CN113215195B

CN113215195B - Recombinant expression vector for high-expression SIA in myogenic cell specificity and application thereof

Info

Publication number: CN113215195B
Application number: CN202110483409.3A
Authority: CN
Inventors: 王刚; 邓璐; 谢丽芳; 卢宛翎; 李彩侠; 刘明
Original assignee: Sichuan University; Chengdu Institute of Biology of CAS
Current assignee: Sichuan University; Chengdu Institute of Biology of CAS
Priority date: 2021-04-30
Filing date: 2021-04-30
Publication date: 2023-04-11
Anticipated expiration: 2041-04-30
Also published as: CN113215195A

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a recombinant expression vector for specifically and highly expressing SIA in myogenic cells and application thereof. The recombinant expression vector promoter is P _EMS The nucleotide sequence is shown as SEQ ID NO. 1; the nucleotide sequence for coding SIA is shown in SEQ ID NO. 2. The invention uses flexible peptide (GGGGS) 3 to replace C peptide to modify proinsulin to obtain high-activity single-chain insulin analogue SIA, and adopts an enhanced muscle specific promoter P _EMS Regulating the expression of SIA and realizing that the high-activity single-chain insulin analogue SIA is specially used in skeletal muscle cellsThe heterosexual high-efficiency expression and secretion are carried out outside the cells and enter a blood circulation system, so that the effect of effectively reducing blood sugar is achieved, and unnecessary side effects caused by ectopic expression are avoided. The recombinant expression vector can be used for preparing a medicament for treating type I diabetes.

Description

Recombinant expression vector for specifically and highly expressing SIA in myogenic cells and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a recombinant expression vector for specifically and highly expressing SIA in myogenic cells and application thereof.

Background

Diabetes is a disease in which the blood sugar level in the body is high due to disorder of glucose metabolism, and is greatly influenced by genetic factors and environmental factors. With the development and progress of society and economy, the life style and eating habits of people are greatly changed, and the number of diabetics is gradually increased. Diabetes is generally classified into type 1 and type 2 diabetes. Type 1 diabetes is an autoimmune disease, usually developed in adolescents, and its pathogenesis is mainly that the beta cell component of pancreatic islets is mistakenly recognized as antigen by immune system and destroyed, so that the insulin in vivo is absolutely deficient, and further glucose metabolism disorder and blood sugar rise are caused.

Insulin is the only effective drug for treating type 1 diabetes at present, but long-term subcutaneous injection is easy to cause pain, skin infection, subcutaneous blood stasis and the like, and is easy to cause the weight gain of patients due to the promotion of fat synthesis; on the other hand, the blood glucose spectrum of type 1 diabetic patients is characterized by large fluctuation, because it is difficult to accurately and flexibly adjust the dosage when the patients inject insulin independently, and fluctuating hyperglycaemia and hypoglycaemia are easily caused. To solve this problem, there are many new ideas: 1. islet beta cell replacement: human whole pancreas or islet transplantation, genetically engineered insulin secreting cells, bioartificial pancreas; 2. an automatic insulin delivery device; 3. somatic gene therapy; 4. convert islet alpha cells to islet beta cells, and so on.

People with type 1 diabetes need to be infused with insulin for a long time, repeatedly and frequently (mostly once a day), and the curative effect is definite, but inconvenience and discomfort are brought to the patients. Compared with the operations such as islet transplantation, islet cell reprogramming and the like, the gene therapy has the advantages of simplicity in operation, low cost, high universality and the like. Therefore, effective gene therapy for type 1 diabetes has been an important research direction of great interest.

The gene therapy is that after the target gene segment is cloned in vitro and an expression vector is constructed, the expression vector carrying exogenous genes is transferred into cells by a special transfer method, the expression of target proteins is completed in the cells, and the corresponding physiological action is exerted at specific sites inside or outside the cells, so that the exogenous target genes replace mutated/deleted genes to realize the functional recovery, thereby achieving the purposes of disease alleviation and treatment.

The gene therapy system mainly has three key links, which respectively comprise (1) functional genes: the correct target gene is selected as the therapeutic gene according to the pathogenesis of the disease. The therapeutic gene for type 1 diabetes is mainly insulin gene. (2) Gene delivery: since gene therapy requires the delivery of foreign expression vectors into organisms, the selection of an optimal gene delivery system is critical for the efficient introduction of foreign genes into target sites in organisms. (3) Gene expression: after delivery of the exogenous gene to the target tissue, organ or cell, it is necessary to ensure that the exogenous gene is expressed specifically and efficiently at that site, i.e., that the expression product is present in sufficient quantity to produce effective biological function, while avoiding unwanted side effects resulting from ectopic expression.

Under physiological conditions, proinsulin (proinsulin) transcribed and translated from an insulin gene is a single-chain precursor peptide containing a B chain, a C peptide and an A chain, the C peptide needs to be cut off by specific enzyme in an islet beta cell, and mature insulin is formed between the A chain and the B chain through two disulfide bonds so as to play a physiological role. The C peptide has a long and rigid structure, and affects the exertion of insulin activity, and the activity of proinsulin without C peptide cleavage is only 5% of that of mature insulin. The system for cleavage of the C peptide from proinsulin is unique to pancreatic beta cells, meaning that it is difficult to obtain mature insulin with high activity when exogenous insulin genes are attempted to be expressed in non-pancreatic beta cells, such as liver and muscle tissue.

Therefore, there is a need to explore a more effective molecular tool for the treatment of diabetes.

Disclosure of Invention

The invention aims to provide a recombinant expression vector for specifically and highly expressing SIA in myogenic cells and application thereof, wherein the recombinant expression vector is specifically and efficiently expressed in skeletal muscle parts, and on one hand, sufficient SIA can be expressed to effectively reduce blood sugar; on the other hand, the unnecessary side effect caused by ectopic expression can be avoided.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides a recombinant expression vector for high-specifically expressing SIA in myogenic cells, wherein the promoter of the recombinant expression vector is P _EMS The nucleotide sequence is shown as SEQ ID NO.1, and the nucleotide sequence of SIA is shown as SEQ ID NO. 2.

