggggtgg ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg 1320

gatgcggtgg gctctatggc ttctgaggcg gaaagaacca gctggggctc tagggggtat 1380

ccccacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg 1440

accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc 1500

gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga 1560

tttagtgctt tacggcacct cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt 1620

gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat 1680

agtggactct tgttccaaac tggaacaaca ctcaacccta tctcggtcta ttcttttgat 1740

ttataaggga ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa 1800

tttaacgcga attaattctg tggaatgtgt gtcagttagg gtgtggaaag tccccaggct 1860

ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc aggtgtggaa 1920

agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa 1980

ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt 2040

ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctctgcct 2100

ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt tgcaaaaagc 2160

tcccgggagc ttgtatatcc attttcggat ctgatcaaga gacaggatga ggatcgtttc 2220

gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat 2280

tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt 2340

cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac 2400

tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg 2460

tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc 2520

aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa 2580

tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc 2640

gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg 2700

aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg 2760

acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa 2820

atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg 2880

acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct 2940

tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc 3000

ttgacgagtt cttctgagcg ggactctggg gttcgaaatg accgaccaag cgacgcccaa 3060

cctgccatca cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat 3120

cgttttccgg gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt 3180

cgcccacccc aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac 3240

aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat 3300

caatgtatct tatcatgtct gtataccgtc gacctctagc tagagcttgg cgtaatcatg 3360

gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc 3420

cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc 3480

gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat 3540

cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac 3600

tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 3660

aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 3720

gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 3780

ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 3840

ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 3900

gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 3960

ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 4020

cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 4080

cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 4140

gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag 4200

aagaacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg 4260

tagctcttga tccggcaaac aaaccaccgc tggtagcggt ttttttgttt gcaagcagca 4320

gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 4380

cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 4440

cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 4500

gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 4560

tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 4620

gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 4680

agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 4740

tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 4800

agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 4860

gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 4920

catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 4980

ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 5040

atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 5100

tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 5160

cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 5220

cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 5280

atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 5340

aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta 5400

ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 5460

aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtc 5515

<210>14

<211>18

<212>DNA

<213> Unknown (Unknown)

<400>14

gtgattttac aacgagat 18

<210>15

<211>18

<212>DNA

<213> Unknown (Unknown)

<400>15

ctttcttgaa tttatgta 18

<210>16

<211>28

<212>DNA

<213> Unknown (Unknown)

<400>16

aggaatcgat gtgattttac aacgagat 28

<210>17

<211>28

<212>DNA

<213> Unknown (Unknown)

<400>17

atgcccgcgg ctttcttgaa tttatgta 28

<210>18

<211>21

<212>RNA

<213> Unknown (Unknown)

<400>18

agaaagguga uuuuacaacg a 21

<210>19

<211>19

<212>RNA

<213> Unknown (Unknown)

<400>19

gacacgcgac uuguaccac 19

<210>20

<211>30

<212>DNA

<213> Unknown (Unknown)

<400>20

tcgttgtaaa atcacctttc ttgaatttat 30

<210>21

<211>30

<212>DNA

<213> Unknown (Unknown)

<400>21

ccactttacc agagttaaaa gcagccctgg 30

<210>22

<211>30

<212>DNA

<213> Unknown (Unknown)

<400>22

cagtagaggc agggatgatg ttctggagag 30

<210>23

<211>30

<212>DNA

<213> Unknown (Unknown)

<400>23

gtcagaggag accacctggt gctcagtgta 30

Claims (4)

1. The application of the reagent for detecting the circular RNA circRNF13 in preparing the preparation for the prognosis of the tongue squamous cell carcinoma patient is disclosed in the specification, wherein the sequence of the circular RNA circRNF13 is shown in SEQ NO:1, and the reagent for detecting the circular RNA circRNF13 is a real-time fluorescent quantitative detection reagent.

2. The use of claim 1, wherein the real-time fluorescence quantitative detection reagent comprises a primer sequence for real-time fluorescence quantitative detection of the expression of circRNF13 in tongue squamous carcinoma tissues:

a forward primer: 5-GTCCAGGATAGACATAGAGC-3, and the main components are as follows,

reverse primer: 5-GTGTAGACTTGTGTGGCTGA-3.

3. The use of claim 2, wherein the real-time fluorescent quantitative detection agent is a kit.

4. The use of claim 3, wherein the kit further comprises:

internal reference gene GAPDH specific PCR primers:

a forward primer: 5'-ACCACAGTCCATGCCATCAC-3'

Reverse primer: 5'-TCCACCACCCTGTTGCTGTA-3' are provided.

Images