The invention also provides a construction method of the recombinant expression vector, which comprises the following steps:

amplifying an EMS fragment from the plasmid pGL3-EMS-Luc, wherein the nucleotide sequence of the plasmid pGL3-EMS-Luc is shown as SEQ ID NO. 3;

carrying out double enzyme digestion on the plasmid pCMV-SIA, and connecting the part from which the CMV fragment is removed with the EMS fragment obtained by amplification to obtain a recombinant expression vector pEMS-SIA; the nucleotide sequence of the plasmid pCMV-SIA is shown as SEQ ID NO. 4.

Further, the primer sequences for amplifying the EMS fragment are respectively as follows:

EMS-F:5’-CGACGCGTTTGATGTACTGCCAAGTTGGAAAGTC-3’；

EMS-R:5’-CTAGCTAGCTAGGGAAACCTGAAGCCGGCA-3’。

the invention also provides the recombinant expression vector and application of the recombinant expression vector constructed by the method in preparation of drugs treating diabetes.

Further, the diabetes is type 1 diabetes.

Compared with the prior art, the invention has the following advantages:

flexible peptide (GGGGS) is used in the present invention ₃ The proinsulin is modified by replacing C peptide to obtain a high-activity Single-chain Insulin Analogue (SIA), and an enhanced muscle-specific promoter P is adopted _EMS The expression of the SIA is regulated, so that the high-activity single-chain insulin analogue SIA is specifically and efficiently expressed at the skeletal muscle part and secreted to the outside of a cell, the effect of effectively reducing blood sugar is achieved, and unnecessary side effects caused by ectopic expression are avoided. The recombinant expression vector can be used for preparing a medicament for treating type I diabetes.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1 SIA expression levels in different cells after transient transfection: respectively transfecting a mouse myoblast C2C12, a rat myoblast L6 and a human embryo kidney cell HEK293 with plasmids pCMV-SIA and pEMS-SIA, and detecting the expression of SIA in a supernatant (cell culture medium) and a cell lysate by an ELISA method after 48 hours; each group N =3.

FIG. 2 shows that SIA promotes glucose uptake by cells. Respectively transfecting 293T cells with a plasmid pEGFP-C1 (blank group), a plasmid pCMV (Mock group) and a plasmid pCMV-SIA (experimental group), taking cell supernatant (containing secreted SIA), adding the cell supernatant into a C2C12 cell culture medium, and detecting the glucose uptake condition of the cells; each group N =5.

FIG. 3 measures the binding ability of SIA to insulin antibodies: respectively transfecting 293T cells with a blank group plasmid pEGFP-C1, a Mock group plasmid pCMV and an experimental group plasmid pCMV-SIA, taking cell supernatant, combining with a mouse insulin antibody, and detecting the combining capacity; each group N =5.

Figure 4 mouse modeling detection plots: e, C peptide detection in blood of the modeling and unmodeled groups is carried out, 8C peptides in each group are not detected in the blood of the modeling group, and success of modeling is indicated; A. b is an HE staining chart of pancreas of an unmodeled group; C. d is a mouse pancreas HE staining chart of a modeling group.

FIG. 5 is a graph showing the blood glucose level detection of each group of mice.

FIG. 6 is a graph showing the weight, diet and drinking of mice in each group.

Figure 7 is a graph of glucose tolerance IPGTT detection at different times for each group of mice.

FIG. 8 is a graph showing the serum insulin levels at different times in each group of mice.

FIG. 9 is a graph of the model of each group of mice and the analysis of survival after treatment.

FIG. 10 histological analysis (H & E staining) of mouse liver and pancreas: 100-fold and 400-fold pictures are collected in an observation area, wherein A is a normal group, and B is an experimental group.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of the stated features, steps, operations, and/or combinations thereof, unless the context clearly indicates otherwise.

In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.

L6 rat myoblasts (rat myoblasts), C2C12 mouse myoblasts (mouse myoblasts), 293T human embryonic kidney cells (human embryo kidney cells), all purchased from the cellular resource center of the Shanghai Life sciences research institute of Chinese academy of sciences. The formulations of the reagents used are shown in table 1 below.

TABLE 1 reagent formulations

Table 1 Reagent formulation

Example 1

Searching mouse insulin gene (NCBIID: NM-008386.4) in NCBI, downloading the gene sequence, analyzing the nucleic acid sequences of signal peptide, insulin B chain, insulin A chain, insulin C peptide and other portions, and deleting the sequence of C peptide and substituting it with a flexible peptide (GGGGS) ₃ And (3) adding enzyme cutting sites at both ends of the whole DNA chain. The designed sequence was subjected to structure prediction analysis using SWISS-MODEL and visualization analysis using VMD. Subsequently, the plasmid pUC57 was cloned and DNA sequence was synthesized by Onychoma and checked for sequencing to ensure that the synthesized sequence was completely accurate. The SIA sequence is shown in SEQ ID NO. 2.

The flexible peptide (GGGGS) 3 is adopted to replace a relatively long and rigid C peptide to connect insulin A and B chains, and the short chain length between insulin B29 and insulin A1 has certain influence on the activity of the insulin, so that the structure of the insulin is predicted and visually analyzed, and the insulin is structurally compared with proinsulin and insulin (PDBID: 2 jzq). As a result, SIA is found to contain 6 Cys (Cys 7, cys19, cys51, cys52, cys56, cys 65) and can form three key disulfide bond structures (Cys 7-Cys52, cys51-Cys56, cys19-Cys 65) of insulin, wherein two of the disulfide bond structures are between A and B chains (Cys 7-Cys52, cys19-Cys 65) and one is in the A chain (Cys 51-Cys 56). (GGGGS) ₃ linker attachment did not affect the formation of these disulfide bonds and overcome the verbosity and rigidity of C-peptide. Equally important is the finding that the overall structure of SIA is closer to that of insulin than proinsulin, and that the structure is more flexible and flexible between closed and openThe linker region and the three alpha helices form enough space between the structures to fully expose the Phe24 site of the B chain and its surrounding region, which are closely related to insulin activity, to facilitate binding to the insulin receptor, which is critical to insulin activity.

Plasmid constructs are shown in table 2 below.

TABLE 2

Construction of plasmid pEMS-SIA:

amplifying an EMS fragment from pGL3-EMS-Luc, selecting MluI as an upstream enzyme cutting site, 5 '-information of CGACGCGTTTGATGTACTGCCAAGTTTGGAAAGTC-3' as an EMS-F, 5 '-information of CTAGCTAGCTAGGGAAACCTGAAGCCCGGCA-3' as a downstream enzyme cutting site, double-enzyme cutting the amplified gene fragments EMS and pCMV-SIA by MluI and NheI, removing CMV, and connecting into EMS to obtain pEMS-SIA. The enzyme digestion and ligation were performed as described in the specification.

Construction of plasmid pCMV-SIA-his:

taking pCMV-SIA as a template, selecting BamHI, SIA-F: 5-. The digestion and ligation were performed as described in the specification.

Construction of prokaryotic expression plasmid pET-28a (+) -SIA:

the pCMV-SIA is taken as a template, and an upstream primer adopts NcoI, infusion-pET28-SIA-F: AACTTTAAGAAGGAGATATACCATGGGCATTATGGCCCTGTTGGGTGCACT, downstream primer selects EcoR I,

Infusion-pET28-SIA-R CAGTGGTGGTGGTGGTGGTGCTCGAGTTAGTGATGATGATGATGGTTGCAGTAGTTCTCCAGCTGGT, double digestion of pET-28a (+) with NcoI and EcoR I, and ligation of SIA by homologous recombination method, to obtain pET-28a (+) -SIA. The enzyme digestion and connection system is completely according to the standard system of the specification.

ELISA detection of cell-expressed SIA

(1) Preparation work:

A. all reagents and samples were left at room temperature (18-25 ℃) prior to use.

Assay Diluent B was diluted 5-fold with deionized or distilled water prior to use. 60mL of ultrapure water was added to 15mL of Assay Diluent B to obtain 1 × Assay Diluent B.

C. Assay dilution C was applied to dilute serum, plasma and cell culture supernatant samples. Heparin is not recommended for use as an anticoagulant in this experiment. The insulin levels varied from sample to sample, and the optimal dilution factor was determined for each sample.

D. 400 μ L of diluent C was added to a vial of lyophilized standard to give 1400 μ IU/mL standard solution. mu.L of the sample solution was removed from 1400. Mu.IU/mL, 450. Mu.L of diluent C was added to give 630. Mu.L of the sample solution 400. Mu.IU/mL, and the sample solution 400. Mu.IU/mL was diluted in a gradient.

E. The 20 XWash Buffer was diluted with ultrapure water to give a1 XWash Buffer. If a 20 × Wash Buffer contains visible crystals, warm to room temperature and mix gently until dissolved.

F. To the biotinylated antibody concentrate was added 1 × Assay Diluent B to dilute 80-fold. Mix gently (concentrate can be stored at 4 ℃ for 5 days).

G. HRP reagent was diluted 400-fold with 1 × Assay Diluent B prior to use. A1 XTP Streptavidin solution was obtained and used as is.

(2) Measurement procedure

B. The 100uL of the serially diluted standards and samples were added to the well plate, respectively, and incubated at room temperature for 2.5 hours.

C. The solution in the well plate was discarded and washed 4 times with 1 × Wash Buffer.

D. 100 μ L of antibody was added to each well. Gently shake for 1 hour at room temperature.

E. And C, repeating the step C.

F. To each well was added 100. Mu.L of 1 × HRP Streptavidin solution. Incubate for 45 minutes at room temperature.

G. And D, repeating the step C.

H. 100. Mu.L of a color developing solution was added. Incubate for 30 minutes at room temperature in the dark, gently shake.

I. 50uL of stop solution was added to each well.

J. OD values of wells of the microplate were measured at a wavelength of 450nm or 550nm using a microplate reader (BioTek) within 30 minutes of the addition of the stop solution.

K. And (3) calculating the result: a standard curve is established by the mean OD value of each standard concentration of insulin and the corresponding insulin concentration, and the amount of insulin contained in the sample is determined by the standard curve.

The expression of SIA in the cell culture medium and the cell lysate is detected by an ELISA method, and the data show that pEMS-SIA has higher SIA expression (p is less than 0.001) than pCMV-SIA in myoblasts C2C12 and L6, and in the cell lysate and the supernatant; in HEK293 cells, the results were reversed, with higher pCMV-SIA expression (p < 0.001), as shown in FIG. 1. Meanwhile, from the absolute expression amount of SIA, although the expression amount of pCMV-SIA in HEK293 is remarkably superior in three cells, the expression amount of pEMS-SIA in myogenic cells C2C12 and L6 is significantly higher than that in HEK293 (348.2 and 347.3vs 275.9 and 209.5 and 216.1vs 139.0). These results indicate that pEMS-SIA can specifically express SIA at high levels in myogenic cells.

Experiment of SIA promoting phagocytosis of glucose analog molecules by cells

HEK293 cells were seeded in 6-well plates and transfected with pCMV-SIA and pcDNA3.1 (+) plasmids, respectively, with the pEGFP-C1 plasmid as a control. At the same time, C2C12 cells were seeded in 96-well plates.

After 24-48h, the C2C12 cell medium was aspirated, rinsed with 100uL PBS, and then subjected to 2h of C2C12 cell glucose starvation experiments with DMEM medium containing 2.5nM glucose. Subsequently, the cells were divided into blank, SIA experimental and Mock groups, each group having 5 wells. Wherein 100uL of HEK293 cell culture medium supernatant after transfection of pCMV-SIA and pcDNA3.1 (+) is added into the SIA experimental group and the Mock group, and 100uL of normal DMEM medium is added into the blank group.

2-NBDG is a glucose analog molecule and can be autofluorescent, and can be used for conveniently and quantitatively analyzing the ability of cells to phagocytose glucose. 0.15mg of 2-NBDG was weighed out in the dark, and DMSO (15 uL) was added to prepare a 10mg/mL stock solution. Storing at-20 deg.C. 5uL of the mother solution was added to 1.5mL of DMEM medium to prepare a concentration of 0.033 mg/mL. Adding 100uL into each well of a 96-well plate in a dark place, and placing the 96-well plate into a carbon dioxide incubator to incubate for 40min in a dark place. The plates were then rinsed 2 times with PBS, photographed using an inverted fluorescence microscope and immediately detected using a microplate reader, excitation/emission wavelengths of 488nm/520nm, respectively.

As can be seen from FIG. 2, the ability of the experimental group to phagocytose 2-NBDG was higher than that of the blank group and the unloaded group (1218.6 vs 641.8 and 639.6).

Detection of binding Capacity of cell-expressed SIA to antibody

1.1 cell preparation

1) Cells HEK293 were seeded evenly in 6-well plates and cultured overnight.

2) HEK293 was transiently transfected with plasmid pCMV-SIA and after 24h the supernatant was harvested, simultaneously with pEGFP-C1 and pcDNA3.1 (+) plasmids as controls.

1.2ELISA plate coating

1) 5mg/mL of insulin was diluted to 0.05mg/mL with the coating solution.

2) 100uL of ELISA plate was added to each well and coated overnight at 4 ℃.

1.3ELISA experiments

1) Solution preparation: 2% (W/V) BSA (0.1 g BSA in 5mL PBS); PBST (1 mL of Tween-100 in 1L PBS, adjusted to pH 7.4).

2) ELISA Experimental procedure

The coated ELISA plate was removed, the coating solution was removed, and each well was rinsed 3 times with 260uL PBST;

add 100uL 2% (W/V) BSA to each well, block for 2h at 37 deg.C, rinse 3 times with 260uL PBST;

HRP-bearing insulin antibody was diluted 1% (W/V) with 2% (W/V) BSA and transfected cell supernatant, respectively, added to the well-blocked wells (100 uL/well), and incubated at 37 ℃ for 1h;

discarding liquid, rinsing each well with 260uL PBST for 3 times, adding 100uL TMB single-component developing solution, and incubating at 37 deg.C for 10min;

1moL/L sulfuric acid is added into each hole to terminate the reaction, and an OD value at 450mm is detected by using an enzyme-labeling instrument.

293T cells were transfected with pEGFP-C1, pCMV and pCMV-SIA, respectively, and cell supernatants were collected 48h later for insulin antibody binding experiments. ELISA experiments tested that SIA in the supernatant of cells transfected with pCMV-SIA could bind to insulin antibody and compete with human insulin. As shown in fig. 3, the experimental group was significantly higher than the blank group and the empty group (1.7 vs3.9 &3.9).

Example 2

SIA plasmid in vivo assay

C57BL/6J male mice, purchased at 6 weeks of age, acclimatized for 1 week, randomly grouped, set up: blank group (normal growth), control group (modeling, no treatment), mock group (modeling, injection of pEMS plasmid), exp1 group (modeling, injection of pCMV-SIA) and Exp2 group (modeling, injection of pEMS-SIA), with 8 mice per group.

Establishment of a type 1 diabetes mouse model: weighing the weight of the mouse, adding the citric acid buffer solution into Streptozotocin (STZ), uniformly mixing, carrying out intraperitoneal injection according to the dose of 60mg/kg, and finishing the injection within about 15 min. Following injection, fasting was performed for 2 hours. The injection is administered 1 time daily for 3 days. And collecting the blood of the mouse by a tail shearing method 72 hours after the injection is finished, and detecting the blood sugar by a Roche glucometer and a blood sugar test paper, wherein the successful construction of the diabetes model is considered when the blood sugar is more than 16.7mmol/L and is stable for 14 days.

The pEMS, pCMV-SIA and pEMS-SIA plasmids were mixed with EGCG and L64, respectively, 50ug of the plasmid was injected into each mouse, and the plasmids were injected into tibialis anterior muscles on both sides of the mouse, respectively, and one hour later, electric pulse treatment was performed (5 Hz,3min, intensity level 3). The mice of each group were fed and tested together in a common environment.

Mouse insulin C peptide detection

Proinsulin (Proinsulin) is cleaved from the middle part (C-peptide) by specific proteases, the a and B chains form insulin via disulfide bonds, and insulin is secreted into the blood in the same amount as the C-peptide. Peptide C levels may reflect the ability of islet beta cells to secrete insulin. Clinically, the presence of insulin antibodies in the serum of type 1 diabetic patients affects the radioimmunoassay for determining blood insulin levels, in which case the endogenous insulin secretion status can be known by measuring plasma C-peptide levels.

There are two reasons why the amount of insulin in blood is not directly measured: 1. the liver clears insulin too quickly. Once in the liver, insulin in the blood is rapidly degraded, and the half-life of insulin in the blood is only 5min. Peptide C is not inactivated by liver, and half-life is 10-11min.2. Most diabetics inject insulin, and the insulin in the blood includes insulin secreted by themselves and insulin injected, so that exogenous and endogenous insulin cannot be distinguished.

After modeling, blood samples were collected from mice using the retrocanthal venous plexus via the eye, centrifuged at 3000rpm for 20min in a pre-cooled 4 ℃ centrifuge, the supernatant carefully collected and stored temporarily at 4 ℃, short-term at-20 ℃ and long-term at-80 ℃. The detection was performed using the C-peptide detection kit according to the methods provided in the specification.

And continuously detecting blood sugar in the period before treatment after modeling until the blood sugar is stably increased, collecting blood samples of the mice by using retrobulbar venous plexus to detect whether the mice are successfully modeled. The detection mode is the same as that of the standard kit. As shown in fig. 4, a and B in the figure are HE staining of pancreas of the unmodeled group, and no lesion is found; C. d is the HE staining of mouse pancreas of the modeling group. The results show that C peptide was not detected in all groups of blood except the non-established group, indicating successful modeling. Then taking the pancreas of the mouse to carry out HE staining, and judging the pathological change condition of the pancreas

Mouse weight/blood glucose test

After diabetes mellitus, the blood sugar is increased, but because the absolute or relative deficiency of insulin causes that the glucose can not be utilized, fat is needed to be decomposed to provide energy, and the diabetes mellitus patients often have the symptoms of weight loss.

And (3) respectively detecting the weight and the blood sugar of the mouse by adopting an electronic balance and a Roche glucometer. Collecting blood drops of the mouse by a tail shearing method, and detecting blood sugar by a Roche glucometer and blood sugar test paper; the body weight of each mouse was measured simultaneously with each blood glucose measurement. After the model is established and before the treatment, the blood sugar and the weight are detected at intervals of 3 days in one week, and when the blood sugar state is stable in the later period, the blood sugar and the weight are detected at intervals of 6 days.

Five groups of mice were tested for changes in blood glucose levels (8 mice per group) during the 60 day period of treatment, as shown in figure 5. After treatment with different plasmids, the Mock and Saline groups did not improve significantly, while the mice in the EMS and CMV groups improved significantly, with some increase in body weight and a decrease in blood glucose levels, but the EMS group was closer to the normal mouse group.

Mouse diet/water consumption/survival assay

Typical symptoms of diabetes are polyuria, dry mouth, polydipsia, appetite, weight loss, i.e., more than three and less than one. After the blood sugar of a patient rises, the glucose in urine can be increased, the increase of urine sugar can generate osmotic diuresis, so that diuresis is caused, and the symptoms of dry mouth and thirst can be generated after diuresis.

In the process of mouse feeding and treatment, fixed time points are selected, the weights of food and drinking water at the two time points are weighed, and the food consumption and the water consumption of the mouse in the time period are calculated. Meanwhile, from the day of treatment, the mice were observed daily for gross color and survival, the dead mice were recorded, and finally statistical analysis was made on their survival using GraphPadprism.

As shown in fig. 6, mock and Saline groups did not significantly improve, while mice in EMS and CMV groups significantly improved, with reduced diet and water intake, and the EMS group was closer to the normal mice group than the normal mice group.

Glucose tolerance test in mice

The glucose tolerance test is mostly used for detecting suspicious diabetes. After a normal individual takes a certain amount of glucose, the blood sugar rises, but after a certain period of time, the body decomposes and utilizes the glucose under the action of insulin or synthesizes and stores glycogen, and the blood sugar is recovered to the fasting level. After a certain amount of glucose is taken, the blood glucose and urine glucose are measured at certain intervals, and the change of the blood glucose concentration before and after the glucose is given is analyzed to deduce the insulin secretion condition, wherein the measurement is called a glucose tolerance test.

Sugar tolerance experiments were performed on

days

12, 36, and 60, and mice were fasted overnight. The following day, mice were weighed and tested for blood glucose. The mice were injected intraperitoneally with glucose at 2g/kg and the blood glucose concentrations of the mice at 30, 60, 90, 120, 150, 180min were recorded.

As shown in fig. 7, mock and saline diabetic mice had little capacity for glucose treatment. Mice in the EMS group had some handling capacity, and were evident on

days

12 and 36, with less capacity at 60. In addition, the CMV group had lower blood glucose processing capacity than the EMS group.

In vivo insulin level detection in mice

Insulin is the only hormone which can reduce blood sugar in the body and is synthesized by islet beta cells, and can promote target cells in the liver, muscle, adipose tissue and the like to transport glucose in blood into cells through glucose transporters on cell membranes, and promote synthesis of glycogen, fat and protein.

According to the blood sugar trend of experimental mice, the serum insulin of each group of mice on

days

0, 12, 24, 36, 48 and 60 is detected, and the insulin expression conditions in the mice at different time periods under different treatment conditions are obtained.

Collecting blood sample of mouse by using retrobulbar venous plexus, centrifuging at 3000rpm for 20min in a precooled 4 deg.C centrifuge, carefully collecting supernatant, and temporarily storing at 4 deg.C for short term at-20 deg.C and long term at-80 deg.C. Detection was performed according to the method provided by the insulin detection kit.

As shown in FIG. 8, in serum insulin, the highest average expression level of EMS group was about 22. Mu.IU/mL, the highest average expression level of CMV group was about 17. Mu.IU/mL, the expression levels of the two groups were significantly different at

day

12, 48 and 60, and the sustained expression process of EMS group was closer to that of normal group.

Mice were observed for gross color and survival and recordings were made for each mouse dead as shown in figure 9.

HE staining of mouse tissue

The pancreas and liver of the experimental mice were HE stained to determine whether the organs of the mice in different treatment groups were diseased or were repaired after treatment.

The tissue is fixed by 4% paraformaldehyde for 24h and then dehydrated by a full-automatic dehydrator. The dehydration time is as follows: the preparation method comprises the following steps of (1) repeating the steps of 75% ethanol for 4h,85% ethanol for 2h,95% ethanol for 1h and 100% ethanol for 0.5h for four times, repeating xylene for 10min for 2 times and repeating paraffin for 1h for 3 times; embedding in paraffin and slicing; slicing, dewaxing and rehydrating; staining with hematoxylin for 10-20min; washing with tap water for 1-3min; alcohol differentiation with hydrochloric acid for 5-10s; washing with tap water for 1-3min; putting into warm water of 50 deg.C or weakly alkaline aqueous solution to turn blue until blue color appears; washing with tap water for 1-3min; adding 85% alcohol for 3-5min; staining with eosin for 3-5min; washing with water for 3-5s; dehydrating with gradient alcohol; the xylene is transparent; and (5) sealing by using neutral gum. Dehydrating, trimming, embedding, slicing, dyeing, sealing and the like, and finally performing microscopic examination. The Pannoramic 250 digital slice scanner produced by the Jinnandan Gill electronics company Limited is adopted to collect images of slices, each slice observes all tissues at the time of 40 times, large lesions are observed, areas to be observed are selected to collect 100-time and 400-time pictures, and specific lesions are observed.

As shown in fig. 10, the normal group was mice of the unmodeled group, and at the end of the experiment, mice were dissected and their livers and pancreas were collected. The results are as follows:

liver: the liver tissue structure is clear, the capsule is complete, the lobular lobule of the liver is not obvious, and the liver cord is arranged regularly; the liver cells are arranged radially around the central vein, and obvious degeneration and necrosis are not seen; the hepatic sinus structure is normal, and obvious extravasated blood expansion and inflammatory cell infiltration are not seen; the structures of the interlobular artery, vein and bile duct in the portal area are relatively complete, and obvious fibroplasia or inflammatory cell infiltration is not seen; no obvious pathological changes are found in the other.

Pancreas: the pancreatic tissue structure is clear, and a thin connective tissue capsule is complete, so that a complete leaf-shaped structure can be seen; the acinar epithelial cells are arranged closely in a single layer, the staining is uniform, and the individual acinar epithelial cells are degenerated and necrotized; the structure of the ducts and blood vessels between the lobules is clear, and obvious hyperplasia or inflammatory cell infiltration is not seen; the islet cell masses are different in size, the boundaries are clear, the shapes of various cells in the island are normal, the nucleus is clear, and obvious degeneration or necrosis is not seen; no obvious pathological changes are found in the other samples.

Experimental groups were modeled for mice under different treatment conditions. Saline group (modeled, untreated), mock group (modeled, injected pEMS plasmid), exp1 group (modeled, injected pCMV-SIA) and Exp2 group (modeled, injected pEMS-SIA), with 8 mice per group. After the experiment, the mouse is dissected, and the liver and pancreas are taken. The observation results are:

liver: the liver tissue structure is clear, the capsule is complete, the lobular lobule of the liver is not obvious, and the liver cord is arranged regularly; the liver cells are radially arranged around the central vein, a small amount of liver cells are degenerated and necrotized, necrotic liver cells are subjected to cytonuclear condensation, and cytoplasm is sparse; a small amount of lymphocyte or neutrophil foci can be seen in the portal area and the peripheral liver lobules; no obvious pathological changes are found in the other samples.

Pancreas: the pancreas tissue structure is relatively clear, and a thin connective tissue capsule is complete, so that a complete leaf-shaped structure can be seen; the acinar epithelial cells are arranged in a monolayer and close manner, the staining is uniform, and the individual acinar epithelial cells are degenerated and necrotized; islet cell masses are different in size, the boundaries are clear, islet cells are denatured and necrotic, necrotic cells are dyed shallowly, the light transmittance is enhanced, nuclei are fixed and contracted, the cells are deeply dyed, and vacuoles different in size are contained in cytoplasm; no obvious pathological changes are found in the other.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

/>

/>

/>

/>

/>

/>

/>

/>

/>

SEQUENCE LISTING

<110> institute of biology of Chengdu of Chinese academy of sciences of Sichuan university

<120> recombinant expression vector for specifically and highly expressing SIA in myogenic cells and application thereof

<130> 1

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 689

<212> DNA

<213> Artificial sequence

<400> 1

ttgatgtact gccaagttgg aaagtcccgt tagtgcccat tgacgtcaat aatatatggc 60

gacggccggg cccctccctg gggacagccc cggtgtggaa agtccccagg ctccccagca 120

ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccaggactat ataaaaaacc 180

tgacccgata tgcctggcca gccaatagcg gtgtggaaag tccccaggct ccccagcagg 240

cagaagtatg caaagcatgc atctcaatta gtcagcaacc agacacccaa atatggcgac 300

gggtgaggaa tggtgaccaa gtcagcaggt gtggaaagtc cccaggctcc ccagcaggca 360

gaagtatgca aagcatgcat ctcaattagt cagcaaccac caacacctgc tgcctgcccg 420

ctctaaaaat aactcccggc ttcaggtttc cctagggccc ctccctgggg acagccccat 480

atggcgacgg ccccccattg acgtcaatgg gacggtaaat ggcccgcctg gcgcccattg 540

acgtcaataa tccagccaat agcacccgat atgcctgggg actatataaa aaacctggga 600

cacccgagat gcctggttac aaggcctggg gacacgctct aaaaataact cccccaacac 660

ctgctgcctg ccggcttcag gtttcccta 689

<210> 2

<211> 276

<212> DNA

<213> Artificial sequence

<400> 2

attatggccc tgttggtgca cttcctaccc ctgctggccc tgcttgccct ctgggagccc 60

aaacccaccc aggcttttgt caaacagcat ctttgtggtc cccacctggt agaggctctc 120

tacctggtgt gtggggagcg tggcttcttc tacacaccca agtccggagg cggtgggagt 180

ggcggaggtg ggagcggtgg aggcgggagt ggcattgtgg atcagtgctg caccagcatc 240

tgctccctct accagctgga gaactactgc aactaa 276

<210> 3

<211> 5506

<212> DNA

<213> Artificial sequence

<400> 3

cggtgtagac tttctctatc gataggtacc ttgatgtact gccaagttgg aaagtcccgt 60

tagtgcccat tgacgtcaat aatatatggc gacggccggg cccctccctg gggacagccc 120

cggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat 180

tagtcagcaa ccaggactat ataaaaaacc tgacccgata tgcctggcca gccaatagcg 240

gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta 300

gtcagcaacc agacacccaa atatggcgac gggtgaggaa tggtgaccaa gtcagcaggt 360

gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat ctcaattagt 420

cagcaaccac caacacctgc tgcctgcccg ctctaaaaat aactcccggc ttcaggtttc 480

cctagggccc ctccctgggg acagccccat atggcgacgg ccccccattg acgtcaatgg 540

gacggtaaat ggcccgcctg gcgcccattg acgtcaataa tccagccaat agcacccgat 600

atgcctgggg actatataaa aaacctggga cacccgagat gcctggttac aaggcctggg 660

gacacgctct aaaaataact cccccaacac ctgctgcctg ccggcttcag gtttccctac 720

tcgagatctg cgatctaagt aagcttggca ttccggtact gttggtaaag ccaccatgga 780

agacgccaaa aacataaaga aaggcccggc gccattctat ccgctggaag atggaaccgc 840

tggagagcaa ctgcataagg ctatgaagag atacgccctg gttcctggaa caattgcttt 900

tacagatgca catatcgagg tggacatcac ttacgctgag tacttcgaaa tgtccgttcg 960

gttggcagaa gctatgaaac gatatgggct gaatacaaat cacagaatcg tcgtatgcag 1020

tgaaaactct cttcaattct ttatgccggt gttgggcgcg ttatttatcg gagttgcagt 1080

tgcgcccgcg aacgacattt ataatgaacg tgaattgctc aacagtatgg gcatttcgca 1140

gcctaccgtg gtgttcgttt ccaaaaaggg gttgcaaaaa attttgaacg tgcaaaaaaa 1200

gctcccaatc atccaaaaaa ttattatcat ggattctaaa acggattacc agggatttca 1260

gtcgatgtac acgttcgtca catctcatct acctcccggt tttaatgaat acgattttgt 1320

gccagagtcc ttcgataggg acaagacaat tgcactgatc atgaactcct ctggatctac 1380

tggtctgcct aaaggtgtcg ctctgcctca tagaactgcc tgcgtgagat tctcgcatgc 1440

cagagatcct atttttggca atcaaatcat tccggatact gcgattttaa gtgttgttcc 1500

attccatcac ggttttggaa tgtttactac actcggatat ttgatatgtg gatttcgagt 1560

cgtcttaatg tatagatttg aagaagagct gtttctgagg agccttcagg attacaagat 1620

tcaaagtgcg ctgctggtgc caaccctatt ctccttcttc gccaaaagca ctctgattga 1680

caaatacgat ttatctaatt tacacgaaat tgcttctggt ggcgctcccc tctctaagga 1740

agtcggggaa gcggttgcca agaggttcca tctgccaggt atcaggcaag gatatgggct 1800

cactgagact acatcagcta ttctgattac acccgagggg gatgataaac cgggcgcggt 1860

cggtaaagtt gttccatttt ttgaagcgaa ggttgtggat ctggataccg ggaaaacgct 1920

gggcgttaat caaagaggcg aactgtgtgt gagaggtcct atgattatgt ccggttatgt 1980

aaacaatccg gaagcgacca acgccttgat tgacaaggat ggatggctac attctggaga 2040

catagcttac tgggacgaag acgaacactt cttcatcgtt gaccgcctga agtctctgat 2100

taagtacaaa ggctatcagg tggctcccgc tgaattggaa tccatcttgc tccaacaccc 2160

caacatcttc gacgcaggtg tcgcaggtct tcccgacgat gacgccggtg aacttcccgc 2220

cgccgttgtt gttttggagc acggaaagac gatgacggaa aaagagatcg tggattacgt 2280

cgccagtcaa gtaacaaccg cgaaaaagtt gcgcggagga gttgtgtttg tggacgaagt 2340

accgaaaggt cttaccggaa aactcgacgc aagaaaaatc agagagatcc tcataaaggc 2400

caagaagggc ggaaagatcg ccgtgtaatt ctagagtcgg ggcggccggc cgcttcgagc 2460

agacatgata agatacattg atgagtttgg acaaaccaca actagaatgc agtgaaaaaa 2520

atgctttatt tgtgaaattt gtgatgctat tgctttattt gtaaccatta taagctgcaa 2580

taaacaagtt aacaacaaca attgcattca ttttatgttt caggttcagg gggaggtgtg 2640

ggaggttttt taaagcaagt aaaacctcta caaatgtggt aaaatcgata aggatccgtc 2700

gaccgatgcc cttgagagcc ttcaacccag tcagctcctt ccggtgggcg cggggcatga 2760

ctatcgtcgc cgcacttatg actgtcttct ttatcatgca actcgtagga caggtgccgg 2820

cagcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga 2880

gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca 2940

ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg 3000

ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt 3060

cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc 3120

ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct 3180

tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc 3240

gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta 3300

tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca 3360

gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag 3420

tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag 3480

ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt 3540

agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa 3600

gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg 3660

attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga 3720

agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta 3780

atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc 3840

cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg 3900

ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccgga 3960

agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt 4020

tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt 4080

gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc 4140

caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc 4200

ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca 4260

gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag 4320

tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg 4380

tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa 4440

cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa 4500

cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga 4560

gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga 4620

atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg 4680

agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt 4740

ccccgaaaag tgccacctga cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg 4800

gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc tttcgctttc 4860

ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcgggggctc 4920

cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgattagggt 4980

gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt gacgttggag 5040

tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg 5100

gtctattctt ttgatttata agggattttg ccgatttcgg cctattggtt aaaaaatgag 5160

ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgcttac aatttgccat 5220

tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc ttcgctatta 5280

cgccagccca agctaccatg ataagtaagt aatattaagg tacgggaggt acttggagcg 5340

gccgcaataa aatatcttta ttttcattac atctgtgtgt tggttttttg tgtgaatcga 5400

tagtactaac atacgctctc catcaaaaca aaacgaaaca aaacaaacta gcaaaatagg 5460

ctgtccccag tgcaagtgca ggtgccagaa catttctcta tcgata 5506

<210> 4

<211> 5715

<212> DNA

<213> Artificial sequence

<400> 4

gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60

ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120

cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180

ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgtttgatgt 240

actgccaagt tggaaagtcc cgttagtgcc cattgacgtc aataatatat ggcgacggcc 300

gggcccctcc ctggggacag ccccggtgtg gaaagtcccc aggctcccca gcaggcagaa 360

gtatgcaaag catgcatctc aattagtcag caaccaggac tatataaaaa acctgacccg 420

atatgcctgg ccagccaata gcggtgtgga aagtccccag gctccccagc aggcagaagt 480

atgcaaagca tgcatctcaa ttagtcagca accagacacc caaatatggc gacgggtgag 540

gaatggtgac caagtcagca ggtgtggaaa gtccccaggc tccccagcag gcagaagtat 600

gcaaagcatg catctcaatt agtcagcaac caccaacacc tgctgcctgc ccgctctaaa 660

aataactccc ggcttcaggt ttccctaggg cccctccctg gggacagccc catatggcga 720

cggcccccca ttgacgtcaa tgggacggta aatggcccgc ctggcgccca ttgacgtcaa 780

taatccagcc aatagcaccc gatatgcctg gggactatat aaaaaacctg ggacacccga 840

gatgcctggt tacaaggcct ggggacacgc tctaaaaata actcccccaa cacctgctgc 900

ctgccggctt caggtttccc tagctagcgt ttaaacttaa gcttggtacc gagctcggat 960

ccattatggc cctgttggtg cacttcctac ccctgctggc cctgcttgcc ctctgggagc 1020

ccaaacccac ccaggctttt gtcaaacagc atctttgtgg tccccacctg gtagaggctc 1080

tctacctggt gtgtggggag cgtggcttct tctacacacc caagtccgga ggcggtggga 1140

gtggcggagg tgggagcggt ggaggcggga gtggcattgt ggatcagtgc tgcaccagca 1200

tctgctccct ctaccagctg gagaactact gcaactaaga attctgcaga tatccagcac 1260

agtggcggcc gctcgagtct agagggcccg tttaaacccg ctgatcagcc tcgactgtgc 1320

cttctagttg ccagccatct gttgtttgcc cctcccccgt gccttccttg accctggaag 1380

gtgccactcc cactgtcctt tcctaataaa atgaggaaat tgcatcgcat tgtctgagta 1440

ggtgtcattc tattctgggg ggtggggtgg ggcaggacag caagggggag gattgggaag 1500

acaatagcag gcatgctggg gatgcggtgg gctctatggc ttctgaggcg gaaagaacca 1560

gctggggctc tagggggtat ccccacgcgc cctgtagcgg cgcattaagc gcggcgggtg 1620

tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc gctcctttcg 1680

ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg 1740

ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa aaacttgatt 1800

agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt 1860

tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca ctcaacccta 1920

tctcggtcta ttcttttgat ttataaggga ttttgccgat ttcggcctat tggttaaaaa 1980

atgagctgat ttaacaaaaa tttaacgcga attaattctg tggaatgtgt gtcagttagg 2040

gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta 2100

gtcagcaacc aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat 2160

gcatctcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac 2220

tccgcccagt tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga 2280

ggccgaggcc gcctctgcct ctgagctatt ccagaagtag tgaggaggct tttttggagg 2340

cctaggcttt tgcaaaaagc tcccgggagc ttgtatatcc attttcggat ctgatcaaga 2400

gacaggatga ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc 2460

cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga 2520

tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct 2580

gtccggtgcc ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac 2640

gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct 2700

attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt 2760

atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt 2820

cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt 2880

cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag 2940

gctcaaggcg cgcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt 3000

gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg 3060

tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg 3120

cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg 3180

catcgccttc tatcgccttc ttgacgagtt cttctgagcg ggactctggg gttcgaaatg 3240

accgaccaag cgacgcccaa cctgccatca cgagatttcg attccaccgc cgccttctat 3300

gaaaggttgg gcttcggaat cgttttccgg gacgccggct ggatgatcct ccagcgcggg 3360

gatctcatgc tggagttctt cgcccacccc aacttgttta ttgcagctta taatggttac 3420

aaataaagca atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt 3480

tgtggtttgt ccaaactcat caatgtatct tatcatgtct gtataccgtc gacctctagc 3540

tagagcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca 3600

attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg 3660

agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg 3720

tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc 3780

tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 3840

tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 3900

aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 3960

tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 4020

tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 4080

cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 4140

agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 4200

tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 4260

aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 4320

ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 4380

cctaactacg gctacactag aagaacagta tttggtatct gcgctctgct gaagccagtt 4440

accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 4500

ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 4560

atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 4620

atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa 4680

tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag 4740

gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg 4800

tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga 4860

gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag 4920

cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa 4980

gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc 5040

atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca 5100

aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg 5160

atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat 5220

aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc 5280

aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg 5340

gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg 5400

gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt 5460

gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca 5520

ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata 5580

ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac 5640

atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa 5700

gtgccacctg acgtc 5715

Claims

1. A recombinant expression vector for expressing SIA in myogenic cells is characterized in that a promoter of the recombinant expression vector is PEMS, and the nucleotide sequence of the recombinant expression vector is shown as SEQ ID NO. 1; the nucleotide sequence for coding SIA is shown in SEQ ID NO. 2.

2. The method for constructing the recombinant expression vector of claim 1, comprising the steps of:

3. The construction method according to claim 2, wherein the primer sequences for amplifying the EMS fragment are respectively as follows:

EMS-F: 5’-CGACGCGTTTGATGTACTGCCAAGTTGGAAAGTC-3’；

EMS-R: 5’-CTAGCTAGCTAGGGAAACCTGAAGCCGGCA-3’。

4. the recombinant expression vector of claim 1, and the use of the recombinant expression vector constructed by the method of claim 2 or 3 in the preparation of a medicament for treating type 1 diabetes.